InDel molecular marker closely linked with ecological sterile character of Chinese cabbage and application of InDel molecular marker

Abstract

The invention provides an InDel molecular marker closely linked with ecological sterile characters of Chinese cabbage, and the number of the InDel molecular markers is four, specifically as follows: a molecular marker Brvms5-5216342, the nucleotide sequence of which is shown as SEQ ID NO.1, and a molecular marker Brvms5-5216342, the nucleotide sequence of which is shown as SEQ ID NO.2; the nucleotide sequence of the molecular marker Brvms5-6164784 is as shown in SEQ ID NO. 2; the nucleotide sequence of the molecular marker Brvms5-6315378 is as shown in SEQ ID NO. 3; the nucleotide sequence of the molecular marker Brvms5-6648913 is as shown in SEQ ID NO. 4. The molecular marker Brvms5- According to the invention, genetic locus positioning is carried out on a newly discovered ecological sterile material LY25 of Chinese cabbage, the sterile characteristic of the ecological sterile material LY25 is controlled by a single-gene recessive genetic locus Brvms5, and compared with the existing genetic pattern of thermo-sensitive sterile and complex allelic genes in Chinese cabbage vegetables, the genetic pattern is simple in genetic law and more convenient to use, and when a hybrid seed is produced, the yield of the hybrid seed is greatly improved. And only the Brvms5 site needs to be introduced into a female parent material.

Description

Technical Field

[0001] The invention belongs to the technical field of vegetable breeding and molecular genetics, and specifically relates to an InDel molecular marker tightly linked to the sterile trait of cabbage ecotype and application thereof. Background Art

[0002] Cabbage vegetables belong to the Brassica genus of the Brassica family in taxonomy. Brassica rapa ), including Chinese cabbage ( B. rapa ssp. pekinensis )、Pakchoy ( B. rapa ssp. chinensis )、Wutacai( B. rapa ssp. narinosa ) and more than ten different subspecies, variants and new types of interspecific hybridization. Cabbage vegetables have strong hybrid vigor, and self-incompatibility and male sterility are the main ways to produce hybrids. Self-incompatibility is a mechanism by which a plant resists its own pollen during flowering and tends to accept pollen from a single plant with a different haplotype. Breeders create self-incompatible parent materials so that they only accept pollen from the other parent under natural conditions to achieve hybrid production. However, the self-incompatibility method has problems such as low parental reproduction coefficient and a certain self-pollination rate of parents during seed production. Male sterility produces hybrids by using pollen-free female parents to accept male parent pollen under natural conditions to produce hybrids. It has the advantages of high hybridization rate and low cost of female parent breeding. It has now become the main method for hybrid seed production of cabbage vegetables.

[0003] The male sterility system of Chinese cabbage was first used in the 1970s, and several types have been developed, including cytoplasmic male sterility (CMS) and dual-purpose nuclear sterility. Different male sterility systems are used differently in Chinese cabbage vegetables. Ogura Type CMS is completely sterile and is currently used more on Chinese cabbage. Ogura When CMS is applied to some specific types of varieties such as red cabbage and Chinese cabbage, the flower buds will turn yellow at low temperatures, affecting their commercial quality. Polima Type CMS is affected by genetic background and low temperature induction, and is prone to powdering during seed production. It is currently mainly used in some pakchoi varieties with less powdering and red cabbage varieties. Dual-purpose nuclear sterility means that its sterility is controlled by recessive nuclear genes, and the sterile line is propagated by test crossing the heterozygous genotype mother with the sterile line. This method requires the removal of 50% of the fertile plants in the seed production field, which increases the cost of seed production. A number of recessive mutant genes that can be used for dual-purpose nuclear sterile seed production have been reported, such as Bra2ms , ftms However, due to the above reasons, dual-purpose nuclear sterility is generally less used in breeding.

