Preparation method of dual-enzyme inorganic functional nanoflower and its application in preparing competitive ELISA kit for detection of clonorchiasis

By preparing the dual enzyme inorganic functional nanoflower composite, the species restriction problem of genus cynomolia detection was solved, and high sensitivity and specific detection for multi-hosts were achieved. It is suitable for cynomolia detection in dogs, rats and humans.

CN119757724BActive Publication Date: 2025-08-15JILIN RUNUO BIOTECHNOLOGY CO LTD
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202411933127.9
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-12-26
Publication Date
2025-08-15
Estimated Expiration
2044-12-26

AI Technical Summary

Technical Problem

The prior art cannot effectively detect recessive patients with cynomoliasis, resulting in the spread of infection, and the traditional enzyme-labeled secondary antibody method has genera limitations, insufficient sensitivity and specificity.

Method used

A dual enzyme inorganic functional nanoflower composite was prepared, and McAb-HRP@Cu-HNFs were generated through co-precipitation reactions of monoclonal antibody, HRP and copper phosphate solutions of Cystosaccharides to compete for ELISA detection, breaking species limitations and improving detection sensitivity.

Benefits of technology

It realizes sensitive, specific and accurate detection of multi-hosts of Chinese dysfunction, and is suitable for multi-host detection in dogs, mice and humans. It has the advantages of simple operation, low cost and good repetition.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119757724B_ABST
    Figure CN119757724B_ABST
Patent Text Reader

Abstract

The present invention discloses a method for preparing a dual-enzyme inorganic functional nanoflower and its application in preparing a competitive ELISA kit for detecting Clonorchis sinensis. This invention belongs to the technical field of Clonorchis sinensis detection. The present invention provides a method for preparing a dual-enzyme inorganic functional nanoflower composite material. The composite material is prepared by reacting a Clonorchis sinensis monoclonal antibody, HRP, and a copper phosphate solution at room temperature for 12-48 hours, followed by coprecipitation to obtain the functional nanoflower composite material. By utilizing the ability of HNFs to catalyze the substrate TMB, the method overcomes the species restrictions imposed by traditional enzyme-labeled secondary antibodies, improves detection sensitivity, and enables multi-host detection of Clonorchis sinensis.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The invention belongs to the technical field of Clonorchis sinensis detection, and particularly relates to a preparation method of a dual-enzyme inorganic functional nanoflower and an application of the nanoflower in preparing a competitive ELISA kit for Clonorchis sinensis disease detection. Background Art

[0002] Mild cases of clonorchiasis often present with no symptoms, but later-stage symptoms can worsen and pose a serious threat to human health. The lack of effective diagnostic technology is a major factor in the inability to detect latent cases, leading to widespread contamination and a year-on-year increase in infection rates. Currently, there are no products available in the domestic or international market to detect human clonorchiasis, severely hindering disease prevention and control efforts. While immunological diagnostic techniques are widely used for a variety of pathogens, including parasites, their sensitivity and specificity still require significant improvement.

[0003] Clonorchis sinensis has a wide distribution of definitive hosts (humans, dogs, cats, pigs, etc.). Companion animals like dogs and cats share the same living environments as humans. Therefore, solely targeting human-source transmission is insufficient to completely control clonorchiasis. Simultaneously monitoring infection frequencies in various definitive hosts along the food chain is also necessary to achieve multi-faceted, all-encompassing prevention and control. Therefore, establishing a multi-host detection method for Clonorchis sinensis to facilitate epidemiological surveillance is crucial for controlling the prevalence of the disease. Summary of the Invention

[0004] The purpose of the present invention is to improve the sensitivity of detecting Clonorchis sinensis antibodies and to improve the sensitivity and specificity of finding antibodies in serum samples with low-intensity infection.

[0005] The invention provides a preparation method of a dual-enzyme inorganic functional nanoflower composite material. The preparation method of the composite material is as follows: a Clonorchis sinensis monoclonal antibody, HRP and a copper phosphate solution are reacted at room temperature for 12-48 hours, and the functional nanoflower composite material is obtained after coprecipitation.

[0006] It is further defined that the total volume is 50 mL, the mass ratio of Clonorchis sinensis monoclonal antibody to HRP is (1-3): (1-3), the concentration of copper phosphate solution is 50 nM-200 nM, and PBS solution is added to dissolve to 50 mL.

[0007] It was further specified that the mass ratio of the Clonorchis sinensis monoclonal antibody to HRP was 1:2, the concentration of the copper phosphate solution was 100 nM, and the reaction was carried out at room temperature for 24 hours.

