Monoclonal antibody of talaromyces marneffei yeast phase protein HSP30 and application thereof

Abstract

The invention relates to a talaromyces marneffei yeast phase protein HSP30 monoclonal antibody and application thereof, and belongs to the technical field of biological medicine. The talaromyces marneffei yeast phase protein HSP30 is a protein up-regulated after talaromyces marneffei is cultured at 37 DEG C or infects a human body, and can be used for early diagnosis of talaromyces marneffei infection. On the basis of a talaromyces marneffei yeast phase protein HSP30 expression recombinant protein, a mouse monoclonal antibody which is specifically bound with the talaromyces marneffei yeast phase protein HSP30 is screened out, and the talaromyces marneffei detection kit is formed by optimizing and combining the mouse monoclonal antibody and the talaromyces marneffei yeast phase protein HSP30. Compared with a traditional talaromyces marneffei detection method, the antibody takes HSP30 with high species specificity as a target spot, yeast phase protein released by talaromyces marneffei in serum can be effectively captured, capturing of complete fungi is more convenient, sensitivity is higher, and aspergillus cross reaction is avoided; compared with a traditional fungus culture diagnosis mode, the method is quicker and more convenient, and the detection efficiency and the detection sensitivity are greatly improved.

Description

Technical Field

[0001] The invention relates to the field of biotechnology, in particular to a monoclonal antibody against yeast-phase protein HSP30 of Talaromyces marneffei and an application thereof, belonging to the field of biomedical technology. Background Art

[0002] Talaromyces marnefei (TM) is one of the three major opportunistic infections in AIDS patients, along with tuberculosis and cryptococcal infection. About 17,300 people are infected and 4,900 are related deaths each year worldwide. Talaromyces marnefei disease develops rapidly, has a poor prognosis, and a high mortality rate. If not treated in time, the mortality rate can be as high as 91.3%. Therefore, the study of rapid diagnosis technology for Talaromyces marnefei infection is of great significance for achieving early detection, early treatment, and prognosis of infected patients, as well as reducing the social medical burden.

[0003] The clinical diagnosis process of T. marneffei is cumbersome and time-consuming. Traditional detection methods mainly rely on fungal culture and histopathological examination. The former usually takes 2-4 weeks for detectable growth of T. marneffei, which may lead to delayed treatment due to delayed diagnosis. The latter is sometimes easily confused with other macrophage pathogens. In recent years, with the rapid development of biotechnology, PCR, gene chips, mass spectrometry and second-generation sequencing technologies have been explored and applied in the detection of T. marneffei infection as a supplement to traditional detection methods. However, due to the high price of these emerging technologies, long detection time, and relatively high requirements for detection instruments and manpower conditions, the application of these new technologies has been limited to a certain extent. Therefore, clinical practice requires the cooperation of more convenient, accurate and cost-effective rapid antigen detection methods. At present, the antigen detection methods for T. marneffei related to China and abroad are generally ELISA detection kits with T. marneffei cell wall mannoprotein Mp1p protein as antigen. However, due to the homology between the MP1 gene of T. marneffei and the mannoprotein genes AFMP1 and AFMP2 of Aspergillus, the monoclonal antibodies screened with Mp1p protein antigen as the target protein cannot distinguish between T. marneffei and Aspergillus, resulting in its specificity in the diagnosis of fungal pneumonia being only 65%. Therefore, finding new diagnostic markers for T. marneffei is the key to solving the low specificity of current rapid antigen detection methods.

[0004] Talaromyces marneffei is a temperature-dependent diphasic fungus and opportunistic pathogen. At 25°C, Talaromyces marneffei is in the hyphal phase and produces asexual conidia. After 24 hours of in vitro culture at 37°C or infection of the human body, yeast-phase protein expression begins to appear. After 96 hours, it can be seen under the microscope that it has completely transformed into a yeast-phase fungus ( Figure 1). Currently, the detailed molecular regulatory mechanisms of the dimorphic transformation and pathogenicity of T. marneffei are still unclear. Studies have shown that the morphological transformation of dimorphic fungi from the hyphal phase to the yeast phase is a necessary process for the production of toxicity. This transformation not only leads to changes in cell morphology, but also involves the expression of yeast-phase-specific proteins of dimorphic fungal toxicity. Chandler et al. identified the differences in the proteomes of the hyphal phase and early yeast phase of T. marneffei and found that the proteins with increased expression in the yeast phase development stage were related to heat shock response, general metabolism and cell wall biosynthesis. In particular, the RanA protein responsible for regulating mitosis and nuclear membrane transport is considered to be related to the signal transduction mechanism of dimorphism. By searching for homologous fungal sequences in the comparison database to infer proteins shared by the hyphal phase and yeast phase, it was found that there were 16 differentially expressed proteins in the proteome maps of the hyphal phase and yeast phase of T. marneffei, of which 12 were highly expressed in the yeast phase. Through protein function prediction, it was found that these proteins have homology with proteins that play a key role in energy production and other cellular metabolic pathways known to date. It is inferred that the protein components that change during the transition from the hyphae phase to the yeast phase of T. marneffei are key toxic protein components that play an important role in the transition of the two phases of the bacteria and even in the pathogenic process. The yeast phase protein HSP30 of T. marneffei happens to be a key protein component that is upregulated in the infection state. Further protein sequence homology analysis revealed that the yeast phase protein heat shock protein 30 (TM.HSP30) with the highest species specificity was found. Studies have found that heat shock protein 30 has the function of a "molecular chaperone". When an organism is exposed to high temperature, it will be stimulated by heat to synthesize this protein to protect the organism itself, help the physiological folding and stretching of newly synthesized polypeptide bonds, and correct the misfolding of polypeptide chains to restore the function and structure of the cell. It can be concluded that the yeast phase protein HSP30 also plays an equally important role in the two-phase transition and pathogenic process of T. marneffei, and can be used as a new diagnostic molecular marker for the detection of T. marneffei. Screening of monoclonal antibodies targeting T. marneffei HSP30 will also provide new ideas and solutions for the rapid detection and treatment of T. marneffei in clinical practice. Summary of the invention

[0005] In view of this, the present invention provides a monoclonal antibody against yeast phase protein HSP30 of Talaromyces marneffei and its use in preparing a Talaromyces marneffei detection kit. The NCBI public gene sequence of the yeast phase protein HSP30 of Talaromyces marneffei is ABF82266 (gi|106647229). The monoclonal antibody against Talaromyces marneffei of the present invention can bind to the yeast phase protein HSP30 of Talaromyces marneffei to achieve the effect of specifically capturing Talaromyces marneffei in an infected state.

[0006] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0007] The technical problem to be solved by the present invention is to provide a mouse monoclonal antibody with high affinity, strong specificity and high sensitivity against Talaromyces marneffei and its application in detecting Talaromyces marneffei infection.