[0004] Thermosensitive sterility and multiple allelic nuclear sterility systems have also attracted the attention of cabbage breeders. Thermosensitive sterility refers to the restoration of fertility in sterile lines under specific temperature conditions, which can achieve self-reproduction of sterile lines without the need for maintenance lines. In rapeseed and rice breeding, thermosensitive sterility is also often called eco-sterility. The thermosensitive sterility line TsCMS7311 of Chinese cabbage discovered by Zhang Lugang et al., whose thermosensitive sterility is regulated by two genetic loci, has been used in the production of Chinese cabbage hybrids. A set of restoration genes derived from the dual-purpose male sterility line AB01 of Chinese cabbage Ms f , sterility gene Ms Linbao Gene ms It is one of the earlier multiple allelic nuclear sterility systems used in cabbage vegetables. The multiple allelic nuclear sterility system can obtain 100% sterile female parents through hybridization of the Linbao line and the sterile line. With the help of linked molecular markers of the corresponding genes, this system has also been applied to cabbage vegetables such as pakchoi and cauliflower. Hong Xiaoru and others also discovered a nuclear sterility system of double gene recessive epistatic interaction in cabbage, which can produce a fully sterile population in production, and is expected to solve the problems of sterile line expansion and low hybrid fruiting rate encountered in the current cabbage seed production. Therefore, some sterile systems with advantages in sterile line expansion or sterile plant rate have been increasingly valued in cabbage vegetable breeding in recent years. Summary of the invention

[0005] In view of this, the present invention provides an InDel molecular marker tightly linked to the sterile trait of the cabbage ecotype and application thereof.

[0006] In order to achieve the above object, the present invention adopts the following technical solutions: One of the purposes of the present invention is to provide an InDel molecular marker that is closely linked to the sterile trait of the cabbage ecotype. There are four InDel molecular markers, which are as follows: Molecular markers Brvms5 -5216342, the nucleotide sequence is shown in SEQ ID NO.1; Molecular markers Brvms5 -6164784, the nucleotide sequence is shown in SEQ ID NO.2; Molecular markers Brvms5 -6315378, the nucleotide sequence is shown in SEQ ID NO.3; Molecular markers Brvms5 -6648913, the nucleotide sequence is shown in SEQ ID NO.4.

[0007] The second object of the present invention is to provide a primer for amplifying the above-mentioned InDel molecular marker, and the primer is specifically as follows: Amplification of molecular markers Brvms5The primer sequence of -5216342 is shown in SEQ ID NO.5; Amplification of molecular markers Brvms5 The primer sequence of -6164784 is shown in SEQ ID NO.6; Amplification of molecular markers Brvms5 The primer sequence of -6315378 is shown in SEQ ID NO.7; Amplification of molecular markers Brvms5 The primer sequence of -6648913 is shown in SEQ ID NO.8.

[0008] The third object of the present invention is to provide a method for detecting the sterility trait of the cabbage ecotype, and the method is specifically as follows: S1. Extract genomic DNA from the plant to be tested; S2, using the DNA in S1 as a template, and amplifying using the primers described in claim 2; S3. The amplified product in S2 was analyzed by gel electrophoresis. The results are as follows: If the result of amplification by the primers shown in SEQ ID NO.5 produces a DNA band of 542 bp, it is a sterile plant; if a DNA band of 483 bp is produced, it is a fertile plant; If the result of amplification by the primers shown in SEQ ID NO.6 produces a DNA band of 359 bp, it is a sterile plant; if it produces a DNA band of 316 bp, it is a fertile plant; If the result of amplification by the primers shown in SEQ ID NO.7 produces a DNA band of 307 bp, it is a sterile plant; if a DNA band of 246 bp is produced, it is a fertile plant; If the result of amplification with the primers shown in SEQ ID NO.8 produces a DNA band of 332 bp, it is a sterile plant; if it produces a DNA band of 297 bp, it is a fertile plant.

[0009] In some specific embodiments, preferably, the PCR reaction system is the same when performing PCR amplification, specifically as follows: total volume 10 μL, including: 2X Magic green Taq super Mix 5.0 μL, forward and reverse primers (10 μM) 0.4 μL each, DNA template (50~200 ng / μL) 2 μL, ddH2O 2.2 μL.

