Maize chromosome 1 NCLB resistance related molecular marker and application thereof

Abstract

The invention relates to the technical field of agricultural biology, in particular to a corn NCLB (chromosome 1 northern leaf blight) resistance related molecular marker and application thereof. Specifically, the invention discloses an SNP (Single Nucleotide Polymorphism) site molecular marker related to corn NCLB resistance, the sequence of the molecular marker is shown as SEQ ID NO.1, and the 201bp site base from the 5'end of the sequence shown as SEQ ID NO.1 shows T / C polymorphism, a corn polyparent population with significant difference on NCLB resistance is constructed, a site Chr1: SNP305669223 which is located on a chromosome 1 and is significantly related to NCLB resistance is analyzed and positioned by utilizing GWAS, and the SNP site molecular marker related to corn NCLB resistance is obtained. According to the present invention, the Zm00001d034918 for regulating and controlling the NCLB resistance of the corn is mined, the qRT-PCR result shows that the expression quantity of the gene after the artificial inoculation of the Setosphaeria turbica is significantly increased in the parent, the result of the present invention is beneficial to further research on the NCLB resistance regulation and control mechanism of the corn, and the technical support is provided for the breeding of the NCLB resistance corn variety.

Description

Technical Field

[0001] This invention relates to the field of agricultural biotechnology, and in particular to the molecular marker site of NCLB resistance on maize chromosome 1, the protein or gene associated with the site, and its application. Background Technology

[0002] Maize is one of China's most important food crops, consistently accounting for more than one-third of the country's total grain crop planting area for the past five years. However, maize production has long been threatened by several significant diseases, among which northern corn leaf blight (NCLB), caused by *Setosphaeria turcica*, is one of the most prevalent foliar diseases affecting maize. NCLB reduces maize yield by decreasing the photosynthetic area of ​​maize leaves, with yield losses generally ranging from 30% to 62% depending on the severity of the disease. Infection before silking and widespread spread during the grain-filling stage results in the most severe yield losses. Therefore, improving maize resistance to NCLB is a key objective of plant breeding and biotechnology-assisted selection. Thus, identifying functional genes closely related to maize resistance to NCLB can provide technical support for marker-assisted selection of NCLB-resistant maize. Summary of the Invention

[0003] To address the aforementioned issues, this invention provides the Chr1 locus (SNP_305669223) on maize chromosome 1, which is significantly associated with NCLB resistance, and subsequently identifies the functional gene Zm00001d034918 that regulates maize resistance to NCLB. The Zm00001d034918 gene discovered in this invention is a functional gene regulating maize resistance to large leaf spot disease. qRT-PCR results show that the expression level of this gene was significantly increased in all four parents after artificial inoculation with the disease *Setosphaeria turcica*.

[0004] To achieve the above objectives, the present invention provides the following technical solution:

[0005] This invention provides a molecular marker for an SNP site associated with NCLB resistance in maize. The SNP site is located at Chr1:SNP_305669223 in maize. The molecular marker sequence is shown in SEQ ID NO:1. The sequence shown in SEQ ID NO:1 exhibits T / C polymorphism at the 201 bp base position starting from the 5′ end.

[0006] Furthermore, this invention provides the application of products detecting the molecular markers at the SNP sites in identifying or assisting in the identification of NCLB resistance in maize. The application involves detecting a maize variety with significant NCLB resistance when the genotype at the 201 bp site from the 5′ end of the sequence shown in SEQ ID NO:1 is CC. In some specific embodiments, the products detecting the molecular markers at the SNP sites can be detection products designed specifically for the sites described in this invention based on known single nucleotide polymorphism (SNP) detection methods such as Sanger sequencing, TaqMan probe method, ARMS-PCR (Amplification Refractory Mutation System PCR), and KASP (Kompetitive Allele-Specific PCR).