[0008] It is further defined that the specific conditions of the co-precipitation are to collect the crystal precipitate by centrifugation at 12,000 r and 4° C. for 30 min, wash it three times with deionized water, and dry it at 30° C.

[0009] It is further defined that the monoclonal antibody against Clonorchis sinensis is obtained by secretion of a hybridoma cell line, and the hybridoma cell line has been deposited in the General Microbiology Center of the China Culture Collection Administration of Microorganisms, with the deposit number CGMCCNO.46128 and the deposit time being November 6, 2024.

[0010] The present invention provides a dual-enzyme-inorganic functional nanoflower composite material obtained by the above method.

[0011] The present invention provides a Clonorchis sinensis antibody detection kit, which comprises the above-mentioned dual-enzyme-inorganic functional nanoflower composite material.

[0012] It is further defined that the kit also includes an ELISA reaction plate, a Clonorchis sinensis CSTR1 antigen, a blocking solution, a sample diluent, a washing solution, a color development substrate and a stop solution.

[0013] Further defined, the ELISA well reaction plate is coated with 7.5ug / mL of Clonorchis sinensis CsTR1 antigen, the blocking solution is 5% skim milk, the sample diluent is phosphate buffered saline, the washing solution is PBST, the chromogenic substrate is 30% H2O2 and 50mMTMB, and the stop solution is 2M H2SO4.

[0014] The present invention provides an application of the above-mentioned kit in a kit for detecting clonorchiasis sinensis.

[0015] Beneficial Effects: Using McAb, HRP, and Cu₃(PO₄)₂ in a natural state, bifunctional nanoflowers are generated, competing with the test serum for binding to the CSTR1 antigen on the plate bottom. The amount of HNFs bound to the plate bottom is then measured to determine the CSTR1 antibody content in the test serum. Furthermore, by utilizing the HNFs' ability to catalyze the substrate TMB, the species restrictions imposed by traditional enzyme-labeled secondary antibodies are overcome, improving detection sensitivity and enabling multi-host detection of Clonorchis sinensis.

[0016] The method provided by the present invention can achieve the effect of catalyzing the TBM substrate without the need for additional coupling of monoclonal antibodies with HRP, and can also achieve the effect of catalyzing the TBM substrate without adding HRP.

[0017] The present invention provides a preparation method for a monoclonal antibody-based dual-enzyme-inorganic functional nanoflower (McAb-HRP@Cu-HNFs) and a competitive ELISA kit for multi-host detection of clonorchiasis. The dual enzymes are a CSTR1 monoclonal antibody (McAb) and horseradish peroxidase (HRP), and the inorganic carrier is copper phosphate. The monoclonal antibody in the McAb-HRP@Cu-HNFs can specifically bind to the CSTR1 antigen of Clonorchiasis sinensis, and HRP can enhance the ability to catalyze the substrate. The competitive ELISA method established on this basis is sensitive, specific, and accurate, and can be used for the detection of multi-host (dog, mouse, and human) clonorchiasis. The McAb-HRP@Cu-HNFs preparation method provided by the present invention is simple to operate, low in cost, and has mild reaction conditions. It is easy and quick to operate. Compared with traditional etiological diagnostic methods, it has the advantages of high specificity, high sensitivity, good reproducibility, and large-scale diagnosis, providing technical support for multi-host detection of clonorchiasis sinensis.

[0018] [Biological Deposit Information]: A hybridoma cell line against the CSTR1 antigen of Clonorchis sinensis, named CSTR1-C3B4C10, has been deposited in the General Microbiology Center of China Culture Collection Administration, with the deposit number CGMCCNO.46128 and the deposit date is November 6, 2024. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 The microscopic morphology of three nanoflowers under electron microscope;

[0020] Figure 2 The detection effect diagram of McAb-HRP@Cu-HNFs at different growth stages;

[0021] Figure 3 The optimization results of the nanoflower generation system are shown in Figure 1. A is the optimization result of the ratio of McAb and HRP, and B is the optimization result of Cu 2+ Concentration optimization result diagram;

[0022] Figure 4 The results of McAb-HRP@Cu-HNFs detection of multiple host serums are shown in Figure 1. A is the rabbit serum test result, B is the mouse serum test result, C is the dog serum test result, and D is the human serum test result.

[0023] Figure 5 The following are the optimization results of coating solution and coating time in McAb-HRP@Cu-HNFs-cELISA reaction system; A is the coating solution selection result, and B is the coating time selection result;

[0024] Figure 6The optimization results of blocking solution and blocking time in the McAb-HRP@Cu-HNFs-cELISA reaction system are shown in Figure 1. A is the result of blocking solution selection, and B is the result of blocking time selection.

