A SNP marker related to intramuscular fat content character of rongcheng pig and detection primer and application thereof

Abstract

The application discloses a SNP marker related to an intramuscular fat content character of Rongchang pigs, a detection primer and application, and belongs to the technical field of molecular biology. The application develops a SNP marker and a detection primer related to the intramuscular fat content character of Rongchang pigs based on a SNP marker technology. The SNP marker developed by the application is located at 121626638 bp of a No. 7 chromosome of Rongchang pigs, and relates to C / T mutation. When the genotype is CT, the intramuscular fat content of Rongchang pigs is significantly higher than that of the TT genotype. The SNP marker can screen out individuals with excellent intramuscular fat content, so that the level of the intramuscular fat content character of Rongchang pigs is improved, and the breeding process of new breeds is accelerated.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of molecular biology, and particularly relates to a SNP marker related to the intramuscular fat content trait of Rongchang pigs, a detection primer and application. BACKGROUND

[0002] In modern farming, the quality characteristics of pork directly affect market value and consumer satisfaction, especially the intramuscular fat (IMF) content. The IMF content not only determines the flavor, tenderness and juiciness of meat, but also is closely related to the preferences of consumers for meat products. With the improvement of living standards, consumers' demand for high-quality pork is increasing, therefore, the research and improvement of IMF content has become a key issue in pig farming. Studies have shown that the formation of IMF is influenced by multiple genetic factors. These genetic factors can be identified through single nucleotide polymorphism (SNP) molecular markers, especially the gene loci closely related to meat quality characteristics. SNP markers are considered as an effective tool for predicting and selecting excellent meat quality characteristics. By identifying SNPs related to IMF content, breeders can more effectively screen individuals with excellent genetic characteristics during breeding, thereby significantly improving the efficiency of selection and reducing the time cost and economic risk brought by traditional methods.

[0003] Rongchang pigs, as a unique high-quality local breed in China, have received widespread attention in the market in recent years due to their high IMF content and unique flavor. Their outstanding meat quality characteristics make them highly competitive in the market, but traditional breeding methods are difficult to quickly meet the demand for high-quality meat products. Therefore, combining modern molecular marker technology to genetically improve Rongchang pigs has become an important means to improve their meat quality and market competitiveness. SUMMARY

[0004] In order to solve the above-mentioned deficiencies existing in the prior art, the purpose of the present application is to provide a SNP marker related to the intramuscular fat content trait of Rongchang pigs, a detection primer and application, so as to provide a new SNP marker for the genetic improvement of Rongchang pigs with high intramuscular fat content.

[0005] The technical scheme for solving the above-mentioned technical problems of the present application is as follows: a SNP marker related to the intramuscular fat content trait of Rongchang pigs is provided, the SNP marker is located at 121626638bp on chromosome 7 of Rongchang pigs; the nucleotide sequence of the gene where the SNP marker is located is shown in SEQ ID NO. 1 or SEQ ID NO. 2.

[0006] Further, the Rongchang pig is a purebred Rongchang pig.

[0007] Further, the SNP marker is located at the 206th bp of the nucleotide sequence shown in SEQ ID NO. 1 or SEQ ID NO. 2; and the genotype of the SNP marker is CT or TT.

[0008] The application provides a primer composition for detecting the SNP marker, which comprises an upstream primer F and a downstream primer R; the nucleotide sequence of the upstream primer F is shown in SEQ ID NO. 3; and the nucleotide sequence of the downstream primer R is shown in SEQ ID NO. 4.

[0009] The application provides application of the SNP marker in determination of intramuscular fat content of Rongchang pigs, improvement of intramuscular fat content of Rongchang pigs or Rongchang pig genetic breeding.

[0010] The application provides a method for detecting intramuscular fat content of Rongchang pigs, which comprises the following steps:

[0011] (1) extracting genomic DNA of the Rongchang pig to be detected;

[0012] (2) using the genomic DNA of the Rongchang pig to be detected as a template, performing PCR amplification by using the primer composition according to claim 4 to obtain a PCR product;

[0013] (3) performing sequencing on the PCR product, analyzing the genotype of the SNP marker; if the genotype is CT, it is determined that the intramuscular fat content of the Rongchang pig to be detected is high; if the genotype is TT, it is determined that the intramuscular fat content of the Rongchang pig to be detected is low.

