SNP (Single Nucleotide Polymorphism) combination for plasmodium vivax traceability and application thereof

Abstract

The invention discloses a plasmodium vivax SNP (Single Nucleotide Polymorphism) molecular marker combination and application thereof in tracing. The 15 SNP molecular markers provided by the invention are mutually independent, and the molecular marker combination can effectively identify Chinese inland plasmodium vivax. According to the invention, 15 SNP molecular markers are obtained through identification by a high-throughput gene mass spectrum chip method, and an SNPs information group of plasmodium vivax is formed by the obtained effective SNPs sites, so that the plasmodium vivax is traced. According to the invention, plasmodium vivax DNA traceability is carried out based on a gene mass spectrum chip method adopted by the SNPs molecular markers, and the method has the characteristics of high throughput and rapidness, and the 15 SNPs molecular markers stably and widely exist in plasmodium vivax genome DNA, so that large-scale popularization of the traceability technology is facilitated.

Description

Technical Field

[0001] The present invention belongs to the field of molecular detection, and specifically relates to a SNP combination for tracing the origin of Plasmodium vivax and an application thereof, and more specifically relates to a Plasmodium vivax SNP molecular marker combination and an application thereof in tracing the origin of Plasmodium vivax malaria in inland China. Background Art

[0002] Malaria is an important parasitic disease. With the support of governments at all levels, my country's malaria prevention and control workers have effectively controlled malaria outbreaks through generations and decades of unremitting efforts. In 2017, China achieved zero local malaria case reports for the first time, and obtained WHO certification for malaria elimination in 2021. However, the continued long-term existence of imported malaria cases and the continued existence of malaria vectors in some parts of my country pose a threat to the consolidation of my country's malaria elimination results. If the sensitivity and effectiveness of the monitoring and response system cannot be maintained, and the source of infection cannot be discovered and eliminated in a timely manner, there will still be a risk of re-transmission and resurgence of the epidemic.

[0003] Molecular tracing technology is of great value in determining the source of malarial parasite infection. Traditional case epidemiological surveys are relatively subjective and lack sufficient evidence, while molecular tracing technology uses geographic strain-specific molecular markers combined with population genetics analysis for determination, and the results are more objective. Among them, microsatellites (simple sequence repeats, SSR) and single nucleotide polymorphisms (single nucleotide polymorphism, SNP) are commonly used molecular markers in molecular tracing research.

[0004] SSR refers to a tandem repeat sequence consisting of 2-6 nucleotides in the genome, also known as short tandem repeat sequence, which has high polymorphism and is easy to amplify and detect by PCR. Liu Yaobao et al. used 9 Plasmodium vivax SSR molecular markers and qPCR method to molecularly trace the strains of 4 Plasmodium vivax malaria cases in a cluster outbreak based on VivaxGENMS, a Plasmodium vivax SSR genotype data sharing platform established by the Asia Pacific malaria elimination network (APMEN). The results showed that the possibility of the cases coming from central China (local infection in Hunan) was very small, and it was more likely to be an "imported secondary case" caused by an imported infectious source from abroad that infected local malaria mosquitoes. Pan Weiqing et al. invented a Plasmodium vivax molecular marker combination containing the central repeat region sequence of the circumsporozoite protein, dihydrofolate reductase SNP, dihydropterin synthase SNP, neutral SSR, etc., and applied it to the geographical traceability of the strains. The PCR method can distinguish Plasmodium vivax samples from central China and Yunnan and Hainan.

[0005] SNP is a variation of a single nucleotide in the genome. First, it is densely distributed in the Plasmodium genome, and the detectable sites are far more than SSR. Second, SNP has high stability and is not prone to mutation. Third, SNP detection methods are diverse. In addition to PCR amplification, sequencing and chip technology can also be carried out, which is easy to achieve automation and high-throughput analysis. Fourth, SNP detection has lower requirements for sample quality than SSR. Its amplified fragment can be less than 100bp, and more information can be obtained from degraded DNA samples.