[0025] Figure 7 Figure 1 shows the optimization results of competitive incubation time and color development time in the McAb-HRP@Cu-HNFs-cELISA reaction system; A is the incubation time selection result diagram, and B is the color development time selection result diagram;

[0026] Figure 8 Figure 1 shows the evaluation results of McAb-HRP@Cu-HNFs-cELISA in canine serum samples; A: Defining the positive and negative cutoff value; B: Antibody titer curve; C: Specificity test;

[0027] Figure 9 The results of the McAb-HRP@Cu-HNFs-cELISA application evaluation in mouse serum samples; A: Determine the positive and negative critical value; B: Determine the antibody titer curve;

[0028] Figure 10 Figure 1 shows the evaluation results of McAb-HRP@Cu-HNFs-cELISA in human serum samples; A: Defining the positive / negative cutoff value; B: Antibody titer curve; C: Specificity test;

[0029] Figure 11 The results of the verification of the functionality of nanoflowers; A is the catalytic substrate of HRP-HNFs; B is the specific competitive recognition antibody of McAb-HNFs; C is the enhanced detection effect of McAb-HRP@Cu-HNFs. DETAILED DESCRIPTION

[0030] Example 1. Preparation of hybridoma cells

[0031] A peptide (KLH-GGKAPPPESA) was prepared based on the repeating unit of CSTR1 for mouse immunization. The peptide was prepared by Sangon Biotech (Shanghai) Co., Ltd.

[0032] (1) First immunization: Mix the prepared KLH-GGKAPPPESA (100 μg) with an equal amount of Freund's complete adjuvant, sonicate until the mixture is in an emulsion state, and inject 200 μL / mouse subcutaneously at multiple points. 14 days later, perform the second immunization with the same dosage as the first immunization, and try to avoid the first inoculation site. 14 days later, perform the third immunization with the same procedure as above. For the fourth immunization, no adjuvant is added and the mouse is injected intraperitoneally. 10 days later, collect serum to detect antibody titer.

[0033] (2) Determination of Mouse Serum Titer: KLH-GGKAPPPESA peptide was used as an ELISA coating antigen to detect serum antibody titers in immunized mice. Serum from unimmunized mice was used as a negative control. The maximum serum dilution with a P / N ratio > 2.1 was defined as the mouse serum titer (Table 1).

[0034] Table 1 Detection of serum titers in immunized mice

[0035]

[0036] (3) Cell fusion. Remove SP2 / 0 cells from liquid nitrogen, quickly place them in a 37°C water bath to dissolve, then transfer them to a biosafety cabinet, centrifuge to remove the supernatant, resuspend them with 1 mL of DMEM basal medium, and transfer them to a culture flask. Add an appropriate amount of complete culture medium, gently mix, and culture in an incubator. After one day of culture, centrifuge to remove the supernatant, count, and store at 4°C. Sacrifice the experimental mice, disinfect them with 75% alcohol, cut open the abdomen to expose the peritoneum, inject the basal culture medium into the mouse's abdominal cavity, repeatedly press the abdominal cavity, and aspirate the liquid into a centrifuge tube. After centrifugation, remove the supernatant, the bottom is the feeder layer cells, blow them away with 20% HAT complete culture medium, and plate 200 μL / well on a 96-well plate for culture. Select mice with a CSTR1 antibody titer higher than 1:5,000 after four immunizations, collect blood from the eyeballs, separate the serum, and store at -20°C for later use.

[0037] The mice were then disinfected with 75% ethanol, and the spleen was removed and ground. Filtered with a sterile mesh and rinsed with basal culture medium. The rinse was collected and centrifuged to precipitate spleen cells, which were resuspended with basal culture medium and counted for later use. SP2 / 0 cells in the logarithmic growth phase were selected and mixed with spleen cells at a ratio of 1:5. The supernatant was removed by centrifugation, and the sediment at the bottom of the centrifuge tube was gently knocked apart. The tube was placed in a 37°C water bath, and preheated PEG 4000 was added (completed within 60 seconds). The centrifuge tube was gently shaken and allowed to stand for 30 seconds. The preheated basal culture medium was then added to terminate. The cells were resuspended with 20% HAT complete culture medium, plated onto a 96-well plate, and cultured in a 37°C, 5% CO2 incubator. 20% HAT DMEM complete culture medium was supplemented on days 4 and 8, respectively, and cell fusion was observed throughout the process.