[0014] Further, the PCR amplification system comprises SYBR, the upstream primer F, the downstream primer R, a DNA template and RNase Free H2O; and the PCR amplification procedure is as follows: 98℃ pre-denaturation for 3 min, 1 cycle; 98℃ denaturation for 10 s, 55-65℃ annealing for 20-30 s, 72℃ extension for 30 s / kb, 23-35 cycles; 72℃ terminal extension for 1-5 min, 1 cycle; and 4℃ incubation.

[0015] The application provides a method for genetic improvement of intramuscular fat content traits of Rongchang pigs, which comprises the following steps: performing PCR amplification on genomic DNA of the Rongchang pig to be detected by using the primer composition, analyzing the genotype of the SNP marker of the Rongchang pig to be detected, and determining Rongchang pigs with high / low intramuscular fat content for subsequent production according to the genotype.

[0016] The application provides a breeding method for Rongchang pigs with high intramuscular fat content, which comprises the following steps: selecting Rongchang pigs with the genotype CT of the SNP marker for subsequent production by using the method for genetic improvement of intramuscular fat content traits of Rongchang pigs.

[0017] The application further provides a kit for detecting the intramuscular fat content of Rongchang pigs, comprising the primer composition.

[0018] The application has the following beneficial effects: the application develops a SNP marker and a detection primer related to the intramuscular fat content trait of Rongchang pigs based on the SNP marker technology. The SNP marker developed by the application is located at 121626638 bp of chromosome 7 in the 11.1 version of the pig reference genome, and involves C / T mutation. When the genotype is CT, the intramuscular fat content of Rongchang pigs is significantly higher than that of the TT genotype. The SNP marker of the application can be used to screen individuals with excellent intramuscular fat content, thereby improving the level of the intramuscular fat content trait of Rongchang pigs, and can be used for early judgment of the IMF content trait of Rongchang pigs and accelerate the breeding process of new breeds. BRIEF DESCRIPTION OF DRAWINGS

[0019] Figure 1 It is a Manhattan plot of the IMF content trait of Rongchang pigs in GWAS analysis.

[0020] Figure 2 It is a histogram of the IMF content of the SNP site in 485 Rongchang pigs. DETAILED DESCRIPTION

[0021] The following examples are only used to explain the application, and are not used to limit the scope of the application. If the specific conditions are not indicated in the examples, the conventional conditions or the conditions recommended by the manufacturer are used. If the reagents or instruments used are not indicated by the manufacturer, they are all conventional products that can be purchased on the market.

[0022] Example 1: Obtaining of the SNP marker related to the intramuscular fat content of Rongchang pigs

[0023] (1) Sample collection and acquisition of IMF phenotype data: 485 purebred samples of Rongchang pigs were collected, and the samples were from the Rongchang pig national breeding farm in Rongchang District, Chongqing, and the IMF content phenotype data of the samples were collected.

[0024] (2) Sample treatment and IMF content determination: the test pigs were slaughtered at 180±5 days, and were sent to a slaughterhouse for unified slaughter. The longissimus dorsi muscle at the 6th-12th rib of the Rongchang pig was collected, 25 g of the longissimus dorsi muscle was weighed, and was placed in a freeze dryer for dehydration to a constant weight. The quantitative filter paper was dried to a constant weight, and the dried filter paper was weighed on a precision balance, then 3 g of the dried sample was weighed and wrapped with filter paper. The fat package was placed in a Soxhlet extractor, and was extracted with anhydrous diethyl ether for 9 h. After the extraction was completed, the fat package was dried again to a constant weight. The IMF content was calculated according to the following formula:

[0025] IMF=(m2-m3) / (m2-m1)×100%

[0026] Wherein: m1 is the weight of the dried filter paper; m2 is the weight of the fat package; m3 is the weight of the fat package after extraction.