[0007] Furthermore, this invention provides a method for improving maize resistance to NCLB, which involves using a gene editing tool to mutate the genotype of the sequence shown in SEQ ID NO:1 at the 201bp site from the 5′ end to CC. In some specific embodiments, the gene editing tool can be an existing technology such as the CRISPR / Cas9 system, the CRISPR / Cas12a system, prime editors (PE), ZFN technology (Zinc Finger Nucleases), or TALEN technology (Transcription Activator-Like Effector Nucleases).

[0008] Furthermore, the present invention provides a maize NCLB resistance protein associated with the molecular marker at the SNP site, the amino acid sequence of which is shown in SEQ ID NO.3.

[0009] Furthermore, the present invention provides a gene encoding the maize NCLB resistance protein, as shown in SEQ ID NO. 2.

[0010] Furthermore, the present invention provides a kit containing reagents for detecting the protein or the gene.

[0011] Furthermore, the kit contains primers for detecting the gene shown in SEQ ID NO.2.

[0012] Furthermore, the primers in the kit are as shown in SEQ ID NO.4 and / or SEQ ID NO.5.

[0013] Furthermore, the present invention provides the application of any of the kits described herein in identifying or assisting in the identification of maize NCLB resistance, wherein the expression level of the protein or gene is positively correlated with maize NCLB resistance.

[0014] Furthermore, the present invention provides the application of the SNP site molecular marker, the protein, or the gene in molecular marker-assisted breeding of NCLB-resistant maize.

[0015] The beneficial effects achieved by this invention are as follows:

[0016] This invention provides the molecular marker site Chr1 (SNP_305669223) on chromosome 1 of maize, which is associated with NCLB resistance, and the protein or gene Zm00001d034918 associated with this site, as well as their applications. This invention utilizes the maize inbred line Ye107, which exhibits moderate NCLB resistance, as a common parent, and crosses it with three temperate and subtropical maize inbred lines with different NCLB resistances to construct a multi-parental maize population with significantly different NCLB resistance. GWAS analysis located Chr1 (SNP_305669223) on chromosome 1, which is significantly associated with NCLB resistance. Furthermore, the functional gene Zm00001d034918, which regulates maize NCLB resistance, was identified. qRT-PCR results showed that the expression level of this gene was significantly increased in all four parents after artificial inoculation with *Setosphaeria turcica*. The results of this invention contribute to further research on the regulatory mechanism of maize leaf spot resistance and also provide technical support for breeding maize varieties resistant to leaf spot. Attached Figure Description

[0017] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the accompanying drawings used in the embodiments will be briefly described below.

[0018] Figure 1 The correlation results of pop1, pop2, and pop3 with NCLB under three different environments are shown in the figure; a: violin plot of the RILs phenotypic distribution of pop1, pop2, and pop3 in response to NCLB under three different environments (YS21, JH22, YS22); bd: NCLB correlation analysis of the same population of pop1, pop2, and pop3 under different environments, respectively.

[0019] Figure 2 This is an phylogenetic tree diagram of pop1, pop2, and pop3;

[0020] Figure 3 The principal component analysis results for pop1, pop2, and pop3 are shown in the figure.

[0021] Figure 4To use the study population for GWAS to mine resistance SNPs; in the figure, the left figure in a to c is the Manhattan plot, and the right figure is the QQ plot. a is the result of YS21S, b is the result of YS22S, and c is the result of BLUP.

[0022] Figure 5 The association diagram between SNP_305669223 and the functional gene Zm00001d034918;

[0023] Figure 6 This is a haplotype analysis plot of NCLB resistance-related SNPs, with the coordinates representing BLUP values.

[0024] Figure 7 Relative expression levels of the gene Zm00001d034918 0.5–48 h after inoculation with the diseased Setosphaeria turcica; the letters in the figure represent the differences from the control group, A indicates p<0.05, b indicates p<0.05, C indicates p<0.01, and d indicates p<0.001. Detailed Implementation

[0025] To further illustrate the present invention, the following description, in conjunction with the accompanying drawings and embodiments, details the NCLB resistance-related molecular marker site Chr1 (SNP_305669223) on maize chromosome 1, the associated protein or gene Zm00001d034918, and their applications. However, these descriptions should not be construed as limiting the scope of protection of the present invention.