[0010] In some specific embodiments, preferably, the PCR reaction procedures are substantially the same when performing PCR amplification, specifically as follows: 94°C pre-denaturation for 3 min; 94°C denaturation for 30 s, 55°C / 52°C annealing for 30 s, 72°C extension for 30 s, 35 cycles; 72°C extension for 5 min, 4°C storage for 10 min; Among them, the annealing temperature during amplification of the primers shown in SEQ ID NO.5 and SEQ ID NO.7 is 55°C; the annealing temperature during amplification of the primers shown in SEQ ID NO.6 and SEQ ID NO.8 is 52°C.

[0011] In some specific embodiments, preferably, the gel electrophoresis detection step is as follows: the PCR product is electrophoresed on 3% agarose gel at 110V for 1 hour, and the result is displayed on a gel imaging system.

[0012] A fourth object of the present invention is to provide application of the above-mentioned InDel molecular marker in cabbage breeding.

[0013] Compared with the prior art, the present invention has the following beneficial effects: (1) The present invention locates the genetic loci of the newly discovered ecotype sterile material LY25 of Chinese cabbage and finds that its sterility characteristic is affected by a single gene recessive genetic locus. Brvms5 Compared with the existing thermosensitive sterility and multiple allele inheritance patterns in cabbage vegetables, the genetic law is simpler and more convenient to use. When producing hybrids, only Brvms5 The loci can be introduced into the parent material.

[0014] (2) Brvms5 The sterile line can be used as its own maintenance line. Brvms5 The ecotypic sterility characteristic of the locus is that it is partially fertile in autumn. Therefore, this locus has greater application value in cabbage vegetables such as Chinese cabbage heart and early-maturing cabbage stalks that can complete the normal flowering and seeding process in autumn. This characteristic can be used to achieve Brvms5 The self-pollination of sterile lines is similar to the existing cytoplasmic sterility types used in Chinese cabbage and Chinese cabbage moss, such as Ogura Type CMS, Polima Compared with the CMS type, no additional maintenance line is needed. In addition, after the small plants bolt in spring, the sterile line shows complete sterility, which is different from the test cross of the nuclear sterile dual-purpose line, which requires the removal of 50% of the fertile plants, and Polima Type CMS has obvious advantages in that the emergence of micro-powder fertile plants after low temperatures in spring affects the purity of hybrids. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] Figure 1 These are characteristic pictures of fertility conversion that occurred in the middle and late stages of the female plant LY25; a is an inflorescence that did not undergo fertility conversion; b is an inflorescence that partially converted to fertility, with the flower with pollen indicated by the red arrow; c is an inflorescence that was completely converted to fertile; d is the basic morphology of anthers and nectaries of sterile and fertile flowers.

[0016] Figure 2This is the Δ-SNPindex distribution diagram of the mixed pool of sterile and fertile in the F2 population; the gray is the 99% confidence interval threshold line, and the green is the 95% confidence interval threshold line.

[0017] Figure 3 is the Δ-SNPindex distribution diagram of chromosome A05; the dotted line indicates Brvms5 The interval where the site is located.

[0018] Figure 4 and Brvms5 Detection results of PCR products of four linked InDel markers; a, b, c, and d are InDel markers, respectively. Brvms5 -5216342, Brvms5 -6164784, Brvms5 -6315378, Brvms5 -6648913, M represents DNA marker, SJ37 is the fertile parent, LY25 is the sterile parent, F1 is the hybrid generation of the two, B1-B9 are sterile plants randomly selected from the F2 population; K1-K9 are fertile plants randomly selected from the F2 population. DETAILED DESCRIPTION

[0019] The present invention is further described in detail below in conjunction with specific embodiments so that those skilled in the art can understand the present invention more clearly.

[0020] Sources and physical and chemical parameters of key test materials: The Chinese cabbage mother plant LY25 comes from a dioecious plant identified in the commercial Chinese cabbage variety "Qiuxiang 828". Its characteristics are significantly different from those of "Qiuxiang 828". No segregation of agronomic traits occurred after two consecutive self-pollinations, but segregation of fertility occurred (fertile: sterile ratio is 3:1). LY25 is the sterile plant line number in the self-pollination progeny population of this dioecious plant.