[0027] (3) Rongchang pig DNA extraction and quality inspection: Whole genome DNA of each ear tissue sample was extracted using DNA extraction kit (DNA Mini Kit). The DNA quality was detected by Nanodrop 2000 spectrophotometer and 1% agarose gel electrophoresis. The qualified standard was that the concentration was >100 ng / μL, the OD260 / 280 ratio was between 1.8-2.0, the A260 / 230 ratio was 1.7-1.9, the gel electrophoresis band was clear without degradation, and the sample was diluted to 50 ng / μL for subsequent experiments.

[0028] (4) Genotyping detection by gene chip: 485 Rongchang pigs were genotyped by liquid 66K chip. Plink (v1.90) software was used for data quality control. The quality control conditions included: removing chromosomal position information, X and Y chromosome sites, individual SNP detection rate >90%, SNP site detection rate >95%, and finally 485 individuals and 64,249 SNP sites were reserved for subsequent analysis.

[0029] (5) Whole genome resequencing and data processing: 120 Rongchang pigs of the core group were selected for 30x whole genome sequencing, and FastQC software was used for quality assessment. The cleaned data (clean reads) was aligned with the pig reference genome (Sscrofa11.1) by BWA software. SAMtools was used to convert SAM files to BAM files, and markdup program of Picard was used to remove PCR duplicates. GATK software was used for SNP site calling, and quality control was performed according to the quality standard. In subsequent analysis, autosomal SNP sites with MAF≥0.05, deletion rate <10 -6 , read length depth≥6 were used as genotype filling reference, and finally 27,133,287 SNP sites were reserved.

[0030] (6) Genotype filling: Beagle5.1 software was used to fill the genotypes of 485 Rongchang pigs based on the whole genome resequencing data of 120 Rongchang pigs. To evaluate the filling accuracy, the whole genome data of 30 Rongchang pigs were randomly selected for comparison, the filling accuracy was calculated, and the SNP with accuracy of 1.00 and MAF≥0.01 was reserved for data analysis.

[0031] (7) Genome-wide association study (GWAS): Using the GEMMA software, a univariate mixed model was used to analyze the IMF content traits of Rongchang pigs by GWAS. The principal components (gender, weight, age, etc.) were used as covariates to correct the model, and the significance threshold was Bonferroni corrected P value (P = 0.05 / N, N is the number of SNPs) log10, the collected pork IMF phenotype traits were analyzed by genome-wide association study, and the significantly associated SNP sites were calculated. P

[0032] From Figure 1 it can be seen that the C / T site mutation at position 121626638 on chromosome 7 of Rongchang pigs is significantly associated with IMF content ( p = 4.38 x 10 -9 ). In the 485 Rongchang pig population, it was found that the molecular marker at position chr7: 121626638 had a significant phenotypic effect. From Figure 2 and Table 1, it can be seen that the chr7: 121626638 site exists in two genotypes in the Rongchang pig population: CT and TT, and the average IMF content of the CT type Rongchang pig is about 0.056; the average IMF content of the TT type Rongchang pig is about 0.037. Through unpaired t-test analysis, it can be seen that the IMF content of the CT type Rongchang pig has a significant difference with the IMF content of the TT type Rongchang pig ( p< 0.0001).

[0033] Table 1 IMF content phenotype value of 485 Rongchang pigs

[0034]

[0035] Example 2 Primer design and screening verification of SNP markers related to IMF content of Rongchang pigs

[0036] After screening the target SNP marker (chr7: 121626638) in Example 1, the sequence of the gene where the SNP site is located is extracted, and the specific primers of the SNP marker are designed and synthesized, and then the SNP marker is screened and tested, as follows:

[0037] (1) After obtaining the target SNP marker (chr7: 121626638), referring to the Sus Scrofa 11.1 reference genome, a sequence containing 400 bp before and after the SNP marker is extracted, and the specific nucleotide sequence is shown in SEQ ID NO. 1 or SEQ ID NO. 2. The specific primers of the SNP marker are designed using Primer Premier 6, and the nucleotide sequences of the upstream primer F and the downstream primer R are as follows:

[0038] ​F: 5'-CGTGTGTGTGTTGGGACTCA-3' (SEQ ID NO. 3);

[0039] R: 5'-GAAGGAGCTGAGAGGTTGGG-3' (SEQ ID NO. 4).