[0026] This invention provides a molecular marker site Chr1 (SNP_305669223) on chromosome 1 of maize, which is a reference site in genome B73 (RefGen_v4). In some specific embodiments, for the detection of this SNP site, this invention provides a molecular marker sequence as shown in SEQ ID NO.1. As shown in SEQ ID NO:1, the 201 bp base from the 5′ end of the sequence exhibits T / C polymorphism. Those skilled in the art can design corresponding products for detection using the sequence shown in SEQ ID NO.1 provided by this invention and employ detection methods known in the art. Based on the detection results, if the genotype of this site is detected as CC, the maize sample to be tested is determined to be a maize variety with significant NCLB resistance.

[0027] SEQ ID NO:1:

[0028] 5'-ACTGTAAAAGAAAAAAATCAATGTTCTATAGTGGTTTTATTTCAAATCAAAAGGCCAACTAAAAGAGTGTTCACTATGGCTGTAAAAATAAATTCAGTGTTCTACATACCCATGGTACACTCACATCTCCTCCTTGTTGATAACACATTCTTCTGACTCATGAGCATGCAGATGACATCTTGGGCCTTGATGATGTTTGAG[T / C]TGTACAACCATTTAGTCCCACAAATCCCAGCAGTAGCAATGTGTTAAACGCAATCGCCAAATGACAGTAGCATTGTGTGACAATTAAGGTATCTTGTTACAACAAGCTTCAAAGGGTTAATATATATTAGTAATATTCCCAAAACATGGTAGAAAAATATGCAAATTAAAGCCACCAAACTGACAAACTAATTGTATATT-3'

[0029] In another aspect, this invention utilizes GWAS analysis to locate Chr1: SNP_305669223, located on chromosome 1 and significantly associated with NCLB resistance. This leads to the discovery of the functional gene Zm00001d034918, which regulates maize resistance to NCLB. The amino acid sequence of the Zm00001d034918 protein is shown in SEQ ID NO.3, and the gene sequence encoding this protein is shown in SEQ ID NO.2. qRT-PCR results show that the expression level of this gene was significantly increased in all four parents after artificial inoculation with the disease Setosphaeria turcica. This indicates a positive correlation between the expression level of this gene or protein and maize resistance to large leaf spot. In some specific embodiments, those skilled in the art can design corresponding detection products based on the sequences shown in SEQ ID NO.2 or SEQ ID NO.3 provided by this invention, and screen maize varieties with significant NCLB resistance by measuring the expression level of Zm00001d034918.

[0030] Example 1

[0031] 1.1 Plant materials

[0032] The experiment was conducted in 2021 and 2022 in three different ecological environments: Yanshan County, Yunnan Province (denoted as YS, altitude 1540m, longitude 104.5°E, latitude 23.6°N), and Jinghong City (denoted as JH, altitude 606.5m, longitude 100.58°E, latitude 21.54°N). Three multi-parent populations were obtained using the single-seed transfer method: pop1 (Ye107×Zheng58), pop2 (Ye107×AN20), and pop3 (Ye107×HuangC). Information on the four parents (Ye107, Zheng58, AN20, and HuangC) is shown in Table 1. The common parent Ye107 is a key superior inbred line developed from two lines of different heterotic groups in the Chinese breeding program, and has been used as a parent in many commercial hybrids planted in a considerable production area of ​​China [Zhen, S., Gao, G., Wang, X., Ning, H., and Duan, X. (2004). Appraisal of drought-enduring quality of several maize inbred lines. J Maize Sci. (in Chinese) 12, 18-19.].

[0033] Among the three multiparental populations, pop1 had 196 recombinant inbred lines (RILs), pop2 had 148 RILs, and pop3 had 184 RILs, ultimately resulting in 528 RILs with rich genetic variation. Parental information is shown in Table 1.