[0008] The invention provides application of an antibody prepared by taking yeast phase protein HSP30 of Talaromyces marneffei as an antigen in preparing a detection product of Talaromyces marneffei.

[0009] The present invention also provides antibodies, which:

[0010] (1) Antibody TM-49D11 includes a heavy chain variable region and a light chain variable region, the heavy chain variable region includes CDRH1 as shown in SEQ ID NO:9, CDRH2 as shown in SEQ ID NO:10, and CDRH3 as shown in SEQ ID NO:11, and the light chain variable region includes CDRL1 as shown in SEQ ID NO:12, CDRL2 as shown in SEQ ID NO:13, and CDRL3 as shown in SEQ ID NO:14;

[0011] (2) Antibody TM-50G1 includes a heavy chain variable region and a light chain variable region, the heavy chain variable region includes CDRH1 as shown in SEQ ID NO: 15, CDRH2 as shown in SEQ ID NO: 16, and CDRH3 as shown in SEQ ID NO: 17, and the light chain variable region includes CDRL1 as shown in SEQ ID NO: 18, CDRL2 as shown in SEQ ID NO: 19, and CDRL3 as shown in SEQ ID NO: 20.

[0012] In some specific embodiments of the present invention, the heavy chain variable region of the above-mentioned antibody has:

[0013] (1), the amino acid sequence shown in SEQ ID NO: 5 or SEQ ID NO: 7; or

[0014] (2) an amino acid sequence obtained by substituting, deleting or adding one or more residues of the amino acid sequence shown in (1), and having the same or similar function as (1); or

[0015] (3) an amino acid sequence having at least 90% homology to the amino acid sequence shown in (1) or (2);

[0016] Its light chain variable region has:

[0017] (4) the amino acid sequence shown in SEQ ID NO: 6 or SEQ ID NO: 8; or

[0018] (5) An amino acid sequence obtained by substituting, deleting or adding one or more residues of the amino acid sequence shown in (4), and having the same or similar function as (4); or

[0019] (6) an amino acid sequence having at least 90% homology to the amino acid sequence shown in (4) or (5);

[0020] The plurality is 2 to 5.

[0021] The present invention also provides a recombinant protein of yeast-phase protein HSP30 of Talaromyces marneffei, the amino acid sequence of which is shown in SEQ ID NO:4.

[0022] The Talaromyces marneffei yeast phase protein HSP30 kit constructed based on the above-mentioned antibodies is characterized in that the Talaromyces marneffei yeast phase protein HSP30 kit comprises the above-mentioned Talaromyces marneffei yeast phase protein HSP30 monoclonal antibody or antibody combination.

[0023] The present invention also provides the use of the above-mentioned Talaromyces marneffei yeast phase protein HSP30 monoclonal antibody in any of the following items:

[0024] 1) preparing an enzyme-linked immunosorbent assay kit for detecting yeast-phase protein HSP30 of Talaromyces marneffei;

[0025] 2) preparing an immunochromatographic detection kit for detecting yeast-phase protein HSP30 of Talaromyces marneffei;

[0026] 3) Preparation of in vitro fluorescent probe reagents for detecting yeast phase protein HSP30 of Talaromyces marneffei;

[0027] 4) Preparing drugs or preparations for preventing and / or treating diseases related to Talaromyces marneffei infection.

[0028] The present invention also provides a labeled complex, which comprises a label and the above-mentioned antibody, wherein the label is at least one of the following:

[0029] Biotin;

[0030] Colloidal gold;

[0031] Fluorescent composite nanoprobes.

[0032] In some specific embodiments of the present invention, the above-mentioned detection product includes a test strip or a test card, and the raw materials of the test strip or the test card include at least one of the following:

[0033] The above-mentioned monoclonal antibody against yeast phase protein HSP30 of Talaromyces marneffei;

[0034] the above-mentioned labeled complex;

[0035] goat anti-mouse monoclonal antibody;

[0036] Biotinylated monoclonal antibody against yeast-phase protein HSP30 of Talaromyces marneffei;

[0037] Streptavidin-conjugated fluorescent marker.

[0038] The present invention also provides a method for preparing the yeast phase protein HSP30 of Talaromyces marneffei, comprising the following steps:

[0039] Step (1): performing bioinformatics analysis on the yeast-phase protein HSP30 of T. marneffei, performing species-specific analysis by sequence alignment, and extracting nucleic acid genes with immunogenicity by protein conformation prediction;

[0040] Step (2): using the plasmid containing the gene encoding the yeast phase protein HSP30 of Talaromyces marneffei intercepted in step (1) as a template, adding a HIS tag by gene synthesis to obtain the gene encoding the HSP30;

[0041] Step (3): connecting the coding gene obtained in step (2) to the template plasmid digested and methylated by Dpn1 to obtain a recombinant expression plasmid;

[0042] Step (4): introducing the recombinant expression plasmid of step (3) into competent cells, culturing and fermenting the cells after kanamycin resistance screening, and purifying the fermentation broth with a nickel column to obtain the yeast-phase protein HSP30 of Talaromyces marneffei;

[0043] Preferably, the mutation primers in step (2) are HSP30-F (SEQ ID NO: 2) and HSP30-R (SEQ ID NO: 3).

[0044] The present invention also provides a method for preparing a monoclonal antibody for detecting Talaromyces marneffei, comprising the following steps:

[0045] Step (1): Immunizing mice with purified yeast-phase protein HSP30 of T. marneffei, fusing spleen cells of the immunized mice with myeloma cells SP20, obtaining hybridoma cells by screening with HAT culture medium, screening hybridoma cells capable of producing T. marneffei-specific capture antibodies by ELISA method using T. marneffei protein culture extract as antigen, and injecting into the peritoneal cavity of mice after expanded culture to obtain monoclonal antibodies;

[0046] Step (2): After fusion, monoclonal antibodies are obtained, monoclonal antibodies reactive to T. marneffei are amplified and cultured, monoclonal antibodies are prepared from ascites, the sensitivity and reactivity of the monoclonal antibodies are further tested, and the best antibody pair is matched using the chessboard method.

[0047] The present invention abandons the mode of targeting the cell wall mannoprotein Mp1p protein of Talaromyces marneffei as the target antigen, and takes a different approach. By analyzing the thermal diphasic characteristics of Talaromyces marneffei, based on the fact that Talaromyces marneffei releases yeast phase proteins after infecting the human body, the yeast phase protein HSP30 with strong species specificity and antigenicity is screened as the target protein. The obtained Talaromyces marneffei yeast phase protein HSP30 has high purity and high yield, and can be used to effectively screen monoclonal antibodies against Talaromyces marneffei.