[0038] (4) Screening and cloning of positive wells. On the 5th and 10th day after cell fusion, the cell culture supernatant was collected and 100 μL was added to each well of a 96-well plate. The cells were incubated at 37°C for 60 minutes, washed three times, and patted dry. Then, 100 μL of rabbit anti-mouse secondary antibody diluted 1:5000 was added to each well. The cells were also incubated at 37°C for 60 minutes, washed three times, and patted dry. Then, 100 μL of TMB was added to each well. The cells were protected from light and developed for 15 minutes. Then, 100 μL of stop solution was added to terminate the reaction. The supernatant of SP2 / 0 cells was used as a negative control in the experiment. The absorbance value was read by a microplate reader. The 31-B4-C10 cell line was screened out with the highest titer (Table 2).

[0039] Table 2 Indirect ELISA detection of cell line supernatant titer

[0040] cell lines 6-E5-E7 17-H10-F10 19-G1-D4 26-C11-H8 27-F1-H9 <![CDATA[OD 450 ]]> 2.02 1.93 1.94 2.71 2.29 cell lines 28-F6-D2 29-D10-D7 31-B4-C10 Negative control Positive control <![CDATA[OD 450 ]]> 1.96 2.23 3.44 0.05 3.31

[0041] Select cells with high OD values ​​for expansion culture, freeze a portion, and subclone the remaining portion again. After pipetting and mixing the liquid in the positive cell wells, transfer it to a 1.5mL centrifuge tube and centrifuge to remove the supernatant. Continue to subculture the cells to the 25th generation to obtain a stable hybridoma cell line. During the final culture, when the cells are in the logarithmic growth phase, freeze the cells, record the relevant information in detail, and store in liquid nitrogen.

[0042] Preservation information of the 31-B4-C10 cell line: A hybridoma cell line secreting monoclonal antibodies against Clonorchis sinensis, named CSTR1-C3B4C10, has been deposited in the General Microbiology Center of the China Culture Collection Administration of Microorganisms with the deposit number CGMCC NO.46128 and the preservation date is November 6, 2024.

[0043] (5) Preparation of monoclonal antibody ascites and titer determination. Female Balb / c mice were intraperitoneally injected with 0.5 mL of IFA to stimulate immune response. Nine days later, 0.5 mL of culture medium (containing 2×10 6 Hybridoma cells). Monitor the mice's mental state and abdominal volume daily. If the mouse's abdomen is significantly distended, collect ascites with a syringe and centrifuge at 5,000 r / min for at least 20 minutes. The supernatant is the monoclonal antibody and should be stored at -80°C until needed.

[0044] Ascites fluid was serially diluted and plated onto a 96-well plate at 100 μL / well. The plate was coated at 37°C for 60 minutes, washed three times with PBST, and patted dry. A 1:5,000 dilution of HRP-conjugated rabbit anti-mouse secondary antibody was added at 100 μL / well and incubated at 37°C for 60 minutes. The plate was washed three times with PBST and patted dry. A single-component TMB substrate solution was added at 100 μL / well and color was developed at 37°C in the dark for 10 minutes. The reaction was terminated by adding 2 M sulfuric acid at 100 μL / well. A negative control was coated with ascites fluid from SP2 / 0 cells, and all other procedures were the same. The titer of mouse 31-B4-C10 ascites fluid was read on a microplate reader, and the titer reached 1:32,000.

[0045] (6) Monoclonal antibody subclass identification. The ascites of mice injected with monoclonal antibodies was collected to identify Clonorchis sinensis McAb. The subclass of the monoclonal antibody was identified using IgG1, IgG2a, IgM, and IgA antibodies, respectively. The monoclonal antibody was IgG1.

[0046] Example 2. Preparation and verification of McAb-HRP@Cu-HNFs functional nanoflowers

[0047] 1. Preparation of McAb-HRP@Cu-HNFs functional nanoflowers: First, the Clonorchis sinensis McAb and HRP obtained in Example 1 were diluted to 1 mg / mL with 0.1M PBS. 30 μL of each diluted solution was added to 50 mL of 0.1M PBS solution, followed by 10 μL of 100 mM copper phosphate solution. The mixture was allowed to stand at room temperature for 24 hours. During this period, the nanoflowers gradually grew and multiplied, forming blue crystals at the bottom. The entire liquid was centrifuged at 12,000 r at 4°C for 30 minutes to collect the precipitate, which was then washed three times with deionized water. The final precipitate was dried at 30°C to obtain a solid crystalline powder, namely McAb-HRP@Cu-HNFs.