[0034] Table 1 Parental Information

[0035]

[0036]

[0037] 1.2 Experimental Design

[0038] A randomized block design (RCBD) was used at three time locations: Yanshan (YS21S) in 2021, Yanshan (YS22S) in 2022, and Jinghong (JH22W) in 2022, with three replicates at each location. Each experimental field consisted of rows 4.0 m long, with a row spacing of 0.7 m and a plant spacing of 0.25 m, with 14 plants per row. Ten plants were sampled from the middle of each row. Maize was grown according to local standard agronomic practices. The statistical method for large leaf spot disease is referenced in [Li, C., Ling, F., Su, G. et al. Location and mapping of the NCLB resistance genes in maize by bulked segregant analysis (BSA) using whole genome re-sequencing. Mol Breeding 40, 92 (2020). https: / / doi.org / 10.1007 / s11032-020-01171-3].

[0039] 1.3 Heritability Analysis

[0040] After preliminary processing of phenotypic data collected at three time locations, correlation analysis was performed on the large leaf spot (NCLB) severity in different populations and environments using the Ime4 package in R software (V4.0.5). The mean, standard deviation, skewness, kurtosis, and coefficient of variation of the large leaf spot were calculated, and a normality test was performed. Broadly heritable ability was calculated by referring to the methods in [Knapp SJ. Confidence intervals for heritability for two-factor mating design single environment linear models. Theor Appl Genet. 1986; 72(5):587-591.] and [Moran, P.; Smith, C. The correlation between relatives on the supposition of mendelian inheritance. Trans. Royal Soc. Edinb. 1918, 52, 438-899.].

[0041] 1.4. DNA Extraction and Genome Sequencing

[0042] First, genomic DNA was extracted from maize seedling leaves using the cetyltrimethylammonium bromide (CTAB) method. Then, the genomic DNA isolated from each F9RIL was digested with restriction endonucleases PstI and MspI, and ligated to a barcode adapter using T4 ligase (New England BioLabs). A GBS DNA library was constructed according to the GBS protocol and sequenced.

[0043] All ligated samples were pooled and purified using the QIAquick PCR Purification Kit (QIAGEN, Valencia, CA, USA). Polymerase chain reaction (PCR) amplification was performed using primers matched to the adapter. Finally, PCR products were purified and quantified using the Qubit dsDNA HS Analysis Kit (Life Technologies, Big Island, NY, USA). After selecting 200–300 bp PCR products using the Egel system (Life Technologies), library concentrations were estimated using a Qubit 2.0 fluorometer and the Qubit dsDNA HS Analysis Kit (Life Technologies). Sequencing reads were then generated using TASSELv5.0 (Li C, Guan H, Jing X, et al. Genomic insights into historical improvement of heterotic groups during modern hybrid maizebreeding. NatPlants. 2022; 8(7):750–763.). Before TASSEL analysis, 80 poly(A) bases were appended to the 3' end of all sequencing reads. For comparative analysis, the B73 (RefGen_v4) reference genome sequence was used, and the analysis was performed using Sentieon software (parameter "bwamem-k 32-MR") (Pei S, Liu T, Ren X, Li W, Chen C, Xie Z. Benchmarking variant callers in next-generation and third-generation sequencing analysis. Brief Bioinform. 2021; 22(3):bbaa148). The results were sorted and deduplicated using Samtools (with parameter rmdup). A total of 549,531 high-quality SNPs were generated and annotated using ANNOVAR software (Wang K, Li M, Hakonarson H. ANNOVAR: functional annotation of genetic variants from high-throughput sequencing data. Nucleic Acids Res. 2010; 38(16):e164.).