[0021] The male parent plant of Chinese cabbage SJ37 comes from the inbred line purified from three generations of self-pollination of the conventional Chinese cabbage variety “Sijiu Huangye”.

[0022] The specific raw materials not described in the present invention are all existing materials and can be directly purchased from the market.

[0023] Example 1 This embodiment provides a method for obtaining an InDel molecular marker that is tightly linked to the sterile trait of the Chinese cabbage ecotype, as follows: 1. Genetic population construction Material Information: Cabbage sterile line LY25: LY25 is a new type of eco-sterile material. When cultivated in autumn, it is male sterile at the beginning of flowering. In the middle and late stages of growth, fertility conversion occurs to varying degrees, and 40% of the plants are completely transformed into fertile ( Figure 1 LY25 showed small bolting in spring cultivation and was strictly sterile throughout the growth period.

[0024] Cabbage inbred line SJ37: SJ37 is an inbred line separated from the conventional Chinese cabbage variety "Sijiu Huangye", and it shows normal fertility in both spring and autumn.

[0025] Using LY25 as the female parent and SJ37 as the male parent, F1 generation seeds were obtained; F1 generation seeds were sown, and the F1 generation was self-pollinated during the flowering period to obtain F2 generation seeds; F2 generation seeds were sown in autumn, and an F2 segregation population of 500 plants was planted.

[0026] 2. Location of the male sterility genetic locus in LY25 After the F2 segregation population bloomed, the fertility characteristics of the flowers were investigated from the beginning to the end of the flowering period. 381 plants were fertile at the beginning of the flowering period, and 119 plants were sterile. The chi-square test showed that the fertility segregation met the 3:1 characteristics, indicating that the sterility of LY25 was controlled by a recessive nuclear gene. 20 F2 plants that were completely fertile throughout the growth period were selected, DNA was extracted, and the DNA of each plant was mixed in equal amounts to form a fertile mixed pool DNA; 20 F2 plants that were sterile during the flowering period were selected, DNA was extracted, and the DNA of each plant was mixed in equal amounts to form a sterile mixed pool DNA. DNA of parents LY25 and SJ37 was extracted, and the DNA of parents LY25, SJ37 and fertile and sterile mixed pools were resequenced at 10X, 10X, 20X and 20X respectively using the second-generation sequencing technology. After obtaining the whole genome resequencing data, the Chinese cabbage T2T genome (ChifuV4.0) was used as the reference genome, and the vcf genotype file was obtained by Samtool, BWA and GATK software. Then, the genetic positioning of the sterile locus was carried out based on the QTL-seq method, and the Δ-SNPindex distribution characteristics of the whole genome were obtained ( Figure 2 The distribution of Δ-SNPindex showed that there were many Δ-SNPindex values ​​exceeding the 99% confidence interval (99% CI) on chromosome A05. Among them, there were continuous Δ-SNPindex values ​​with small fluctuations and extremely significant levels (CI>99) in the 5.1-7.5Mb interval at the front end of chromosome A05, which was consistent with the typical linkage disequilibrium characteristics. Therefore, this interval was preliminarily used as the linkage interval where the LY25 ecotype sterility genetic locus was located ( Figure 3 ), and the located sterile locus was named Brvms5 .