[0006] With the publication of the genome sequence of Plasmodium falciparum in 2002 and the complete genome sequence of Plasmodium vivax in 2012, there are a large number of SNP markers that may contain barcodes. Rachel Daniels et al. used Taqman technology to screen and obtain 24 SNP combinations based on the nuclear genome of Plasmodium falciparum for identification and tracking of isolates from the epidemic population in Senegal. Mary Lynn Baniecki et al. used HRM technology to screen and obtain 42 SNP combinations of Plasmodium vivax for identification of the geographical origin of Plasmodium vivax strains. However, it is limited to South America (Brazil, French Guiana), Africa (Ethiopia), and Asia (Sri Lanka).

[0007] One limitation of these SNP combinations is that the data sets they are based on are not large enough. As more data become available and geographic coverage increases, researchers can develop genotyping tools that are more accurate and have wider global coverage. In addition, some SNP combinations used for tracing are only analyzed and screened at the bioinformatics level, and there are not enough experimental samples to verify their accuracy. Furthermore, some precious samples that can greatly improve the accuracy of tracing have become difficult to use for testing after long-term improper storage.

[0008] This team analyzed the whole genome data of 309 Plasmodium vivax parasites from 14 countries and regions, screened out the unique SNPs of Plasmodium vivax parasites in inland China through comparative genomics methods, and designed and evaluated the corresponding gene mass spectrometry chips. A total of 278 samples of imported Plasmodium vivax cases from inland China (Anhui, Henan, and Zhejiang provinces) and the China-Myanmar border were collected, and the molecular marker combination that can effectively identify Plasmodium vivax parasites in inland China was identified by gene mass spectrometry chip method, and the gene tracing technology that can objectively trace the source of Plasmodium vivax was established. Products for tracing the source of Plasmodium vivax were developed to accurately assess the transmission risk of epidemic points, and then take effective disposal measures in a timely manner.

[0009] This team 1) is based on a large amount of whole genome data: wide geographical coverage, covering 14 countries and regions. The data volume is large, including 65 newly sequenced whole genome data and 244 publicly available whole genome data. This ensures that a large number of high-quality candidate SNPs can be screened at the bioinformatics analysis level; 2) Based on a large number of Plasmodium vivax case samples for identification: a total of 278 cases. And because of the application of the gene mass spectrometry chip method, some precious but degraded DNA samples can also be used for detection, greatly improving the accuracy of molecular identification; 3) The gene mass spectrometry chip method used can perform 40-fold genotyping on up to 384 samples at the same time within 10 hours, generating 15,360 genotypes for analysis. Achieve high-throughput analysis in a short time; 4) The Plasmodium vivax traceability molecular marker combination obtained through screening and identification can be used for PCR experiments at the grassroots level for detection. Summary of the invention

[0010] One of the technical problems to be solved by the present invention is to provide a combination of SNP molecular markers for tracing the origin of Plasmodium vivax in inland China, wherein n in the sequence table represents the mutation site of each molecular marker, respectively: SNP1: the sequence is shown in SEQ ID NO: 1, and the allele mutation site is: T / C;

[0011] SNP2: The sequence is shown in SEQ ID NO: 2, and the allele mutation site is: T / G;

[0012] SNP3: The sequence is shown in SEQ ID NO: 3, and the allele mutation site is: T / C;

[0013] SNP4: The sequence is shown in SEQ ID NO: 4, and the allele mutation site is: A / G;

[0014] SNP5: the sequence is shown in SEQ ID NO: 5, and the allele mutation site is: G / A;

[0015] SNP6: The sequence is shown in SEQ ID NO: 6, and the allele mutation site is: C / T;

[0016] SNP7: sequence as shown in SEQ ID NO: 7, allele mutation site is: A / C;

[0017] SNP8: sequence as shown in SEQ ID NO: 8, allele mutation site is: C / T;

[0018] SNP9: sequence as shown in SEQ ID NO: 9, allele mutation site is: C / T;

[0019] SNP10: The sequence is shown in SEQ ID NO: 10, and the allele mutation site is: C / G;

[0020] SNP11: the sequence is shown in SEQ ID NO: 11, and the allele mutation site is: T / C;

[0021] SNP12: the sequence is shown in SEQ ID NO: 12, and the allele mutation site is: C / T;

[0022] SNP13: The sequence is shown in SEQ ID NO: 13, and the allele mutation site is: G / T;

[0023] SNP14: the sequence is shown in SEQ ID NO: 14, and the allele mutation site is: G / T;

[0024] SNP15: The sequence is shown in SEQ ID NO: 15, and the allele mutation site is: C / T.