[0044] 1.5 Population Structure, Phylogenetic Tree, and PCA

[0045] In population structure analysis, we employed a model-based clustering algorithm in admix V1.3 [Mussmann, SM; Douglas, MR; Chafin, TK; Douglas, MEADMIXPIPE: Population analyses in ADMIXTURE for non-model organisms. BMC Bioinform. 2020, 21, 337.]. Preliminary analysis included multiple runs with consecutive K values ​​ranging from 1 to 12, each with five-fold cross-validation. The most probable K value was determined using the cross-validation values ​​from admix. Inbred lines with a membership probability greater than 0.5 were assigned to corresponding clusters, and the results were visualized using TBtools software v1.098727 [Chen, C.; Chen, H.; Zhang, Y.; Thomas, HR; Frank, MH; He, Y.; Xia, R. TBtools: An Integrative Toolkit Developed for Interactive Analyses of Big Biological Data. Mol. Plant. 2020, 13, 1194–1202.]. Phylogenetic tree analysis was performed using Tassel v5.0 software, utilizing 549,531 high-quality SNPs to assess the genetic relationships among 528 RILs. Principal component analysis (PCA) was performed using R package 4.3.2, and the results were visualized using the scatterplot3d package.

[0046] 1.6 Genome-wide association analysis

[0047] GWAS was performed using the Efficient Mixed-Model Association (EMME) method in the GEMMA (Genome-wide Efficient Mixed-Model Association Analysis) software package (Zhou X, Stephens M. Genome-wide efficient mixed-model analysis for association studies. Nat Genet. 2012;44(7):821-824. Published 2012 Jun 17.).

[0048] This invention uses PLINK (Purcell S, Neale B, Todd-Brown K, et al. PLINK: a tool set for whole-genome association and population-based linkage analyses. Am J HumGenet. 2007; 81(3):559-575.) to calculate independent markers with the parameter -indeppairwise 5050.2. The significance threshold -log10(p)>4.5 is calculated using the formula -log10(1 / number of SNPs) to identify significant SNPs associated with maize NCLB. SNPs that met or exceeded the threshold were extracted using bedtools v1.7 (Strable J, Wallace JG, Unger-Wallace E, et al. Maize YABBY Genes drooping leaf1 and drooping leaf2 RegulatePlantArchitecture.Plant Cell.2017;29(7):1622-1641.) and candidate genes associated with maize NCLB were identified in the 100kb region upstream and downstream of significantly relevant SNPs based on B73 (RefGen_v4). In the process of screening candidate genes, we referred to the screening distance of candidate genes for temperate maize by Zhang et al. (2016, 2022) [Zhang, X., et al., Characterizing the population structure and genetic diversity of maize breeding germplasmin Southwest China using genome-wide SNP markers. BMC Genomics, 2016.17(1):p.697.] [Zhang, X., et al., Genetic architecture of maize yield traits dissected by QTL mapping and GWAS in maize. The Crop Journal, 2022.10(2):p.436-446.].

[0049] 1.7 Haplotype Analysis

[0050] Haploview v4.2 software was used to perform haplotype analysis on SNPs associated with NCLB in three environments. First, a haplotype map was constructed using high-density whole-genome SNPs, and haplotypes of SNPs significantly associated with maize leaf spot resistance were determined based on the location of these loci and LD analysis results. Finally, genes within the haplotypes were annotated to identify functionally relevant gene loci.

[0051] 1.8 qRT-PCR and gene expression levels

[0052] RNA was extracted using the TIANGEN RNAprep Pure Plant Kit, and then reverse transcribed into first-strand cDNA using the FastKingRT Kit (With gDNase). Finally, the SuperReal PreMixPlus (SYBR Green) kit and Archimed... TM qRT-PCR was performed using a Quantitative PCR Detection System to determine the relative expression levels of candidate genes in different parents, with a reaction volume of 20 μL. Infected leaves were collected at 0.5, 1, 3, 6, 9, 12, 24, and 48 hours after artificial inoculation of maize, and uninoculated leaves from each parent were used as controls. The relative expression levels of the candidate gene Zm00001d034918 were analyzed using two primer pairs: F-1-18'CTCCACGAGACCATCCTGACC and R-1-18'CCTCTTCGCCTAGCACCAAA, with GAPDH used as an internal reference gene for qRT-PCR. The three-step qRT-PCR reaction program was set as follows: pre-denaturation stage: 95℃ for 15 min; PCR reaction stage: denaturation at 95℃ for 10 s, annealing at 56℃ for 20 s, extension at 72℃ for 30 s (signal acquisition during this stage); melting curve stage: 95℃ for -15 s, 60℃ for -1 min, 95℃ for -1 s (fluorescence signal acquisition every 0.5℃ during the process of reaching 95℃), for 40 cycles.