[0048] The monoclonal antibody screened by the present invention for the yeast phase protein HSP30 of Talaromyces marneffei has a stronger detection sensitivity and specificity for Talaromyces marneffei than the detection kit of the monoclonal antibody with the mannoprotein Mp1p protein as the target protein, and is not easy to cross-react with other Mucor, Aspergillus flavus, yeast and Cryptococcus. Moreover, because Talaromyces marneffei will transform into the yeast phase and release the yeast phase protein after infecting the human body, the monoclonal antibody can also avoid the interference of Talaromyces marneffei in the environment, further improving the detection specificity.

[0049] The yeast phase protein HSP30 of Talaromyces marneffei of the present invention and its application in preparing a detection kit have the following effects:

[0050] The present invention selects the antigen of Talaromyces marneffei as the target, which has higher sensitivity and specificity than detecting the corresponding antibodies produced by the human body and can avoid infection during the window period.

[0051] The monoclonal antibodies TM-49D11 and TM50G5 of T. marneffei constructed and screened by the above method can be used to construct a T. marneffei antigen detection kit, which can effectively capture the yeast phase protein released by T. marneffei in serum, which is more convenient and more sensitive than the capture of complete fungi. Compared with the traditional fungal culture diagnosis method, it is faster and simpler, and greatly improves the detection efficiency and sensitivity. The monoclonal antibody against the yeast phase protein HSP30 of T. marneffei of the present invention can bind to the yeast phase protein HSP30 released by T. marneffei after infecting the human body, and has good sensitivity and specificity. Clinical application tests show that its detection sensitivity for T. marneffei infection reaches 89% and its specificity reaches 100%. BRIEF DESCRIPTION OF THE DRAWINGS

[0052] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art are briefly introduced below.

[0053] Figure 1 Thermal dimorphism of Talaromyces shimarneffei;

[0054] Figure 2 The three-dimensional structure of the yeast protein HSP30 of Talaromyces marneffei is shown;

[0055] Figure 3 The figure shows the antigen epitope prediction result after bioinformatics simulation;

[0056] Figure 4 The recombinant plasmid of yeast protein HSP30 of Talaromyces schrenkiana;

[0057] Figure 5 The yeast-phase protein HSP30 of Bacillus marneffei expressed in Escherichia coli is shown (Coomassie Brilliant Blue staining);

[0058] Figure 6 Shown is the standard curve after assembly of monoclonal antibody TM-50G1 and Biotin-TM-49D11;

[0059] Figure 7 The sensitivity and specificity of the monoclonal antibodies TM-50G1 and Biotin-TM-49D11 against yeast-phase protein HSP30 of Talaromyces schmidtii in ELISA double sandwich antibody system;

[0060] Figure 8 The flowchart of the fluorescent immunochromatographic kit constructed by labeling the fluorescent composite nanoprobe with the yeast HSP30 monoclonal antibody of Talaromyces marneffei for the detection of Talaromyces marneffei is shown;

[0061] Fig. 9 To demonstrate the specificity verification of the Tallabium marneffei immunochromatographic kit disclosed in the present invention, wherein 1 represents Penicillium, 2 represents Aspergillus nidulans, 3 represents Aspergillus flavus, 4 represents Aspergillus polydophorus, 5 represents Candida albicans, 6 represents Candida tropicalis, 7 represents Candida glabrata, 8 represents Candida auris, 9 represents Cryptococcus, 10 represents Staphylococcus aureus, 11 represents Streptococcus pneumoniae, 12 represents Staphylococcus capitis, 13 represents Staphylococcus epidermidis, 14 represents a blank control, and 15 represents Tallabium marneffei;

[0062] Fig.10 The sensitivity verification of the Talaromyces marneffei immunochromatography kit disclosed in the present invention is shown. DETAILED DESCRIPTION

[0063] The present invention discloses a yeast phase protein HSP30 of Talaromyces marneffei and its application in the preparation of a Talaromyces marneffei detection kit. Those skilled in the art can refer to the content of this article and appropriately improve the process parameters to achieve it. It is particularly important to point out that all similar replacements and modifications are obvious to those skilled in the art, and they are all considered to be included in the present invention. The method and application of the present invention have been described through preferred embodiments, and relevant personnel can obviously modify or appropriately change and combine the methods and applications described herein without departing from the content, spirit and scope of the present invention to implement and apply the technology of the present invention.

[0064] The heat shock proteins (HSPs) described in the present invention are highly conservative stress proteins produced by organisms (or cells cultured in vitro) under adverse environmental factors and are ubiquitous in the entire biological world. Heat shock response (HSR) is a physiological, rapid and short-term cell metabolic regulation, during which the expression of some normal genes in the cell is inhibited, while a group of special genes are activated and expressed. This group of special genes is called heat shock genes, and the proteins produced are called heat shock proteins. Heat shock protein 30 (HSP30) is one of the small molecule heat shock proteins.

[0065] By performing homology analysis on the amino acid sequence of the target protein and comparing the functions of the identified orthologs, the present application predicted the functions of the yeast-phase proteins of T. marneffei and found that these proteins can be divided into several categories: Ran GTPase spi1, succinyl-CoA synthetase α subunit, heat shock protein 30, NAD-dependent formate dehydrogenase and hypothetical protein HSP90 ATPase activator, heat shock protein 70, heat shock protein 90ATPase and catalase-peroxidase. These proteins have homology with currently known proteins that play a role in energy production and other cellular metabolic pathways (such as NAD-dependent formate dehydrogenase, ATP synthase β subunit, adenylate kinase, phosphoglycerate kinase, and succinyl-CoA synthetase subunits). Further protein sequence homology analysis revealed that the yeast phase protein heat shock protein 30 (TM.HSP30) with the highest species specificity has been found. Studies have found that heat shock protein 30 has the function of a "molecular chaperone". When an organism is exposed to high temperatures, it will be stimulated by heat to synthesize this protein to protect the organism itself, help the physiological folding and stretching of newly synthesized polypeptide bonds, and correct the misfolding of polypeptide chains to restore the function and structure of the cell. It can be concluded that the yeast phase protein HSP30 also plays an equally important role in the two-phase transition and pathogenicity of Talaromyces marneffei, and can be used as a new diagnostic molecular marker for the detection of Talaromyces marneffei. The preparation of a large amount of Talaromyces marneffei yeast phase protein HSP30 can be used to screen Talaromyces marneffei-specific monoclonal antibodies for rapid serological detection of Talaromyces marneffei.

[0066] The amount of HSP30, a yeast protein of Talaromyces marneffei, was analyzed to be about 30 kD. Through comparison and analysis of the NCBI database, it was found that HSP30 was more species-specific than other yeast proteins of Talaromyces marneffei. Its three-dimensional model was constructed by bioinformatics ( Figure 3 ), which has 6 B cell epitopes on its surface and better antigenicity. It is more conducive to screening specific monoclonal antibodies against Talaromyces marneffei.