[0025] The second technical problem to be solved by the present invention is to provide a method for combining the Plasmodium vivax SNP molecular markers in tracing the source, comprising the following steps:

[0026] 1) 15 SNPs were selected from the previous whole genome sequencing data. The SNPs should meet the following requirements: A. The distance between any adjacent SNPs is greater than 1Mb, ensuring that the SNPs are independent of each other and there is no linkage phenomenon; B. There is no association between any SNP and other SNPs; C. There is no variation in the SNP flanking sequence;

[0027] 2) DNA was extracted from 128 whole blood samples collected from patients with Plasmodium vivax in inland China (Anhui, Henan, and Zhejiang provinces) and 150 samples collected from the China-Myanmar border area;

[0028] 3) Based on the selected 15 SNPs sites, specific primers and probes were designed, and the SNPs site genotype analysis was performed on each sample using the gene mass spectrometry chip method, including: gene amplification, PCR product purification, extension reaction, desalting, chip spotting, and genotyping.

[0029] The third technical problem to be solved by the present invention is to provide specific primers used in the Plasmodium vivax SNP molecular marker combination in the gene mass spectrometry chip method, which are:

[0030] SNP1: the upstream primer snp1-F is shown in SEQ ID NO: 16; the downstream primer snp1-R is shown in SEQ ID NO: 17;

[0031] SNP2: the upstream primer snp2-F is shown in SEQ ID NO: 18; the downstream primer snp2-R is shown in SEQ ID NO: 19;

[0032] SNP3: the upstream primer snp3-F is shown in SEQ ID NO: 20; the downstream primer snp3-R is shown in SEQ ID NO: 21;

[0033] SNP4: the upstream primer snp4-F is shown in SEQ ID NO: 22; the downstream primer snp4-R is shown in SEQ ID NO: 23;

[0034] SNP5: the upstream primer snp5-F is shown in SEQ ID NO: 24; the downstream primer snp5-R is shown in SEQ ID NO: 25;

[0035] SNP6: the upstream primer snp6-F is shown in SEQ ID NO: 26; the downstream primer snp6-R is shown in SEQ ID NO: 27;

[0036] SNP7: the upstream primer snp7-F is shown in SEQ ID NO: 28; the downstream primer snp7-R is shown in SEQ ID NO: 29;

[0037] SNP8: the upstream primer snp8-F is shown in SEQ ID NO: 30; the downstream primer snp8-R is shown in SEQ ID NO: 31;

[0038] SNP9: the upstream primer snp9-F is shown in SEQ ID NO: 32; the downstream primer snp9-R is shown in SEQ ID NO: 33;

[0039] SNP10: the upstream primer snp10-F is shown in SEQ ID NO: 34; the downstream primer snp10-R is shown in SEQ ID NO: 35;

[0040] SNP11: the upstream primer snp11-F is shown in SEQ ID NO: 36; the downstream primer snp11-R is shown in SEQ ID NO: 37;

[0041] SNP12: the upstream primer snp12-F is shown in SEQ ID NO: 38; the downstream primer snp12-R is shown in SEQ ID NO: 39;

[0042] SNP13: the upstream primer snp13-F is shown in SEQ ID NO: 40; the downstream primer snp13-R is shown in SEQ ID NO: 41;

[0043] SNP14: the upstream primer snp14-F is shown in SEQ ID NO: 42; the downstream primer snp14-R is shown in SEQ ID NO: 43;

[0044] SNP15: the upstream primer snp15-F is shown in SEQ ID NO: 44; the downstream primer snp15-R is shown in SEQ ID NO: 45.