[0048] 2. Preparation of McAb@Cu--HNFs: The Clonorchis sinensis McAb obtained in Example 1 was diluted to 1 mg / mL with 0.1M PBS. 30 μL of each diluted solution was added to 50 mL of 0.1M PBS solution, followed by 10 μL of 100 mM copper phosphate solution. The mixture was allowed to stand at room temperature for 24 hours. During this period, nanoflowers gradually formed and increased in number, with blue crystals forming at the bottom. The entire solution was centrifuged at 12,000 r / min at 4°C for 30 minutes to collect the precipitate, which was then washed three times with deionized water. The final precipitate was dried at 30°C to obtain a solid crystalline powder.

[0049] 3. HRP@Cu--HNFs: HRP was diluted to 1 mg / mL with 0.1M PBS. 30 μL of each diluted solution was added to 50 mL of 0.1M PBS. Then, 10 μL of 100 mM copper phosphate solution was added. The mixture was allowed to stand at room temperature for 24 hours. During this period, the nanoflowers gradually grew and multiplied, forming blue crystals at the bottom. The entire solution was centrifuged at 12,000 r / min at 4°C for 30 minutes to collect the precipitated crystals. The precipitated crystals were washed three times with deionized water and dried at 30°C to obtain a solid crystalline powder.

[0050] The dried McAb@Cu-HNFs, HRP@Cu-HNFs, and McAb-HRP@Cu-HNFs were diluted with deionized water to a concentration of 1 mg / mL, and 30 μL was added to a clean silicon wafer and placed in an incubator to dry naturally. After gold spraying, the microscopic morphology of the three nanoflowers was observed under a desktop scanning electron microscope. All three structures showed a typical "flower"-like morphology. HRP-HNFs was looser and had a larger specific surface area than the other two structures; McAb-HNFs had the most compact morphology and resembled a rose; McAb-HRP@Cu-HNFs had a typical "petal"-like structure and the largest surface area among the three. With a large surface area, there are more binding sites exposed on the surface, which is more conducive to binding to substrate-coated antigens ( Figure 1 ).

[0051] Compared with the detection effect of McAb@Cu-HNFs, McAb-HRP@Cu-HNFs can also achieve specific competitive binding to CRTR1 antibodies in serum, and the 1-(P / N) value is improved, which is better than that of simple McAb@Cu-HNFs ( Figure 11 ).

[0052] The growth of nanoflowers includes three stages: nucleation, aggregation, and growth. Over time, more and more nanoflower crystals are generated, and their morphology will change accordingly. Once the petals become compact, they may include the recognition site, reducing the efficiency of antigen-antibody binding and affecting the detection effect. McAb-HRP@Cu-HNFs grown for 12 hours, 24 hours, 36 hours, and 48 hours were prepared, and the microscopic state was observed by SEM. The detection effect of rabbit negative and positive serum for Clonorchis sinensis was tested by cELISA. The nanoflowers at different growth stages and their microscopic morphology were also analyzed, which also proved that loose structures have better detection effects.

[0053] At 12-24h, the overall structure of the nanoflowers was intact and loose, with a large specific surface area; at 36-48h, the nanoflowers gradually became compacted, and some binding sites were blocked. The detection effect of 12-24h was significantly better than that of 36-48h. The amount of nanoflowers generated at 24h was significantly more than that at 12h. Combining the maximum utilization rate and the detection effect (P is the positive sample, N is the negative sample), McAb-HRP@Cu-HNFs was finally selected to grow to 24h ( Figure 2 PI=(1-OD Sample / OD Negative )×100%.

[0054] In the functionalized hybrid nanoflower system, McAb can specifically recognize antibodies, and HRP can enhance the catalytic reaction. The appropriate ratio can enhance the synergistic effect of the two. The McAb:HRP ratio was set to 3:1, 2:1, 1:1, 1:2, and 1:3. The results showed that the detection effect was best when the McAb:HRP addition ratio was 2:1. Figure 3 A).

[0055] Optimal Cu 2+ Concentration screening. Appropriate concentration of Cu 2+ It can achieve the maximum utilization of raw materials and avoid the interference of excess ions. 2+ The concentrations were set at 50nM, 75nM, 100nM, 125nM, 150nM, 175nM, and 200nM. The test results at 50-100nM were significantly better than those at 125-200nM. There was no difference in the test results between 50-100nM, but the amount of nanoflowers generated at 100nM was greater. The optimal Cu2+ The concentration was 100 nM ( Figure 3 B).