[0067] 1. The present invention also provides a preparation method for detecting yeast phase protein HSP30 of Talaromyces marneffei, comprising the following steps:

[0068] In some embodiments of the present invention, the method for preparing the yeast-phase protein HSP30 of Talaromyces marneffei specifically comprises:

[0069] (1) Download the original sequence of the yeast phase protein HSP30 of Talaromyces marneffei from the NCBI database: ABF82266 (gi|106647229), and extract the gene fragment with the strongest species specificity and immunogenicity through database comparison and protein conformation prediction. According to the amino acid sequence, the functionally identical amino acid sequence obtained by replacing, deleting or / and adding one or more amino acids is preferred. The nucleotide sequence encoding the yeast phase protein HSP30 of Talaromyces marneffei is a synthetically optimized plasmid gene sequence such as SEQ ID NO: 1. Using it as a template, using a site-directed mutagenesis method, and using a mutant primer as a specific amplification primer, PCR amplification is performed to obtain the coding gene of the yeast phase protein HSP30 of Talaromyces marneffei. The primers are HSP30-F (SEQ ID NO: 2) and HSP30-R (SEQ ID NO: 3);

[0070] (2) connecting the coding gene obtained in step (1) to the template plasmid digested and methylated by Dpn1 to obtain a recombinant expression plasmid;

[0071] (3) The recombinant expression plasmid of step (2) is introduced into BL21 and T7E competent cells, and cultured and fermented after kanamycin resistance screening. The fermentation broth is purified by nickel column to obtain the yeast phase protein HSP30 of Talaromyces marneffei. The purified protein sequence is SEQ ID NO: 4.

[0072] 2. The present invention also provides a method for preparing a monoclonal antibody against yeast phase protein HSP30 of Talaromyces marneffei

[0073] (1) The purified yeast protein HSP30 of T. marneffei was used as the target antigen to immunize mice, and the mouse serum was collected for indirect ELISA detection after four booster immunizations. The fungal protein extract of T. marneffei was used as the coating antigen to compare the detection effect of the background serum of mice before immunization and the mouse serum after immunization on T. marneffei, so as to judge the effectiveness of the target antigen immunized mice in screening T. marneffei-specific monoclonal antibodies, and select mice with good sensitivity and specific reaction for booster immunization. Hybridoma cells were obtained by cell fusion technology. The fungal protein extract of T. marneffei was used as the coating antigen again to screen monoclonal antibody strains with good detection sensitivity and specificity, and then amplified culture was performed, and then injected into mice to collect ascites, and specific T. marneffei monoclonal antibodies were separated and purified using affinity chromatography columns.

[0074] (2) After fusion, a total of 40 monoclonal antibodies were obtained, of which 12 monoclonal antibody supernatants were reactive to Talaromyces marneffei, and monoclonal antibodies were prepared by amplification culture and ascites. The sensitivity and reactivity of the 12 monoclonal antibodies were further tested, and the best antibody pair was matched by the chessboard method. Finally, it was confirmed that Antibody 49-D11-G8 and Antibody 50-G5-E1 had the best detection effect on Talaromyces marneffei after assembly.

[0075] Antibody 49-D11-G8-VH amino acid sequence:

[0076]

[0077] Antibody 49-D11-G8-VL amino acid sequence:

[0078]

[0079] Antibody 50-G5-E1-VH amino acid sequence:

[0080]

[0081] Antibody 50-G5-E1-VL amino acid sequence:

[0082]

[0083] Among them, the CDR sequences are:

[0084] Antibody 49-D11-G8-VH:

[0085] CDR1:GASLTDAG(SEQ ID NO:9);

[0086] CDR2: ISGAGAT (SEQ ID NO: 10); CDR3: AHGTWQGY (SEQ ID NO: 11).

[0087] Antibody 49-D11-G8-VL:

[0088] CDR1: QTVTTSSYTY(SEQ ID NO:12);

[0089] CDR2: YATS (SEQ ID NO: 13);

[0090] CDR3: QHSWASQWT (SEQ ID NO: 14).

[0091] Antibody 50-G5-E1-VH:

[0092] CDR1: GYSFTSNYA (SEQ ID NO:15);

[0093] CDR2: INQYTGEP (SEQ ID NO:16);

[0094] CDR3: ASRGSASTGAVDY (SEQ ID NO: 17). Antibody 50-G5-E1-VL:

[0095] CDR1: QDHKTY (SEQ ID NO:18);

[0096] CDR2: SATA (SEQ ID NO: 19);

[0097] CDR3: LAHAESPWG (SEQ ID NO:20).

[0098] Antibody 49-D11-G8-VH Nucleotide sequence:

[0099]

[0100] Antibody 49-D11-G8-VL Nucleotide sequence:

[0101]

[0102] Antibody 50-G5-E1-VH nucleotide sequence:

[0103]

[0104] Antibody 50-G5-E1-VL Nucleotide Sequence:

[0105]

[0106] 3. The present invention also provides a method for detecting the yeast phase protein HSP30 of Talaromyces marneffei by using the double antibody sandwich ELISA (enzyme-linked immunosorbent assay) method, wherein the two antibodies in the antibody composition are used as the capture antibody and the detection antibody in the double antibody sandwich ELISA method, respectively. Among them, the detection antibody may also carry a detectable label such as a biotin label. In some embodiments of the present invention, the detection method is an ELISA double sandwich detection method, which has the advantages of simple operation, low cost, high sensitivity, high specificity, high accuracy, high precision, etc., and can be used to accurately and quickly detect Talaromyces marneffei infection.

[0107] 4. The present invention also provides a labeled complex, which includes the above-mentioned monoclonal antibody against the yeast phase protein HSP30 of T. marneffei and a marker, and the marker includes but is not limited to any one of the following: biotin, colloidal gold, and fluorescent composite nanoprobe.

[0108] 5. The present invention also provides a test strip or a detection card, the raw materials of which include any one of the following or a combination thereof: the above-mentioned monoclonal antibody against the yeast phase protein HSP30 of Talaromyces marneffei, the above-mentioned labeled complex, and a sheep anti-mouse monoclonal antibody.

[0109] 6. The present invention also provides the use of a composite nanoprobe labeled with monoclonal antibodies TM-50G1 and TM-49D11 against yeast phase protein HSP30 of Talaromyces marneffei in the preparation of a product for detecting Talaromyces marneffei.

[0110] 7. The present invention provides a fluorescent immunochromatography kit for detecting Talaromyces marneffei, wherein the kit comprises the monoclonal antibody against yeast phase protein HSP30 of Talaromyces marneffei described in the first aspect.