[0045] The fourth technical problem to be solved by the present invention is to provide specific probes used in the gene mass spectrometry chip method for the Plasmodium vivax SNP molecular marker combination, which are:

[0046] SNP1: probe snp1-E is represented by SEQ ID NO: 46;

[0047] SNP2: probe snp2-E is represented by SEQ ID NO: 47;

[0048] SNP3: probe snp3-E is represented by SEQ ID NO: 48;

[0049] SNP4: probe snp4-E is represented by SEQ ID NO: 49;

[0050] SNP5: The probe snp5-E is represented by SEQ ID NO:50.

[0051] SNP6: probe snp6-E is represented by SEQ ID NO: 51;

[0052] SNP7: probe snp7-E is represented by SEQ ID NO: 52;

[0053] SNP8: probe snp8-E is shown in SEQ ID NO: 53;

[0054] SNP9: probe snp9-E is represented by SEQ ID NO: 54;

[0055] SNP10: The probe snp10-E is represented by SEQ ID NO:55.

[0056] SNP11: probe snp11-E is represented by SEQ ID NO: 56;

[0057] SNP12: probe snp12-E is represented by SEQ ID NO: 57;

[0058] SNP13: probe snp13-E is represented by SEQ ID NO: 58;

[0059] SNP14: probe snp14-E is represented by SEQ ID NO: 59;

[0060] SNP15: The probe snp15-E is represented by SEQ ID NO:60.

[0061] The fifth technical problem to be solved by the present invention is the application of the SNPs molecular marker combination, specific primers, and probes in tracing the origin of Plasmodium vivax in inland China or in preparing products for tracing the origin of Plasmodium vivax in inland China.

[0062] Beneficial Effects

[0063] The present invention is based on the previous whole genome resequencing work. Through comparative genomics methods, the unique SNPs of Plasmodium vivax in inland China are selected, the corresponding gene mass spectrometry chips are designed and evaluated, and the molecular marker combination that can effectively identify Plasmodium vivax in inland China is screened and identified. This SNP combination can be used to develop Plasmodium vivax traceability products to accurately assess the transmission risk of epidemic sites, and then take effective disposal measures in a timely manner.

[0064] The present invention 1) is based on a large amount of whole genome data: wide geographical coverage and large amount of data. It ensures that a large number of high-quality candidate SNPs can be screened at the bioinformatics analysis level; 2) based on a large number of Plasmodium vivax case samples used for identification, and some precious but degraded DNA samples can also be used for detection, which greatly improves the accuracy of molecular identification; 3) The gene mass spectrometry chip method used can generate up to 15,360 genotypes for analysis within 10 hours. High-throughput analysis is achieved in a short time; 4) The Plasmodium vivax traceability molecular marker combination obtained by screening and identification can be used for PCR experiments at the grassroots level for detection. BRIEF DESCRIPTION OF THE DRAWINGS

[0065] Figure 1 It is a schematic diagram of the genotyping results of Plasmodium vivax specific SNP sites using the gene mass spectrometry chip method in Example 1. DETAILED DESCRIPTION

[0066] The following examples are only used to illustrate the present invention and are not intended to limit the scope of the present invention. Experimental methods without specific conditions in the examples are usually carried out under conventional conditions or under conditions recommended by the manufacturers.

[0067] Example 1

[0068] 1 Materials

[0069] 1.1 Plasmodium vivax genomic DNA

[0070] Whole blood samples from 278 patients infected with Plasmodium vivax were collected from Henan, Anhui, Zhejiang, and Yunnan provinces.

[0071] 1.2 Main Reagents

[0072]

[0073] 2 Methods

[0074] 2.1 Selection of SNPs

[0075] SNPs were selected from the results of previous studies to ensure that 1) the distance between any adjacent SNPs was ≥ 1 Mb, SNPs were independent of each other, and there was no linkage; 2) any SNP was not associated with other molecular markers; 3) there was no variation in the flanking sequences of SNPs. The SNPs selected in this study are shown in Table 1 (SEQ ID NO: 1-15).