[0056] The positive and negative serum of rabbit, mouse, dog and human were diluted with PBS according to the ratio of serum to be tested: McAb-HRP@Cu-HNFs = 4:1, 3:1, 2:1, 1:1, 1:2, 1:3, 1:4 and 1:10. The results showed that McAb-HRP@Cu-HNFs can be used to detect multi-host serum of Clonorchiasis sinensis, and the best effect was achieved when the ratio of serum to be tested: McAb-HRP@Cu-HNFs was 1:2. Figure 4 ).

[0057] Example 3. Kit for detecting Clonorchis sinensis antibodies

[0058] A Clonorchis sinensis antibody detection kit comprises: a dual-enzyme-inorganic functional nanoflower composite material, an ELISA reaction plate, a Clonorchis sinensis CSTR1 antigen, a blocking solution, a sample diluent, a washing solution, a chromogenic substrate, and a stop solution. The ELISA well reaction plate is coated with 7.5 ug / mL Clonorchis sinensis CsTR1 antigen, the blocking solution is 5% skim milk, the sample diluent is phosphate buffer, the washing solution is PBST, the chromogenic substrate is 30% H2O2 and TMB, and the stop solution is 2M H2SO4.

[0059] CSTR1 antigen amino acid sequence: (SEQ ID NO.1)

[0060] GGKAPPPESAGGKAPPPESAGGKAPPPESAGGKAPPPESAGGKAPPPESAGGKAPPPE SAGGKAPPPESAGGKAPPPESAGGKAPPPESAGGKAPPPESA;

[0061] CSTR1 antigen gene sequence: (SEQ ID NO.2)

[0062] GGCGGCAAGGCACCACCTCCTGAGTCAGCTGGCGGCAAGGCACCACCTCCTGAGTCAGCTGGCGGCAAGGCACCACCTCCTGAGTCAGCTGGCGGCAAGGCACCACCTCCTGAGTCAGCTGGCGGCAAGGCACCACCTCCTGAGTCAGCT GGCGGCAAGGCACCACCTCCTGAGTCAGCTGGCGGCAAGGCACCACCTCCTGAGTCAGCTGGCGGCAAGGCACCACCTCCTGAGTCAGCTGGCGGCAAGGCACCACCTCCTGAGTCAGCTGGCGGCAAGGCACCACCTCCTGAGTCAGCT.

[0063] Example 4. ELISA detection of antibodies

[0064] 1. Optimization of the McAb-HRP@Cu-HNFs-cELISA reaction system: The checkerboard method was used to screen the optimal coating concentration of the antigen and the optimal dilution of the antibody. The best detection effect was achieved when the CSTR1 antigen was coated at 7.5 μg / mL and the serum:McAb-HRP@Cu-HNFs ratio was 1:3 (Table 1).

[0065] Table 1 Screening antigen coating concentration and antibody dilution multiple

[0066]

[0067] 2. Selection of dilution multiples of McAb-HRP@Cu-HNFs: McAb was diluted at 1:250, 1:500, 1:1000, 1:2000, 1:4000, 1:6000, 1:8000, and 1:10000, respectively. Then, competitive incubation was performed according to the optimal ratio of serum:McAb-HRP@Cu-HNFs. The results showed that the detection effect was best when McAb-HRP@Cu-HNFs was diluted at 1:1000.

[0068] 3. Optimization of coating solution and coating time: The five common coating solutions (PBS, CBS, NaCl, Tris, ddH20) all have certain detection effects, among which CBS has the best effect, with a PI value of 89% ( Figure 5 A) Further optimization of the coating time showed that the negative serum OD 450 The value is basically around 1.2, but as time goes by, the OD of positive serum 450 As the PI value increases, the PI value decreases, so the coating time is selected as 12h ( Figure 5B).

[0069] 4. Optimization of blocking solution and blocking time: A suitable blocking solution can effectively reduce the non-specific binding of the reaction. After screening three blocking solutions (5% skim milk, 1% BSA, and 1% Casein), all of them have a certain effect, among which 5% skim milk has the best effect ( Figure 6 A). Further optimization of the blocking time showed that the PI value was the highest when the blocking time was 1.5h ( Figure 6 B).

[0070] 6. Optimization of competitive incubation time and color development time: The competitive incubation time between the serum to be tested and the monoclonal antibody is an important factor in determining the quality of the entire reaction system. Insufficient reaction time will lead to insufficient antigen-antibody binding, while too long a time will cause non-specific binding. The serum to be tested was competitively incubated with McAb-HRP@Cu-HNFs for 0.5h, 1h, 1.5h, and 2h, respectively. The results showed that the PI value of the competitive incubation for 1h was the highest, and the detection effect was the best ( Figure 7 A).