[0111] The composite nanomaterial and the monoclonal antibody of yeast phase protein HSP30 of Talaromyces marneffei are applied in immunochromatography (LFA). In a specific embodiment of the present invention, the Talaromyces marneffei; the kit also includes an immunochromatographic test strip, the immunochromatographic test strip includes a sample pad, a chromatographic membrane and an absorption pad connected in sequence, and the chromatographic membrane is provided with a detection line and a quality control line; the detection line is loaded with the monoclonal antibody TM-50G1 of yeast phase protein HSP30 of Talaromyces marneffei; the monoclonal antibody TM-49D11 of yeast phase protein HSP30 of Talaromyces marneffei labeled with fluorescent nanomaterial; the quality control line is loaded with goat anti-mouse IgG. Rapid enrichment and quantitative analysis of Talaromyces marneffei in the sample can be realized, especially rapid enrichment and quantitative analysis of yeast phase protein HSP30 of Talaromyces marneffei, magnetic enrichment effect and signal amplification can be realized, matrix interference in practical applications can be eliminated, and the sensitivity of detection can be further improved, which has great potential in high sensitivity and on-site monitoring of Talaromyces marneffei infection.

[0112] The present invention will be further described below in conjunction with the embodiments.

[0113] Example 1: Screening of specific monoclonal antibodies against yeast-phase proteins of Talaromyces marneffei

[0114] (1) Identify target proteins used as diagnostic markers for T. marneffei infection

[0115] The yeast phase protein sequence of T. marneffei was compared with the NCBI protein database by BLAST homology (The Basic Local Alignment Search Tool), and protein sequences with high homology to other bacteria and fungi were eliminated. Finally, proteins with strong species specificity and functional effects were determined as the target antigen protein of this study, and finally the yeast phase protein HSP30 of T. marneffei was determined as the target protein.

[0116] (2) Genetic engineering technology to express the yeast-phase protein HSP30 of Talaromyces marneffei

[0117] By comparing and analyzing the amino acid sequence of yeast-phase protein HSP30 of Talaromyces marneffei, the gene sequence was optimized and the target protein gene fragment was synthesized:

[0118]

[0119] The plasmid containing the yeast phase protein HSP30 encoding gene of T. marneffei was used as a template, and site-directed mutagenesis was used. The mutant primers were used as specific amplification primers to perform PCR amplification to obtain the encoding gene of the yeast phase protein HSP30 of T. marneffei. The primer sequences are as follows:

[0120] HSP30-F: TGTTCCAGGGGCCCggatccAGCCTTTTCC (SEQ ID NO: 2);

[0121] HSP30-R:TCGAGTGCGGCCGCAAGCTTTTATTCAATG (SEQ ID NO: 3).

[0122] The obtained coding gene was connected to the template plasmid pET-28b-3C (EMDBiosciences, Novagen) digested and methylated by Dpn1, and the recombinant expression plasmid was obtained through the restriction site BamHI / HindIII. The recombinant expression plasmid was introduced into BL21 and T7E competent cells, and cultured and fermented after kanamycin resistance screening. The fermentation broth was purified by nickel column to obtain the yeast phase protein HSP30 of Talaromyces marneffei ( Figure 5 ). The purified protein sequence is:

[0123]

[0124] Among them, residues 1 to 11 are his tags used for nickel column protein purification, and residues 12 to 23 are cleavage sites.

[0125] (3) Mouse immunization and identification of yeast-phase protein HSP30 of Talaromyces marneffei

[0126] The above-mentioned Talaromyces marneffei yeast phase protein HSP30 was used as the target antigen, mice were immunized according to different concentration gradients, and the mouse serum was taken for indirect ELISA detection after four booster immunizations. The Talaromyces marneffei fungal protein extract was used as the coating antigen, and the detection effect of the background serum of mice before immunization and the serum of mice after immunization on Talaromyces marneffei was compared, so as to judge the effectiveness of immunizing mice with Talaromyces marneffei yeast phase protein HSP30 to screen Talaromyces marneffei-specific monoclonal antibodies, and select mice with better sensitivity and specific response for booster immunization.

[0127] (4) Fusion, screening and identification of specific monoclonal antibodies

[0128] a. Cell fusion and monoclonal antibody screening

[0129] ① Take mouse spleen cells and myeloma cells SP2 / 0 for cell fusion according to traditional cell fusion technology. On the day of fusion, prepare feeder layer cells in advance and spread them on 96-well culture plates. Remove the spleen of the immunized mouse through sterile surgery, and gently grind and filter to obtain spleen cells. Use PEG to fuse with SP2 / 0 myeloma cells that have been revived and cultured to a good state one week in advance. Resuspend with HAT medium and spread on the prepared 96-well plate containing feeder layer cells for culture. Observe the cells and change the medium halfway on the sixth day after fusion. Change the medium in full on the eighth day and replace HT medium. At the same time, use the replaced medium for ELISA detection to measure the cell antibody titer of each well, and select the positive clone wells for amplification and culture;

[0130] ②Using the protein extract of Talaromyces marneffei as the target antigen, the cell line that can stably secrete monoclonal antibodies was established by verification by ELISA method and multiple subclone screening;

[0131] ③ Using protein extracts of various fungi such as Talaromyces marneffei, Aspergillus, Mucor, Cryptococcus and Candida as antigens, the cross-reactivity of each monoclonal antibody strain was detected by ELISA method;

[0132] ④Select highly specific and sensitive monoclonal antibody cell lines for ascites preparation and antibody purification.

[0133] b. Performance evaluation of the screened monoclonal antibodies against T. marneffei

[0134] The sensitivity, specificity and antibody affinity of the purified monoclonal antibody were determined by indirect ELISA using bacterial cells and protein extracts of Talaromyces marneffei, Aspergillus, Mucor, Cryptococcus and Candida.

[0135] Experimental results:

[0136] 1. The serum titer of mice immunized with yeast phase protein HSP30 of Talaromyces marneffei is shown in Table 2.

[0137] Table 1

[0138]

[0139]

[0140] 2. ELISA results of the supernatant of monoclonal antibody culture after fusion for Talaromyces marneffei

[0141] After the fusion, a total of 40 monoclonal antibodies were successfully screened and established. The yeast phase protein of T. marneffei was detected by cell culture supernatant. Among them, 12 monoclonal antibodies with good reactivity to the protein were selected for cell line amplification culture and ascites preparation. After purification, the subtypes of these 12 monoclonal antibodies were detected, and the results are shown in Table 2.