[0027] 3. Development of InDel-linked molecular markers for ecotypic sterility genes Based on the vcf genotype file obtained in step 2, the genotypes of InDel (insertion-deletion mutation type molecular marker) in the A05: 5.1-7.5Mb linkage interval of LY25 and SJ37 were analyzed. The conditions for selecting InDel were: 1. Nucleic acid sequence>30bp; 2. Polymorphism in LY25 and SJ37; 3. The genotypes of LY25 and SJ37 were both homozygous. Finally, four InDel molecular markers were screened, and the specific information is as follows: The first InDel is located at A05:5216342 and is named Brvms5 -5216342, the nucleotide sequence of LY25 is: TGAAAGAACATTCTATGCCGCCGTTTTAGCTGCACCTAAGGCTAAGCCCTTCAAAACATA (SEQ ID NO. 1), and SJ37 is: T; The second InDel is located at A05:6164784 and is named Brvms5 -6164784, the nucleotide sequence of LY25 is here: GCCCATAAAATCTAGTCCTTCGCAAATTATCCGGATATGAAGTC (SEQ ID NO. 2), and SJ37 is here: G; The third InDel is located at A05:6315378 and is named Brvms5 -6315378, the nucleotide sequence of LY25 is: GGTTGGATAATAAAGAACATGATAATTCTGTAAATGATTTTCCAATTACTCATAACGCTTAT (SEQ ID NO. 3), and SJ37 is: G; The fourth InDel is located at A05:6648913 and is named Brvms5 -6648913, the nucleotide sequence of LY25 here is: ATCAATAAGATTATTGTCTTAATTGTTTTTTCTTTG (SEQ ID NO.4), and SJ37 here is: A.

[0028] Example 2 This example further performs linkage verification on the four InDel molecular markers obtained in Example 1, and the specific steps are as follows: 1. Primer design Primers were designed for the four InDel molecular markers obtained in Example 1. The specific primer sequences are as follows: Amplification of molecular markers Brvms5-5216342 primer sequence SEQ ID NO.5: Brvms5 -5216342-F: TGAGGAGTTCAGAAGACTCAATTTG; Brvms5 -5216342-R:GTGTCTGAACTACCTTACTAAAACAAA; Amplification of molecular markers Brvms5 -6164784 primer sequence SEQ ID NO.6: Brvms5 -6164784-F:AGGAAGCACAACGAAGGTACTAG; Brvms5 -6164784-R:TTGGTTCGGTTCGTTTATCGACT; Amplification of molecular markers Brvms5 -6315378 primer sequence SEQ ID NO.7: Brvms5 -6315378-F:ACCAAAAGCTCTCTATGAAAACA; Brvms5 -6315378-R: GGTAAACATATCCTGAATGTGATAACT; Amplification of molecular markers Brvms5 -6648913 primer sequence SEQ ID NO.8: Brvms5 -6648913-F:AGCTTAGGATCCAAGCAACTTC; Brvms5 -6648913-R:AATGCAGAGCAGCAACTTCA.

[0029] 2. PCR amplification and product detection The parents LY25, SJ37, and F1 were selected, and the sterile plants (9 plants) and fertile plants (9 plants) were randomly selected from the F2 plants, and their genomic DNA was extracted respectively; the extracted DNA was used as a template, and PCR amplification was performed respectively using the primers designed in the above step 1, and then the amplified products were detected by gel electrophoresis (the results are shown in Figure 4 ).

[0030] The PCR reaction system was the same during PCR amplification, as follows: total volume 10 μL, including: 2X Magicgreen Taq super Mix 5.0 μL, forward and reverse primers (10 μM) 0.4 μL each, DNA template (50-200 ng / μL) 2 μL, ddH2O 2.2 μL.

[0031] The PCR reaction procedures were basically the same when performing PCR amplification, as follows: pre-denaturation at 94°C for 3 min; denaturation at 94°C for 30 s, annealing at 55°C / 52°C for 30 s, extension at 72°C for 30 s, for 35 cycles; extension at 72°C for 5 min, and storage at 4°C for 10 min; Among them, the annealing temperature during amplification of the primers shown in SEQ ID NO.5 and SEQ ID NO.7 is 55°C; the annealing temperature during amplification of the primers shown in SEQ ID NO.6 and SEQ ID NO.8 is 52°C.

[0032] The steps for gel electrophoresis detection are as follows: PCR products are electrophoresed on 3% agarose gel at 110V for 1 hour, and the results are displayed on a gel imaging system.

[0033] Depend on Figure 4 The results show that there are four InDel markers: Brvms5 -5216342, Brvms5 -6164784, Brvms5 -6315378, Brvms5 -6648913 was completely linked to the sterile locus in the F2 segregating population, which also verified the conclusion in Example 1, that the sterile locus Brvms5 Located in the significant interval of 5.1-7.5Mb at the front end of chromosome A05. At the same time, these four InDel markers can also be used as nuclear sterility sites Brvms5 Linked markers are used to transfer the sterile locus from LY25 backcross in breeding. Brvms5 .