[0071] The color development reaction is the last step of the monitoring system. The appropriate color development time is an important factor affecting the determination of positive and negative results. The color change produced by the catalytic substrate will deepen over time, and the influence of non-specific binding antigen-antibody complex will also become increasingly greater. By setting the gradient color development time of 5min, 10min, 15min, and 20min, the PI value of 10min color development is the highest, and the detection effect is the most ideal ( Figure 7 B).

[0072] 7. McAb-HRP@Cu-HNFs-cELISA Parameter Optimization Results: The final protocol and assay for the McAb-HRP@Cu-HNFs-cELISA assay system are as follows: CSTR1 was diluted to 7.5 μg / mL in CBS and 100 μL was added to each well. Coating was performed at 4°C for 12 hours, followed by three washes with PBST (3 min each) with shaking. Blocking was performed by adding 200 μL of 5% skim milk (dissolved in PBST) to each well, incubating at 37°C for 1.5 hours, and then washing with PBST (3 min each) with shaking for three times. McAb-HRP@Cu-HNFs were diluted 1:1000 in PBS, and the test serum and McAb-HRP@Cu-HNFs were mixed at a ratio of 1:2 and added to the microplate (total volume 100 μL). The competition reaction was incubated at 37°C for 1 hour, washed three times with PBST, and the microplate was patted dry.

[0073] Add 100 μL of substrate (add color development solution substrate (30% H2O2 + 50 mM TMB) to each well, keep constant temperature at 37°C for 10 min to fully develop the color, and add 100 μL of sulfuric acid solution (2M) to stop the color development. Read the OD value of the sample to be tested and the McAb solution on the microplate reader respectively. 450 The sample inhibition rate PI value was calculated.

[0074] Example 5. Evaluation of McAb-HRP@Cu-HNFs-cELISA in clinical samples

[0075] (1) Application of McAb-HRP@Cu-HNFs-cELISA in canine clinical samples

[0076] The optimized cELISA method was used to detect 53 canine negative serum samples and calculate the PI value of the serum to be tested. The average value was 32.91, the standard deviation was 5.11, and the cut-off value calculated by adding 2 times the standard deviation to the average value was 43.13% ( Figure 8 A). The serum of dogs artificially infected with Clonorchis sinensis at different stages was tested and the antibody titer curve was drawn. The results showed that the antibody positive conversion time detected by this method was 21 days after infection ( Figure 8 B). In detecting positive sera of dogs infected with different parasites, cELISA only specifically identifies positive sera of Clonorchis sinensis and has no cross-reaction with sera of other parasites, showing strong specificity ( Figure 8 C).

[0077] cELISA testing of canine clinical serum samples: 53 canine serum samples were tested using the optimized cELISA method, and the test results were compared with the fecal KK test method. The KK method detected 11 positive and 42 negative samples, while the cELISA detected 12 positive and 41 negative samples (compared with the KK method, the sensitivity of this method was 100% and the specificity was 97.62% (Table 2)). Table 2 Comparison of cELISA test results with the KK method

[0078]

[0079] (2) Application of McAb-HRP@Cu-HNFs-cELISA in mouse clinical samples

[0080] 42 negative mouse serum samples were tested to calculate the positive and negative cutoff values. The optimized cELISA method was used to calculate the inhibition rate (PI) of the serum to be tested. The average value was 25.63, the standard deviation was 6.19, and the cut-off value calculated by adding 2 times the standard deviation to the average value was 38.01% ( Figure 9A). Antibody titer curves were drawn by testing the sera of mice artificially infected with Clonorchis sinensis at different stages. The results showed that the antibody positive conversion time detected by this method was 21 days after infection ( Figure 9 B).

[0081] (3) Application evaluation of McAb-HRP@Cu-HNFs-cELISA in human serum samples

[0082] 88 healthy human serum samples were tested and the cut-off value was determined. The average value was 31.8 and the standard deviation was 7.87. The PI value calculated by adding 2 times the standard deviation to the average value was 47.54, which was used as the threshold value of this method ( Figure 10 A). Detection of human Schistosoma japonicum, Trichinella spiralis, Toxoplasma gondii, Whipworm, Cysticercus, Ascaris, Hookworm, Hydatid, Clonorchis sinensis positive serum and negative serum as control. This method only specifically identifies Clonorchis sinensis positive serum and has no cross-reaction with other types of parasites. It has high specificity ( Figure 10 B). In the sensitivity experiment, serum samples were divided into different infection levels according to the infection intensity detected by the modified Kato-Katz method in fecal samples (EPG: 0, 24, 48, 72, 96, 120, 144, 168, 192, 216, 240). The results showed that this method can identify serum samples with different infection intensities and can still effectively detect serum samples with low infection intensity (EPG ≥ 24), with high sensitivity ( Figure 10 C);

[0083] EPG (Eggs per gram of feces) is primarily based on the modified Kato-Katz technique (KK method), the internationally recognized test for clonorchiasis and the current industry standard for testing. Compared to the direct smear method, the KK method allows for quantitative fecal sampling (42 mg), making the processed sample more convenient for observation and suitable for quantitative egg testing.