[0040] (2) 50 purebred Rongchang pigs at 35 days of age were randomly selected from the Rongchang pig national breeding farm in Rongchang County, Chongqing, for verifying the application effect of the specific primer designed for the SNP marker on early prediction of IMF content of Rongchang pigs. Ear tissue of 50 Rongchang pigs to be tested was collected, genomic DNA was extracted as a template, and the DNA was diluted to 100 ng / μL; the specific primer was diluted to 10 μmol / L, PCR amplification was carried out using the specific primer, and a PCR product was obtained; wherein the amplification system is shown in Table 2, and the amplification program is shown in Table 3. The PCR product of the Rongchang pig to be tested was purified and recovered by electrophoresis on 2% agarose, and the genotype of the polymorphic site of the Rongchang pig SNP marker was analyzed by sequencing results. The sequencing results show that among the 50 Rongchang pigs to be tested, 8 have the genotype CT, and 42 have the genotype TT.

[0041] Table 2 Amplification system

[0042]

[0043] Table 3 Amplification program

[0044]

[0045] (3) The 50 Rongchang pigs to be tested were slaughtered when they reached 6 months of age, IMF content determination was carried out (see Example 1, Step 2 for specific methods), and the predicted IMF content according to the genotype at 35 days of age was compared to verify the effect of the SNP marker in early judgment and IMF content trait evaluation application of Rongchang pigs.

[0046] The results are shown in Table 4. The IMF content of the Rongchang pigs with the genotype CT is higher than that of the Rongchang pigs with the genotype TT, and there is a significant difference (P<0.0001), indicating that the primer designed for the SNP marker has practical significance in early prediction of IMF content of Rongchang pigs. p<

[0047] Table 4 Genotype and corresponding IMF content of 50 Rongchang pigs to be tested

[0048]

[0049] The nucleotide sequence of the gene where the SNP marker is located is as follows:

[0050] ​1. TTGAGAATTCTACCCAACACCCTCTGCATCTGAGTATTTCCAAGCCGTTGGGTGGAAATAGACATGGGTCCCAGGCCCGTGTGTGTGTTGGGACTCACTCTTCGCTCTCCTCGTTTTGAATGGCGTGAGGGTTTTGTTGTTGTTGTTTTATTCTTGGGTTTCAGCAACTACCAACCTCAGCTGGTTTTCCCCAGAAGGGCACTGTCAGTCCTCTGCTGGGGACACGGGGGACCCTGTGCCGCCCTCCAGGGCCTTCTTTCCCCTGGCGGAACTCCTCTCTAGGCACTCTAGTGGCCTTGGTGTCCCCAACCTCTCAGCTCCTTCTCCTGGACTCGGGGCCCTTCAGGGGCCGCCCCAGCCCCCATCCCTGCCCCACAGCCCGGAGGGCTCCCAAGGAAGG (SEQ ID NO. 1);

[0051] 2. TTGAGAATTCTACCCAACACCCTCTGCATCTGAGTATTTCCAAGCCGTTGGGTGGAAATAGACATGGGTCCCAGGCCCGTGTGTGTGTTGGGACTCACTCTTCGCTCTCCTCGTTTTGAATGGCGTGAGGGTTTTGTTGTTGTTGTTTTATTCTTGGGTTTCAGCAACTACCAACCTCAGCTGGTTTTCCCCAGAAGGGCACTGTTAGTCCTCTGCTGGGGACACGGGGGACCCTGTGCCGCCCTCCAGGGCCTTCTTTCCCCTGGCGGAACTCCTCTCTAGGCACTCTAGTGGCCTTGGTGTCCCCAACCTCTCAGCTCCTTCTCCTGGACTCGGGGCCCTTCAGGGGCCGCCCCAGCCCCCATCCCTGCCCCACAGCCCGGAGGGCTCCCAAGGAAGG (SEQ ID NO. 2).

[0052] The above description is merely that of the preferred embodiments of the present application, and is not intended to limit the present application. Modification and equivalents of the present application are intended to be included within the scope of the present application. Therefore, the true scope and spirit of the present application should be defined by the appended claims.