[0076] Table 1 SNP locus related information

[0077] SNP number Location Allele chromosome sequence SNP1 1287888 [T / C] 5 tcaagtgcatnttttgttcta(n=torc) SNP2 1099763 [T / G] 9 tttcgtcaaanctccttcgta(n=t or g) SNP3 903012 [T / C] 10 gcggtgcgggntacatactgt(n=torc) SNP4 568448 [A / G] 10 aaggagagganaagattccat(n=a or g) SNP5 1488996 [G / A] 9 cgtagaccatntgagcggtaa(n=g or a) SNP6 906577 [C / T] 8 agggtgtcatntcgctgagcg (n=c or t) SNP7 2541165 [A / C] 12 gtctccaaacnaacacgaact(n=a or c) SNP8 876813 [C / T] 9 atgaagaagtnctttattatg(n=c or t) SNP9 24806 [C / T] 1 gtagttacaantcaaaaccct(n=c or t) SNP10 154635 [C / G] 12 cgtacagccaccacccatca(n=c or g) SNP11 2548050 [T / C] 12 tgtgtaaaaanaacttatttt(n=torc) SNP12 294797 [C / T] 4 ccatactcgtngtatttgtga(n=c or t) SNP13 321804 [G / T] 5 gcacttgttgnaccaaccgtt(n=g or t) SNP14 216337 [G / T] 8 cagacatgcancgctctccgt(n=g or t) SNP15 1102689 [C / T] 14 aaaggcacatngtgctggcgg (n=c or t)

[0078] 2.2 Amplification of Plasmodium vivax SNP molecular markers

[0079] According to the upstream and downstream sequence information of the selected SNPs molecules, 15 pairs of specific primers were designed on the Agena primer design website (https: / / www.agenacx.com). The primer information used in the present invention is shown in Table 2 and was synthesized by Nanjing GenScript Biotechnology Co., Ltd.

[0080] Table 2 Amplification primer information of Plasmodium vivax SNPs (SEQ ID NO: 16-45)

[0081]

[0082]

[0083] Gene amplification was performed using Plasmodium vivax genomic DNA as a template. The reaction conditions were ① 95°C pre-denaturation for 2.0 min; ② 95°C denaturation for 30 sec, ③ 56°C annealing for 30 sec, ④ 72°C extension for 1.0 min, steps ② to ④, 45 cycles; ⑤ 72°C extension for 5 min, and finally stored at 4°C. DNA polymerase was purchased from Agena Bioscience, and the reaction system was 5.0 μl, specifically 10x PCR Buffer (buffer) 0.5 μl; MgCl2 0.4 μl; dNTPs (2.5 mM each) 0.1 μl; 0.5 uMPrimer Mix (upstream and downstream primers) 1 μl; Template DNA (DNA template) 2 μl; PCR Enzyme (5 U / μl) (enzyme) 0.2 μl; HPLC grade water (liquid chromatography grade) 0.8 μl.

[0084] 2.3 Purification of PCR products

[0085] The above PCR product was purified by SAP method. The reaction conditions were ①37℃40.0min, ②85℃5.0min, and finally stored at 4℃. SAP purified enzyme was purchased from Agena Bioscience, and the reaction system was 7.0μl, specifically SAP Buffer (buffer) 0.17μl; SAP Enzyme (1.7U / μl) (enzyme) 0.3μl; PCR product 5μl; Water (ultrapure water) 1.53μl.

[0086] 2.4 Extension reaction

[0087] According to the upstream and downstream sequence information of the selected SNPs molecules, 15 specific probes were designed. The probe information used in the present invention is shown in Table 3. They were synthesized by Nanjing GenScript Co., Ltd. (SEQ ID NO: 46-60).