[0142] Table 2

[0143] Antibody clone number Antibody subtype 10-C6-H1 IgG 1 10-H6-B6 IgG 1 1-E6-B1 IgG 2b 10-E2-H3 IgG 2b 17-E11-C12 IgG 2b 3-F1-B3 IgG 2b 8-D3-C1 IgG 2b 17-C8-A11 IgG 2b 35-D5-D2 IgG 2a 49-D11-G8 IgG 2b 50-G5-E1 IgG 1 52-C1-C5 IgG 2b

[0144] 4. ELISA results of the titer detection of 12 monoclonal antibodies against HSP30

[0145] The antibody titer of monoclonal antibody to HSP30 was detected by indirect ELISA, the coating antigen was HSP30 protein, the coating concentration was 5μg / ml, the dosage was 100μL / well, the coating diluent was CBS, pH 9.6. The secondary antibody used was Peroxidase AffiniPure Goat Anti-Mouse IgG (FC). The blank control was PBS.

[0146] Antibody titer: the highest dilution ratio when the test value / blank control>=3

[0147] The results are shown in Table 3.

[0148] Table 3

[0149]

[0150] 5. ELISA results of monoclonal antibody titer detection against Talaromyces marneffei

[0151] The antibody titer of monoclonal antibody against T. marneffei was detected by indirect ELISA, the coating antigen was 1 μg of T. marneffei culture extract, the coating antibody concentration was 5 μg / ml, the dosage was 100 μL / well, and the coating diluent was CBS, pH 9.6. The secondary antibody was Peroxidase AffiniPure Goat Anti-Mouse IgG (FC). The blank control was PBS.

[0152] Antibody titer: the highest dilution ratio when the test value / blank control>=3

[0153] The results are shown in Table 4.

[0154] Table 4

[0155] Clone number 1:2K 1:4K 1:8K 1:16K 1:32K 1:64K 1:128K blank 1-E6-B1 0.17 0.08 0.09 0.07 0.05 0.05 0.05 0.08 10-E2-H3 0.07 0.05 0.06 0.06 0.06 0.06 0.04 0.06 17-E11-C12 0.29 0.17 0.13 0.08 0.07 0.05 0.04 0.06 3-F1-B3 1.75 1.83 1.70 1.53 1.23 1.00 0.71 0.06 8-D3-C1 3.82 2.86 2.04 1.31 0.83 0.48 0.27 0.06 17-C8-A11 1.80 1.65 1.51 1.30 1.07 0.80 0.56 0.07 35-D5-D2 0.31 0.24 0.20 0.15 0.11 0.09 0.06 0.06 49-D11-G8 2.73 2.57 2.25 1.79 1.53 0.95 0.60 0.06 50-G5-E1 0.77 0.43 0.31 0.24 0.18 0.12 0.09 0.06 52-C1-C5 1.15 0.99 0.97 0.85 0.74 0.55 0.37 0.12 10-C6-H1 0.10 0.07 0.06 0.07 0.06 0.06 0.05 0.07 10-H6-B6 0.12 0.12 0.12 0.12 0.11 0.11 0.11 0.11

[0156] The ELISA results of the titer detection of 12 monoclonal antibodies against Talaromyces marneffei showed that 4 of them had good reactivity. These antibodies with good reactivity were paired in pairs using the chessboard method to find suitable antibody pairs.

[0157] Example 2: Establishment and optimization of the double sandwich ELISA assay for Talaromyces marneffei

[0158] (1) Diagnostic antibody pairing for monoclonal antibodies against T. marneffei

[0159] Part of the T. marneffei antibody obtained in Example 1 was taken out for biotin labeling, and the other part was used as a capture antibody to be coated on an ELISA plate, and streptavidin-HRP was used as a secondary antibody for detection. The sample was added using the chessboard titration method, and each strain of antibody was paired with each other. The protein extract of T. marneffei was used as the target antigen for testing to determine the optimal pairing combination of coating antibody-capture antibody, the optimal dilution of each antibody, and the optimal working concentration of the enzyme-labeled antibody. Steps:

[0160] 1. Coating: Antibody, 2 μg / mL, 100 μL / well, 37°C, 2 h; Sample loading position is shown in Table 5;

[0161] Table 5

[0162] Plate-1 1 2 3 4 5 6 7 A 3-F1-B3 8-D3-C1 17-C8-A11 35-D5-D2 49-D11-G8 50-G5-E1 52-C1-C5 B 3-F1-B3 8-D3-C1 17-C8-A11 35-D5-D2 49-D11-G8 50-G5-E1 52-C1-C5 C 3-F1-B3 8-D3-C1 17-C8-A11 35-D5-D2 49-D11-G8 50-G5-E1 52-C1-C5 D 3-F1-B3 8-D3-C1 17-C8-A11 35-D5-D2 49-D11-G8 50-G5-E1 52-C1-C5 E 3-F1-B3 8-D3-C1 17-C8-A11 35-D5-D2 49-D11-G8 50-G5-E1 52-C1-C5 F 3-F1-B3 8-D3-C1 17-C8-A11 35-D5-D2 49-D11-G8 50-G5-E1 52-C1-C5 G 3-F1-B3 8-D3-C1 17-C8-A11 35-D5-D2 49-D11-G8 50-G5-E1 52-C1-C5

[0163] 2. Blocking: 3% BSA-PBS, 300 μL / well, 37°C, 1.5 h;

[0164] 3. Washing: PBST, 300 μL / well, 3 times;

[0165] 4. Add antigen, 0.5 μg / mL, 100 μL / well, 37°C, 1 h; the sample addition position is shown in Table 6;

[0166] Table 6

[0167]

[0168] 5. Washing: PBST, 300 μL / well, 3 times;

[0169] 6. Biotin-conjugated antibody, 0.3 μg / mL, 100 μL / well, 37°C, 1 h; the sample loading position is shown in Table 7;

[0170] Table 7

[0171] Plate-1 1 2 3 4 5 6 7 A Biotin-3 Biotin-3 Biotin-3 Biotin-3 Biotin-3 Biotin-3 Biotin-3 B Biotin-8 Biotin-8 Biotin-8 Biotin-8 Biotin-8 Biotin-8 Biotin-8 C Biotin-17 Biotin-17 Biotin-17 Biotin-17 Biotin-17 Biotin-17 Biotin-17 D Biotin-35 Biotin-35 Biotin-35 Biotin-35 Biotin-35 Biotin-35 Biotin-35 E Biotin-49 Biotin-49 Biotin-49 Biotin-49 Biotin-49 Biotin-49 Biotin-49 F Biotin-50 Biotin-50 Biotin-50 Biotin-50 Biotin-50 Biotin-50 Biotin-50 G Biotin-52 Biotin-52 Biotin-52 Biotin-52 Biotin-52 Biotin-52 Biotin-52

[0172] 7. Washing: PBST, 300 μL / well, 3 times;

[0173] 8. Streptavidin-HRP, 100 μL / well, 37°C, 30 min;

[0174] 9. Washing: PBST, 300 μL / well, 5 times;

[0175] 10.TMB substrate solution, 100 μL / well, 37°C, 5 min;

[0176] 11. Stop: 2M HCl, 50 μL / well;

[0177] 12. Reading: OD 450 -OD 620 .