Claims

1. Use of a reagent for detecting SNP markers associated with the intramuscular fat content trait of Rongchang pigs in determining the intramuscular fat content of Rongchang pigs, characterized in that: If its genotype is CT, the intramuscular fat content of the Rongchang pig to be tested is determined to be high fat content; if its genotype is TT, the intramuscular fat content of the Rongchang pig to be tested is determined to be low fat content; the SNP marker is located at the 206th bp of the nucleotide sequence shown in SEQ ID NO.1 or SEQ ID NO.2; the genotype of the SNP marker is CT or TT.

2. Use of a reagent for detecting SNP markers associated with the intramuscular fat content trait of Rongchang pigs in increasing the intramuscular fat content of Rongchang pigs; characterized in that: Rongchang pigs with a SNP marker genotype of CT are selected for subsequent production; the SNP marker is located at the 206th bp of the nucleotide sequence shown in SEQ ID NO.1 or SEQ ID NO.2; the genotype of the SNP marker is CT or TT.

3. Use of a reagent for detecting SNP markers associated with the intramuscular fat content trait of Rongchang pigs in Rongchang pig genetic breeding, characterized in that: Rongchang pigs with a SNP marker genotype of CT are selected for subsequent production; the SNP marker is located at the 206th bp of the nucleotide sequence shown in SEQ ID NO.1 or SEQ ID NO.2; the genotype of the SNP marker is CT or TT.

4. A method for detecting the intramuscular fat content of Rongchang pigs, characterized in that: The following steps are involved: (1) Extracting genomic DNA from Rongchang pigs to be tested; (2) Using the genomic DNA of the Rongchang pig to be tested as a template, PCR amplification is performed using the primer combination to obtain a PCR product; (3) Sequencing the PCR product and analyzing the genotype of the SNP marker; if the genotype is CT, the intramuscular fat content of the Rongchang pig to be tested is determined to be high fat content; if the genotype is TT, the intramuscular fat content of the Rongchang pig to be tested is determined to be low fat content; The primer composition in step (2) comprises an upstream primer F and a downstream primer R; the nucleotide sequence of the upstream primer F is shown in SEQ ID NO.3; the nucleotide sequence of the downstream primer R is shown in SEQ ID NO.4; The SNP marker is located at the 206th bp of the nucleotide sequence shown in SEQ ID NO.1 or SEQ ID NO.2; the genotype of the SNP marker is CT or TT.

5. The method for detecting the intramuscular fat content of Rongchang pig according to claim 4, wherein The PCR amplification system includes: SYBR, upstream primer F, downstream primer R, DNA template and RNase-free H2O; the PCR amplification program is: 98°C pre-denaturation for 3 minutes, 1 cycle; 98°C denaturation for 10 seconds, 55-65°C annealing for 20-30 seconds, 72°C extension for 30 seconds / kb, 23-35 cycles; 72°C final extension for 1-5 minutes, 1 cycle; and 4°C insulation.

6. A method for genetically improving the intramuscular fat content trait of Rongchang pigs, characterized in that: The method comprises the following steps: performing PCR amplification on genomic DNA of a Rongchang pig to be tested using a primer combination, analyzing the genotype of a SNP marker of the Rongchang pig to be tested, and determining Rongchang pigs with high / low intramuscular fat content for subsequent production based on the genotype; if the genotype is CT, determining the intramuscular fat content of the Rongchang pig to be tested as high fat content; if the genotype is TT, determining the intramuscular fat content of the Rongchang pig to be tested as low fat content; and selecting Rongchang pigs with the genotype of the SNP marker being CT for subsequent production; The primer composition includes an upstream primer F and a downstream primer R; the nucleotide sequence of the upstream primer F is shown in SEQ ID NO.3; the nucleotide sequence of the downstream primer R is shown in SEQ ID NO.4; The SNP marker is located at the 206th bp of the nucleotide sequence shown in SEQ ID NO.1 or SEQ ID NO.2; the genotype of the SNP marker is CT or TT.

7. A method for breeding Rongchang pigs with high intramuscular fat content, characterized in that: The following steps are involved: The method according to claim 6 is used to select Rongchang pigs whose SNP marker genotype is CT for subsequent production; the SNP marker is located at the 206th bp of the nucleotide sequence shown in SEQ ID NO.1 or SEQ ID NO.2; the genotype of the SNP marker is CT or TT.

Images