[0088] SNP number Probe sequence SNP1 snp1-E, acatctactt atttcaagtg cat SNP2 snp2-E,cttcgcaatttttcgtcaaa SNP3 snp3-E,tccatctgcg gtgcggg SNP4 snp4-E,cctcaatttcttcatggaatctt SNP5 snp5-E,aagagtgcat atttgcgtag accat SNP6 snp6-E,gggcatcgtg agggagggtg tcat SNP7 snp7-E,gcgtacctcagttcgtgtt SNP8 snp8-E,aatggtgcaggacataataaag SNP9 snp9-E, caccaaagga cgtagttaca a SNP10 snp10-E, ggacaaacat acgtacgtac agcca SNP11 snp11-E,tccttgaaaa atgaaaataa gtt SNP12 snp12-E,ttttgctcta cttcacaaat ac SNP13 snp13-E, gatgagaagc acttgttg SNP14 snp14-E,ggtggattta cggagagcg SNP15 snp15-E,attagccaaa ggcacat

[0089] The purified PCR product was used as a template for extension reaction. The reaction conditions were ① 95℃ pre-denaturation for 30 sec; ② 95℃ denaturation for 5 sec, ③ 52℃ annealing for 5 sec, ④ 80℃ extension for 5 sec, ③ to ④, 5 cycles; ② to ④, 40 cycles; ⑤ 72℃ extension for 3 min, and finally stored at 4℃. The extension enzyme was purchased from Agena Bioscience, and the reaction system was 9.0μl, specifically iPLEX Buffer (buffer) 0.2μl; iPLEX Termination mix (reaction termination solution) 0.2μl; Extend Mix (5 probes) 0.94μl; iPLEX Enzyme (enzyme) 0.04μl; purified PCR product 7μl; Water (water) 0.04μl.

[0090] 2.5 Sample desalting

[0091] Use a scraper to evenly distribute the cleaning resin in the 96 small holes in the resin plate. Add 41μl of water to the extension product, cover with a sealing film, and centrifuge to mix. Flip the 96-well PCR plate with the extension product and place it on the plate with the cleaning resin added. Flip the PCR plate again, cover with a sealing film, and place it on a rotator and shake it upside down for 15 minutes to fully mix the resin and the extension product. Centrifuge the PCR plate at 4000rpm for 5 minutes.

[0092] 2.6 Genotype detection and statistical analysis

[0093] The extension products after desalting in the PCR plate were spotted onto gene chips respectively, and then the gene chips were placed in the MassArray mass spectrometer of Agena for genotype detection. The mass spectrometry results were statistically analyzed using the MassARRAYTyper Analyzer software version 4.0 of Agena.

[0094] 3 Results

[0095] 3.1 Genotype detection

[0096] The SNPs genotypes of 278 Plasmodium vivax samples were detected by Agena's MassArray mass spectrometer, and the alleles of each SNP were calculated. The main genotypes of samples from inland China and the China-Myanmar border area are as follows:

[0097]

[0098] 3.2 Analysis of detection rate of Plasmodium vivax samples

[0099] According to statistics, among 278 Plasmodium vivax samples, 271 samples had signals in the results of the gene mass spectrometry chip, with a detection rate of 97.5%.

[0100] 3.3 Sensitivity and specificity analysis

[0101] In the results of the detection signal, based on the combination of 15 SNPs, 121 out of 125 Plasmodium vivax samples from inland China were determined to be from inland China, with a sensitivity of 96.8%; 12 out of 146 Plasmodium vivax samples from the China-Myanmar border were determined to be from inland China, with a specificity of 91.8%.

[0102] Sample source Detection quantity Sensitivity Inland China 125 96.8％(121 / 125)

[0103] Sample source Detection quantity Specificity China-Myanmar border area 146 91.8％(134 / 146)

[0104] From the above results, it can be seen that in recent years, our team has collected samples of imported Plasmodium vivax cases from inland China (Anhui, Henan, and Zhejiang provinces) and the China-Myanmar border, and performed whole genome resequencing on some Plasmodium vivax samples. Through comparative genomics methods, the unique SNPs of Plasmodium vivax in inland China were selected, the corresponding gene mass spectrometry chips were designed and evaluated, and 15 SNPs molecular marker combinations that can effectively identify Plasmodium vivax in inland China were screened and identified. The sensitivity of this SNPs combination reached 96.8% and the specificity reached 91.8%. Relying on this invention, our team has successfully established a gene tracing technology that can objectively trace the source of Plasmodium vivax. The above results can be used to trace the source of malaria cases after malaria is eliminated in China, and can also be used to develop Plasmodium vivax traceability products, which have broad application prospects.