[0034] Through the above research, the present invention successfully screened out four InDel molecular markers closely linked to the sterile traits of cabbage ecotypes and verified them, which provided a basis for their use in subsequent cabbage breeding. Brvms5 Provides effective linkage markers.

[0035] The above are only preferred embodiments of the present invention and are not intended to limit the protection scope of the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principles of the present invention should be included in the protection scope of the present invention.

Claims

1. An InDel molecular marker tightly linked to the sterility trait of cabbage ecotype, characterized in that: There are four InDel molecular markers, as follows: Molecular markers Brvms5 -5216342, the nucleotide sequence is shown in SEQ ID NO.1; Molecular markers Brvms5 -6164784, the nucleotide sequence is shown in SEQ ID NO.2; Molecular markers Brvms5 -6315378, the nucleotide sequence is shown in SEQ ID NO.3; Molecular markers Brvms5 -6648913, the nucleotide sequence is shown in SEQ ID NO.

4.

2. A primer for amplifying the InDel molecular marker according to claim 1, characterized in that: The primers are specifically as follows: Amplification of molecular markers Brvms5 The primer sequence of -5216342 is shown in SEQ ID NO.5; Amplification of molecular markers Brvms5 The primer sequence of -6164784 is shown in SEQ ID NO.6; Amplification of molecular markers Brvms5 The primer sequence of -6315378 is shown in SEQ ID NO.7; Amplification of molecular markers Brvms5 The primer sequence of -6648913 is shown in SEQ ID NO.

8.

3. A method for detecting the sterility trait of cabbage ecotype, characterized in that: The method is specifically as follows: S1. Extract genomic DNA from the plant to be tested; S2, using the DNA in S1 as a template, and amplifying using the primers described in claim 2; S3. The amplified product in S2 was analyzed by gel electrophoresis. The results are as follows: If the result of amplification by the primers shown in SEQ ID NO.5 produces a DNA band of 542 bp, it is a sterile plant; if a DNA band of 483 bp is produced, it is a fertile plant; If the result of amplification by the primers shown in SEQ ID NO.6 produces a DNA band of 359 bp, it is a sterile plant; if it produces a DNA band of 316 bp, it is a fertile plant; If the result of amplification by the primers shown in SEQ ID NO.7 produces a DNA band of 307 bp, it is a sterile plant; if a DNA band of 246 bp is produced, it is a fertile plant; If the result of amplification with the primers shown in SEQ ID NO.8 produces a DNA band of 332 bp, it is a sterile plant; if it produces a DNA band of 297 bp, it is a fertile plant.

4. The method according to claim 3, characterized in that The PCR reaction system was the same during PCR amplification, as follows: total volume 10 μL, including: 2X Magic green Taq super Mix 5.0 μL, forward and reverse primers (10 μM) 0.4 μL each, DNA template (50~200 ng / μL) 2 μL, ddH2O 2.2 μL.

5. The method according to claim 3, characterized in that: The PCR reaction procedure was basically the same when performing PCR amplification, as follows: pre-denaturation at 94°C for 3 min, denaturation at 94°C for 30 s, annealing at 55°C / 52°C for 30 s, extension at 72°C for 30 s, 35 cycles, extension at 72°C for 5 min, and storage at 4°C for 10 min; The annealing temperature of the primers shown in SEQ ID NO.5 and SEQ ID NO.7 during amplification is 55°C; the annealing temperature of the primers shown in SEQ ID NO.6 and SEQ ID NO.8 during amplification is 52°C.

6. The method according to claim 3, characterized in that The steps for gel electrophoresis detection are as follows: PCR products are electrophoresed on 3% agarose gel at 110V for 1 hour, and the results are displayed on a gel imaging system.

7. Use of the InDel molecular marker according to claim 1 in cabbage breeding.

Images