[0178] 13: Experimental results: as shown in Table 8.

[0179] Table 8

[0180] Plate-1 1 2 3 4 5 6 7 HSP30 3-F1-B3 8-D3-C1 17-C8-A11 35-D5-D2 49-D11-G8 50-G5-E1 52-C1-C5 Biotin-3 1.18 2.92 4.28 4.32 0.58 4.66 4.28 Biotin-8 4.46 3.43 3.66 4.01 3.69 3.98 3.86 Biotin-17 4.11 3.80 2.73 4.56 4.58 4.48 4.51 Biotin-35 5.04 3.85 4.16 3.66 4.30 4.13 3.98 Biotin-49 1.23 2.90 4.04 4.65 0.75 4.69 4.38 Biotin-50 4.57 3.68 4.13 3.94 4.46 4.23 4.00 Biotin-52 4.00 3.95 3.91 3.93 4.50 4.40 4.24

[0181] (2) Determination of the detection sensitivity of the optimal antibody pair after assembly

[0182] According to the above step (1), the most suitable antibody pair 50-G5-E1 and biotin-labeled 49-D11-G8 were determined and named TM-50G5 and Biotin-TM49D11, respectively.

[0183] 1. Coating: TM-50G5, 2μg / mL, 100μL / well, 37℃, 2h;

[0184] 2. Blocking: 3% BSA-PBS, 300 μL / well, 37°C, 1.5 h;

[0185] 3. Washing: PBST, 300 μL / well, 3 times;

[0186] 4. Primary antibody antigen: concentration from 2 ng / mL to 0.03125 ng / mL, dilution ratio from 1:16 to 1:1024, 100 μL / well, 37°C, 1 h; the sample loading position and dilution multiple are shown in Table 8;

[0187] Table 9

[0188]

[0189] 5. Washing: PBST, 300 μL / well, 3 times;

[0190] 6. Biotin-conjugated antibody Biotin-TM49D11, 0.2 μg / mL, 100 μL / well, 37°C, 1 h;

[0191] 7. Washing: PBST, 300 μL / well, 5 times;

[0192] 8. Streptavidin-HRP, 100 μL / well, 37°C, 30 min;

[0193] 9. Washing: PBST, 300 μL / well, 5 times;

[0194] 10.TMB substrate solution, 100 μL / well, 37°C, 5 min;

[0195] 11. Stop: 2M HCl, 50 μL / well;

[0196] 12. Reading: OD 450 -OD 620 .

[0197] 13: The detection performance results of the assembled TM-50G5 and Biotin-TM49D11 antibody pairs are shown in Table 10, and the standard curve is shown in Figure 6 shown.

[0198] Table 10

[0199]

[0200] (3) Determine the detection specificity of the optimal antibody pair after assembly

[0201] Talaromyces marneffei, normal human serum and other common fungal and bacterial dilutions, including protein extracts of Candida albicans, Aspergillus flavus, Candida auris, Aspergillus nidulans, Aspergillus polymorpha, Penicillium, Cryptococcus, Streptococcus pneumoniae, Staphylococcus aureus, Staphylococcus epidermidis, Streptococcus viridans, Pseudomonas aeruginosa, etc., were detected using the constructed Talaromyces marneffei ELISA double sandwich method, and its clinical sample detection ability and application conditions were evaluated.

[0202] step:

[0203] 1. Coating: TM-50G5, 2μg / mL, 100μL / well, 37℃, 2h;

[0204] 2. Blocking: 3% BSA-PBS, 300 μL / well, 37°C, 1.5 h;

[0205] 3. Washing: PBST, 300 μL / well, 3 times;

[0206] 4. Primary Antigen: Talaromyces marneffei, normal human serum and other common fungi and bacteria dilutions (Candida albicans, Aspergillus flavus, Candida auris, Aspergillus nidulans, Aspergillus polymorpha, Penicillium, Penicillium, Cryptococcus, Streptococcus pneumoniae, Staphylococcus aureus, Staphylococcus epidermidis, Streptococcus viridans, Pseudomonas aeruginosa), the sample loading position and dilution multiple are shown in Table 11;

[0207] Table 11

[0208]

[0209]

[0210] 5. Washing: PBST, 300 μL / well, 3 times;

[0211] 6. Biotin-conjugated antibody Biotin-TM49D11, 0.2 μg / mL, 100 μL / well, 37°C, 1 h;

[0212] 7. Washing: PBST, 300 μL / well, 5 times;

[0213] 8. Streptavidin-HRP, 100 μL / well, 37°C, 30 min;

[0214] 9. Washing: PBST, 300 μL / well, 5 times;

[0215] 10.TMB substrate solution, 100 μL / well, 37°C, 5 min;

[0216] 11. Stop: 2M HCl, 50 μL / well;

[0217] 12. Reading: OD 450 -OD 620 Combined with Cutoff, determine the positive or negative nature of the sample.

[0218] 13 Test results see Figure 7 , Table 12.

[0219] Table 12

[0220] Plate-1 1 2 3 4 5 6 A 2.185 0.009 0.007 0.028 0.005 0.006 B 2.163 0.008 0.007 0.025 0.007 0.006 C 0.015 0.008 0.006 0.006 0.0012 0.007 D 0.017 0.009 0.007 0.008 0.01 0.009 E 0.01 0.005 2.884 1.333 0.013 0.009 F 0.013 0.006 2.347 1.376 0.017 0.007 G 0.008 0.007 0.009 0.007 0.006 0.005 H 0.009 0.009 0.007 0.006 0.007 0.008

[0221] The results of ELISA specificity test showed that this group of monoclonal antibodies had no cross-reaction to Candida albicans, Aspergillus flavus, Candida auris, Aspergillus nidulans, Aspergillus polymorpha, Penicillium, Penicillium, Cryptococcus, Streptococcus pneumoniae, Staphylococcus aureus, Staphylococcus epidermidis, Streptococcus viridans, and Pseudomonas aeruginosa, and had a good reaction to Talaromyces marneffei. The results of clinical sample detection ability test showed that the Talaromyces marneffei monoclonal antibodies TM-50D5 and TM-49G11 had excellent sensitivity and specificity for the detection of Talaromyces marneffei.