[0084] Place a gauze mesh over the stool sample and scrape back and forth to remove any stool that escapes through the mesh. Then, place a stool quantification plate (with a recessed center for the sample) on a glass slide. Once the plate is filled, slowly remove it. Cover with a strip of cellophane previously treated with malachite green and glycerol and gently press it into an oval shape. Allow the sample to stand at room temperature for 1 hour to achieve relative transparency before examination under a microscope. To calculate the number of eggs per gram (EPG), multiply the number of eggs on each slide by 24.

[0085] cELISA detection of human clinical serum samples: The optimized cELISA method was used to test 133 human serum samples, and the test results were compared with the fecal KK detection method. The KK method detected 59 positive and 74 negative samples, while the McAb-HRP@Cu-HNFs-cELISA detected 61 positive and 72 negative samples. Compared with the KK method, the sensitivity of this method was 96.61% and the specificity was 94.59% (Table 3).

[0086] Table 3 Comparison of cELISA test results and KK method

[0087]

[0088] In summary, the present invention provides a method for preparing dual-enzyme-inorganic functional nanoflowers. On this basis, a competitive ELISA detection method for multi-host detection of clonorchiasis was further established, which can be used for serological antibody detection in humans, dogs, and mice infected with Clonorchis sinensis. The constructed cELISA detects sera from artificially infected dogs and mice 21 days after infection and has good specificity, with no cross-reactions with sera from dogs or humans infected with other parasites. The constructed cELISA has excellent detection performance, with a sensitivity of 100% and a specificity of 97.62% in canine clinical serum samples; and a sensitivity of 96.61% and a specificity of 94.59% in human clinical serum samples, providing technical support for the detection and scientific prevention and control of multi-host clonorchiasis.

Claims

1. A method for preparing a dual-enzyme inorganic functional nanoflower composite material, characterized in that: The preparation method of the composite material is as follows: a monoclonal antibody against Clonorchis sinensis, a copper phosphate solution, and HRP are combined as combination 1; or a monoclonal antibody against Clonorchis sinensis and a copper phosphate solution are combined as combination 2, reacted at room temperature for 12-48 hours, and co-precipitated to obtain a functional nanoflower composite material; the monoclonal antibody against Clonorchis sinensis is secreted by a hybridoma cell line, and the hybridoma cell line has been deposited in the General Microbiology Center of the China Culture Collection Administration with a deposit number of CGMCC NO. 46128 and a deposit date of November 6, 2024.

2. The method according to claim 1, characterized in that The total volume is 50 mL, the mass ratio of Clonorchis sinensis monoclonal antibody to HRP is (1-3): (1-3), the concentration of copper phosphate solution is 50 nM-200 nM, and PBS solution is added to dissolve to 50 mL.

3. The method according to claim 1, characterized in that The mass ratio of Clonorchis sinensis monoclonal antibody to HRP was 1:2, the concentration of copper phosphate solution was 100 nM, and the reaction was carried out at room temperature for 24 h.

4. The method according to claim 1, wherein The specific conditions of the co-precipitation are: centrifugation at 12,000 r and 4° C. for 30 min to collect the crystal precipitate, washing it three times with deionized water, and drying the crystal precipitate at 30° C.

5. The dual-enzyme-inorganic functional nanoflower composite material obtained by the method according to any one of claims 1 to 4.

6. A Clonorchis sinensis antibody detection kit, characterized in that: The kit comprises the dual-enzyme-inorganic functional nanoflower composite material according to claim 5.

7. The kit according to claim 6, characterized in that The kit also includes an ELISA reaction plate, a Clonorchis sinensis CSTR1 antigen, a blocking solution, a sample diluent, a washing solution, a color development substrate and a stop solution.

8. The kit according to claim 7, characterized in that The ELISA reaction plate was coated with 7.5 μg / mL of Clonorchis sinensis CsTR1 antigen, the blocking solution was 5% skim milk, the sample diluent was phosphate buffered saline, the washing solution was PBST, the chromogenic substrate was 30% H2O2 and 50 mM TMB, and the stop solution was 2M H2SO4.