[0053] 2. Results

[0054] 2.1 Phenotypic Analysis of Large Spot Disease

[0055] We planted three RIL populations, Pop1, Pop2, and Pop3, in three environments [Yanshan (2021 and 2022) and Jinghong (2022)] and identified NCLB severity indices. As shown in Table 2, we performed descriptive statistics based on the disease data from the three RIL populations. It can be seen that the absolute values ​​of kurtosis and skewness for Pop1, Pop2, and Pop3 are all less than 1, indicating that their phenotypic frequencies approximate a normal distribution. The heritability of the NCLB severity indices for the three populations in the three environments were 0.972, 0.939, and 0.946, respectively. The high heritability makes the candidate genes identified by GWAS more reliable. Figure 1 As shown in diagram a, compared to Pop2 and Pop3, Pop1's disease severity distribution is closer to the lower end. This indicates that Pop1 has a lower disease severity and is more resistant to disease. From... Figure 1 b to Figure 1 The correlation coefficients of the three groups were lowest at 0.755 (Pop1YS21S and JH22W) and highest at 0.986 (Pop2YS21S and YS22S). Pop1, Pop2, and Pop3 all showed high correlation coefficients under different environments, indicating that they have significant stability against NCLB invasion under different environments, providing strong support for the reliability of GWAS analysis.

[0056] Table 2 Statistical analysis results of NCLB phenotypes

[0057]

[0058] Note: W represents winter, S represents summer. Env represents the environment. Range indicates the range of plant disease severity within the population. SD represents the standard deviation. CV represents the coefficient of variation. H 2 It represents heritability.

[0059] 2.2 Population Structure of RIL Groups

[0060] This invention utilizes Admixture software to perform population structure analysis on 528 materials. The analysis results are as follows: Figure 4 As shown, overall, population structure, principal component analysis (PCA), and phylogenetic tree ( Figure 2 , Figure 3 The results were consistent. Based on pedigree or genetic background, RILs could be divided into three major clusters. When K=3, the population structure of RILs became clear: 196 RILs in pop1, 148 RILs in pop2, and 184 RILs in pop3. Phylogenetic analysis also revealed three genetic clusters, consistent with the population structure based on kinship.

[0061] 2.3 Genome-wide association analysis of NCLB

[0062] This invention uses 528 samples and 549,531 valid SNP markers (minimum allele frequency MAF ≥ 5%, deletion value r). 2 GWAS analysis was performed with a threshold of -log10(P) > 4.5, identifying several SNPs significantly associated with NCLB. In BLUP analysis, the site Chr1, SNP_305669223, significantly associated with NCLB resistance, was identified.

[0063] 2.6 Identification and Validation of NCLB-Related Candidate Genes

[0064] We screened candidate genes in the 100kb upstream and downstream regions of significant SNPs that were consistently identified in different environments. Finally, candidate genes potentially involved in regulating NCLB resistance were identified (Table 3). SNP_305669223 was identified in three environments: YS21S, YS22S, and BLUP, with phenotypic differences of 5.32%, 4.771%, and 4.82%, respectively. Screening the 100kb region near this SNP revealed a candidate gene Zm00001d034918 (…). Figure 5 Functional annotations from the NCBI and MaizeGDB databases show that Zm00001d034918 encodes member 3 of the ABC transporter G family. This candidate gene is associated with plant energy metabolism (Table 4).