[0222] Example 3: Talaromyces marneffei fluorescent immunochromatographic kit

[0223] (1) Construction of a fluorescent immunochromatography kit using a fluorescent composite nanoprobe labeled with a monoclonal antibody against HSP30 of Talaromyces marneffei yeast

[0224] 1. The fluorescent markers are respectively labeled with the selected Talaromyces marneffei monoclonal antibody TM-49D11 at different concentrations, and the addition amount of the specific antibody is greater than 0 and less than 1 mg, preferably 0.001-0.02 mg, per 1 g of the composite fluorescent nanospheres; the specific antibody is the Talaromyces marneffei monoclonal antibody TM-49D11;

[0225] 2. Spray anti-Talaromyces marneffei monoclonal antibody TM-50G5 and goat anti-mouse IgG on the surface of nitrocellulose membrane respectively; then put the modified NC membrane into a constant temperature drying oven (37°C) to obtain the nitrocellulose membrane in the immunochromatographic test strip. Among them, the concentration of anti-Talaromyces marneffei monoclonal antibody TM-50G5 is greater than 0 and not greater than 1 mg / mL, preferably 0.8 mg / mL; the concentration of goat anti-mouse IgG is greater than 0 and not greater than 3 mg / mL, preferably 1 mg / mL.

[0226] 3. Assembly: Attach the nitrocellulose membrane, absorbent paper, conjugate pad, and sample pad to the PVC base plate, cut into 3 mm wide strips, and store in a dry place; the base plate is used as the backing card of the immunochromatographic test paper, and the material of the base plate is preferably PVC. The sample pad is used to load the sample solution to be tested. The absorbent pad is used to provide capillary force. The chromatographic membrane can be a nitrocellulose membrane (NC membrane).

[0227] 4. Loading buffer includes: 100% 10mmol / L PBS buffer, 1% Tween 20 and 3% fetal bovine serum (FBS)

[0228] 5. The sample to be tested is incubated with the composite nanoprobe, and the bacteria are recovered by magnetic enrichment of the composite nanoprobe, and then resuspended in the loading buffer and loaded onto the sample pad of the immunochromatographic test strip, and contacted with the detection line on the immunochromatographic test strip for chromatography reaction. After the chromatography reaction, the fluorescence signal is read by the immunofluorescence analyzer. The effect is shown in the figure Figure 8 shown.

[0229] (2) Specificity verification

[0230] We selected a variety of common pathogenic bacteria (10 5 cells / mL) as bacterial interferors to test the specificity of Mag@QDs-TM49D11. Figure 9 As shown in Figure 2, the photo of the immunochromatographic test strip and the fluorescence signal on the detection line clearly demonstrate that Mag@QDs-TM49D11 has good selectivity for the target bacteria. Therefore, the specific bacterial antibodies applied on the detection line of the immunochromatographic test strip are sufficient to ensure the high specificity of the detection platform.

[0231] (3) Sensitivity verification

[0232] The results of immunochromatographic assays were used to verify the detection of different concentrations of Talaromyces marneffei (0-10 5 cells / mL). The results are shown in the figure. Figure 10 It can be seen that the vLOD of Mag@QDs-TM49D11 in fluorescence mode is 100 cells / mL. The results show that the immunochromatographic detection method containing Mag@QDs-TM49D11 has high analytical performance for the target Talaromyces marneffei and a wide detection dynamic range (5 orders of magnitude).

[0233] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. Application of antibodies prepared using yeast phase protein HSP30 of Talaromyces marneffei as antigen in the preparation of detection products for Talaromyces marneffei.

2. An antibody, characterized in that include: The heavy chain CDR1 has the sequence shown in SEQ ID NO:9 or SEQ ID NO:15; and / or The heavy chain CDR2 has the sequence shown in SEQ ID NO: 10 or SEQ ID NO: 16; and / or The heavy chain CDR3 has the sequence shown in SEQ ID NO: 11 or SEQ ID NO: 17; and / or The light chain CDR1 has the sequence shown in SEQ ID NO: 12 or SEQ ID NO: 18; and / or The light chain CDR2 has the amino acid sequence of SEQ ID NO: 13 or the amino acid sequence of SEQ ID NO: 19; and / or The light chain CDR3 has the sequence shown in SEQ ID NO:14 or SEQ ID NO:

20.

3. The antibody according to claim 2, characterized in that Its heavy chain variable region has: (1), the amino acid sequence shown in SEQ ID NO: 5 or SEQ ID NO: 7; or (2) an amino acid sequence obtained by substituting, deleting or adding one or more residues of the amino acid sequence shown in (1), and having the same or similar function as (1); or (3) an amino acid sequence having at least 90% homology to the amino acid sequence shown in (1) or (2); Its light chain variable region has: (4) the amino acid sequence shown in SEQ ID NO: 6 or SEQ ID NO: 8; or (5) An amino acid sequence obtained by replacing, deleting or adding one or more residues of the amino acid sequence shown in (4), and having the same or similar function as (4); or (6) an amino acid sequence having at least 90% homology to the amino acid sequence shown in (4) or (5); The plurality is 2 to 5.

4. An antibody combination, characterized in that Comprising the antibody of claim 2 or 3.

5. A nucleic acid molecule encoding the antibody according to claim 2 or 3.

6. The nucleic acid molecule according to claim 5, characterized in that have: (7), the nucleotide sequence shown in SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23 or SEQ ID NO:24; or (8) A nucleotide sequence obtained by replacing, deleting or adding one or more bases to the nucleotide sequence shown in (7), and having the same or similar function as (7); or (9) a nucleotide sequence having at least 90% homology to the nucleotide sequence shown in (7) or (8); The number is 2 to 15.

7. Use of any of the following in the preparation of products containing Talaromyces marneffei: (i) the antibody according to claim 2 or 3; (ii) the antibody combination according to claim 4; (iii) a nucleic acid molecule according to claim 5 or 6; The products include: (a) an enzyme-linked immunosorbent assay kit for detecting yeast-phase protein HSP30 of Talaromyces marneffei; or (b) an immunochromatographic detection kit for detecting yeast-phase protein HSP30 of Talaromyces marneffei; or (c) In vitro detection of yeast phase protein HSP30 of Talaromyces marneffei using fluorescent probe reagent; or (d) Drugs or preparations for preventing and / or treating diseases related to Talaromyces marneffei infection.

8. A product, characterized in that include: (i) the antibody according to claim 2 or 3; or (ii) the antibody combination according to claim 4; The products include: (a), ELISA kit for detecting yeast-phase protein HSP30 of Talaromyces marneffei; Or (b), an immunochromatographic detection kit for detecting the yeast phase protein HSP30 of Talaromyces marneffei; or (c), an in vitro fluorescent probe reagent for detecting the yeast phase protein HSP30 of Talaromyces marneffei; or (d), a drug or preparation for preventing and / or treating diseases related to Talaromyces marneffei infection.

9. A detection method for non-diagnostic and non-therapeutic purposes, characterized in that: Based on any of the following tests: (i) the antibody according to claim 2 or 3; (ii) The antibody combination according to claim 4.

Images