[0105] All documents mentioned in the present invention are cited as references in this application, just as each document is cited as reference individually. In addition, it should be understood that after reading the above teachings of the present invention, those skilled in the art can make various changes or modifications to the present invention, and these equivalent forms also fall within the scope defined by the claims attached to this application.

Claims

1. A SNPs molecular marker combination for tracing the origin of Plasmodium vivax in inland China, characterized by: The molecular identifiers of SNPs are: SNP1: The sequence is shown in SEQ ID NO: 1, and the allele mutation site is: T / C; SNP2: The sequence is shown in SEQ ID NO: 2, and the allele mutation site is: T / G; SNP3: The sequence is shown in SEQ ID NO: 3, and the allele mutation site is: T / C; SNP4: The sequence is shown in SEQ ID NO: 4, and the allele mutation site is: A / G; SNP5: the sequence is shown in SEQ ID NO: 5, and the allele mutation site is: G / A; SNP6: The sequence is shown in SEQ ID NO: 6, and the allele mutation site is: C / T; SNP7: sequence as shown in SEQ ID NO: 7, allele mutation site is: A / C; SNP8: sequence as shown in SEQ ID NO: 8, allele mutation site is: C / T; SNP9: sequence as shown in SEQ ID NO: 9, allele mutation site is: C / T; SNP10: the sequence is shown in SEQ ID NO: 10, and the allele mutation site is: C / G; SNP11: the sequence is shown in SEQ ID NO: 11, and the allele mutation site is: T / C; SNP12: the sequence is shown in SEQ ID NO: 12, and the allele mutation site is: C / T; SNP13: The sequence is shown in SEQ ID NO: 13, and the allele mutation site is: G / T; SNP14: the sequence is shown in SEQ ID NO: 14, and the allele mutation site is: G / T; SNP15: The sequence is shown in SEQ ID NO: 15, and the allele mutation site is: C / T.

2. A method for tracing the origin of Plasmodium vivax in inland China using a gene mass spectrometry chip method, characterized by: The steps include: 1) 15 SNPs were selected from the previous whole genome sequencing data. The SNPs should meet the following requirements: A. The distance between any adjacent SNPs is greater than 1Mb, ensuring that the SNPs are independent of each other and there is no linkage phenomenon; B. There is no association between any SNP and other SNPs; C. There is no variation in the SNP flanking sequence; 2) Extract DNA from 128 whole blood samples of Plasmodium vivax patients collected from inland areas of China and 150 samples collected from the China-Myanmar border area; 3) Based on the selected 15 SNPs sites, specific primers and probes were designed, and the SNPs site genotype analysis was performed on each sample using the gene mass spectrometry chip method, including: gene amplification, PCR product purification, extension reaction, desalting, chip spotting, and genotyping.

3. The method for tracing the origin of Plasmodium vivax in inland China using a gene mass spectrometry chip as claimed in claim 2, characterized in that: the specific primers used in step 3) are respectively: SNP1: the upstream primer snp1-F is shown in SEQ ID NO: 16; the downstream primer snp1-R is shown in SEQ ID NO: 17; SNP2: the upstream primer snp2-F is shown in SEQ ID NO: 18; the downstream primer snp2-R is shown in SEQ ID NO: 19; SNP3: the upstream primer snp3-F is shown in SEQ ID NO: 20; the downstream primer snp3-R is shown in SEQ ID NO: 21; SNP4: the upstream primer snp4-F is shown in SEQ ID NO: 22; the downstream primer snp4-R is shown in SEQ ID NO: 23; SNP5: the upstream primer snp5-F is shown in SEQ ID NO: 24; the downstream primer snp5-R is shown in SEQ ID NO: 25; SNP6: the upstream primer snp6-F is shown in SEQ ID NO: 26; the downstream primer snp6-R is shown in SEQ ID NO: 27; SNP7: the upstream primer snp7-F is shown in SEQ ID NO: 28; the downstream primer snp7-R is shown in SEQ ID NO: 29; SNP8: the upstream primer snp8-F is shown in SEQ ID NO: 30; the downstream primer snp8-R is shown in SEQ ID NO: 31; SNP9: the upstream primer snp9-F is shown in SEQ ID NO: 32; the downstream primer snp9-R is shown in SEQ ID NO: 33; SNP10: the upstream primer snp10-F is shown in SEQ ID NO: 34; the downstream primer snp10-R is shown in SEQ ID NO: 35; SNP11: the upstream primer snp11-F is shown in SEQ ID NO: 36; the downstream primer snp11-R is shown in SEQ ID NO: 37; SNP12: the upstream primer snp12-F is shown in SEQ ID NO: 38; the downstream primer snp12-R is shown in SEQ ID NO: 39; SNP13: the upstream primer snp13-F is shown in SEQ ID NO: 40; the downstream primer snp13-R is shown in SEQ ID NO: 41; SNP14: the upstream primer snp14-F is shown in SEQ ID NO: 42; the downstream primer snp14-R is shown in SEQ ID NO: 43; SNP15: the upstream primer snp15-F is shown in SEQ ID NO: 44; the downstream primer snp15-R is shown in SEQ ID NO:

45.

4. The method for tracing the origin of Plasmodium vivax in inland China using a gene mass spectrometry chip as claimed in claim 2, characterized in that: the specific probes used in step 3) are: SNP1: probe snp1-E is represented by SEQ ID NO: 46; SNP2: probe snp2-E is represented by SEQ ID NO: 47; SNP3: probe snp3-E is represented by SEQ ID NO: 48; SNP4: probe snp4-E is represented by SEQ ID NO: 49; SNP5: The probe snp5-E is represented by SEQ ID NO:

50. SNP6: probe snp6-E is represented by SEQ ID NO: 51; SNP7: probe snp7-E is represented by SEQ ID NO: 52; SNP8: probe snp8-E is shown in SEQ ID NO: 53; SNP9: probe snp9-E is represented by SEQ ID NO: 54; SNP10: The probe snp10-E is represented by SEQ ID NO:

55. SNP11: probe snp11-E is represented by SEQ ID NO: 56; SNP12: probe snp12-E is represented by SEQ ID NO: 57; SNP13: probe snp13-E is represented by SEQ ID NO: 58; SNP14: probe snp14-E is represented by SEQ ID NO: 59; SNP15: The probe snp15-E is represented by SEQ ID NO:

60.

5. The method for tracing the origin of Plasmodium vivax in inland China using a gene mass spectrometry chip as described in claim 2 is characterized in that: the gene amplification reaction conditions described in step 3) are ① pre-denaturation at 95°C for 2.0 min; ② denaturation at 95°C for 30 sec, ③ annealing at 56°C for 30 sec, ④ extension at 72°C for 1.0 min, steps ② to ④, 45 cycles; ⑤ extension at 72°C for 5 min, and finally storage at 4°C.

6. The method for tracing the origin of Plasmodium vivax in inland China using a gene mass spectrometry chip as described in claim 2 is characterized in that: the PCR product purification reaction conditions described in step 3) are ① 37°C 40.0 min, ② 85°C 5.0 min, and finally stored at 4°C.

7. The method for tracing the origin of Plasmodium vivax in inland China using a gene mass spectrometry chip as described in claim 2 is characterized in that: the extension reaction conditions described in step 3) are ① pre-denaturation at 95°C for 30 seconds; ② denaturation at 95°C for 5 seconds, ③ annealing at 52°C for 5 seconds, ④ extension at 80°C for 5 seconds, ③ to ④, 5 cycles; ② to ④, 40 cycles; ⑤ extension at 72°C for 3 minutes, and finally stored at 4°C.

8. Use of the SNPs molecular marker combination as claimed in claim 1 in tracing the origin of Plasmodium vivax in inland China or in preparing products for tracing the origin of Plasmodium vivax in inland China.

9. Use of the primer pair according to claim 3 in tracing the origin of Plasmodium vivax in inland China or in preparing a product for tracing the origin of Plasmodium vivax in inland China.

10. Use of the specific probe as claimed in claim 4 in tracing the origin of Plasmodium vivax in inland China or in preparing a product for tracing the origin of Plasmodium vivax in inland China.

Images