[0065] Table 3 Candidate genes associated with NCLB

[0066]

[0067] Haplotype analysis was performed on SNPs that were significantly associated with NCLB resistance and consistently identified in various environments. To determine the relationship between different haplotypes and NCLB resistance, haplotype analysis was conducted on SNPs. SNP_305669223 is located 76.059 kb downstream of Zm00001d034918 and exhibits T / C substitution (…). Figure 5 This SNP is located within a terminally inverted repeat (TIR) ​​element and can be up to 1.517 kb in length. Figure 5 SNP_305669223 exhibits two haplotypes: Hap1 (TT) and Hap2 (CC). Figure 6Haplotype Hap2 (CC) showed superior resistance to NCLB compared to Hap1 (TT), with a significant difference in resistance between the two haplotypes. Therefore, we hypothesize that Hap2 may be a superior haplotype for enhancing NCLB resistance. Of the 528 RILs, 278 were Hap1 (TT) and 22 were Hap2 (CC), with the Hap2 haplotype identified only in pop1 (Table 4). Overall, haplotype analysis indicates that the dominant haplotype of SNP_305669223 was primarily found in pop1. Therefore, pop1 is considered to exhibit better resistance to NCLB, confirming the disease score distribution of RILs in pop1, which showed lower disease severity compared to pop2 and pop3.

[0068] Table 4. Distribution of genotypes

[0069]

[0070]

[0071] To determine the effect of the candidate gene Zm00001d034918 on NCLB resistance, we performed qRT-PCR analysis on this gene using four parents. Maize leaves were collected at 0.5, 1, 3, 6, 9, 12, 24, and 48 hours after artificial inoculation, and untreated leaves from each parent were collected as controls to measure the relative expression level of this gene in different parents. The results are as follows: Figure 7 This indicates that, compared with the untreated control group, the expression level of the Zm00001d034918 gene was significantly and stably increased in all four parents after inoculation with the pathogen. In HuangC and Zhang58, the expression level of Zm00001d034918 showed an increasing trend from 0.5 to 48 hours, while in AN20, the expression level of this gene began to decrease after 6 hours, and in Ye107, the expression level began to decrease after 0.5 hours.

[0072] Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, and not all embodiments. People can obtain other embodiments based on these embodiments without creative effort, and these embodiments all fall within the protection scope of the present invention.

Claims

1. A SNP locus molecular marker associated with resistance to corn leaf blight (NCLB), characterized in that: The SNP site is located in Chr1: SNP_305669223 of corn, and the molecular marker sequence is shown in SEQ ID NO.

1. As shown in SEQ ID NO:1, the base of the 201 bp site from the 5′ end of the sequence presents T / C polymorphism.

2. Use of the product for detecting the SNP site molecular marker of claim 1 in identifying or assisting in identifying NCLB resistance in corn, characterized in that: The application is to detect that when the genotype of the 201 bp site from the 5′ end of the sequence shown in SEQ ID NO: 1 is CC, a corn variety with significant NCLB resistance is obtained.

3. A method for improving corn resistance to NCLB, characterized in that: Gene editing tools were used to mutate the genotype of the 201 bp position from the 5′ end of the sequence shown in SEQ ID NO: 1 to CC.

4. A corn NCLB resistance protein associated with the SNP site molecular marker of claim 1, characterized in that: The amino acid sequence of the protein is shown in SEQ ID NO.

3.

5. The gene encoding the maize NCLB resistance protein according to claim 4, characterized in that: The gene is shown as SEQ ID NO.

2.

6. A kit, characterized in that: The kit contains reagents for detecting the protein according to claim 4 or the gene according to claim 5.

7. The kit according to claim 6, characterized in that The reagent contains primers for detecting the gene shown in SEQ ID NO.

2.

8. The kit according to claim 7, characterized in that The primers are shown as SEQ ID NO.4 and / or SEQ ID NO.

5.

9. Use of the kit according to any one of claims 6 to 8 in identifying or assisting in identifying NCLB resistance in maize, characterized in that: The expression level of the protein or gene is positively correlated with the NCLB resistance of corn.

10. Use of the SNP site molecular marker according to claim 1, or the protein according to claim 4, or the gene according to claim 5 in molecular marker-assisted breeding of NCLB-resistant corn.

Images