A cyclic ligation ultrasensitive immunoassay method

Through the circular ligation hypersensitive immunoassay method, nucleic acid amplification is performed by using circular elements and ligase to form a circular template, which solves the antibody quality dependence and background signal problems in PLA technology, and achieves high specificity and stability protein detection.

CN119757755BActive Publication Date: 2025-08-29SHANGHAI BIOGERM MEDICAL TECH CO LTD
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202411552753.3
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-11-01
Publication Date
2025-08-29
Estimated Expiration
2044-11-01

AI Technical Summary

Technical Problem

The existing proximity ligation technology (PLA) has problems in protein detection with high dependence on antibody quality, batch difference leads to deviation in result and non-specific ligation of oligonucleotides to generate background signals, resulting in insufficient specificity and stability of the detection.

Method used

The cyclic ligation hypersensitive immunoassay method is used to mix the sample to be tested with the first antibody and the second antibody to form a complex, and bind to the first and second circular elements, and then use ligase to form a circular template and perform exonuclease cleavage and nucleic acid amplification to detect the signal.

Benefits of technology

It improves the specificity and stability of protein detection, reduces background signal, is suitable for high sensitivity detection of low-abundance proteins, is simple to operate and does not require large instruments.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119757755B_ABST
    Figure CN119757755B_ABST
Patent Text Reader

Abstract

The present invention relates to an antigen detection method. Specifically, an antigen reacts with an antibody, a first cyclic element, and a second cyclic element to form an antigen-antibody-nucleic acid complex. A ligase and an exonuclease are then used to catalyze the formation of a circular template molecule. A nucleic acid amplification reaction is performed using the circular template molecule as a target, and a signal is detected to obtain a detection result. The method of the present invention has high specificity, high detection efficiency, and low background signal, and exhibits excellent stability and sensitivity in the detection of low-abundance proteins.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the field of molecular biology, and in particular to a cyclic connection hypersensitive immunoassay method. Background Art

[0002] In the field of clinical diagnostics, proximity ligation (PLA) is a highly sensitive protein detection technology. By detecting the expression levels and post-translational modifications of specific proteins, PLA helps identify disease-related biomarkers, thereby improving the accuracy and reliability of diagnosis, especially in situations where high sensitivity and specificity are required. For example, PLA can be used to detect tumor markers, aiding in the diagnosis of cancer and monitoring disease progression. PLA technology has also been applied to the detection of pathogens, such as viruses and bacteria. This technology can provide higher sensitivity than traditional immunoassays, facilitating rapid diagnosis in the early stages of infection.

[0003] The advantage of PLA technology lies in its high specificity and sensitivity. It combines the specificity of ELISA and the sensitivity of PCR, making it possible to detect low-abundance proteins. In addition, PLA technology does not require sample purification and can be directly detected in cell or tissue samples. It is suitable for a variety of sample types, including biological samples, cell lines, and fresh, frozen or formalin-fixed tissue sections. PLA technology can also be used for multiple detection to increase the throughput of experiments. Although PLA technology has many advantages, it also has some limitations, such as its high dependence on the quality of the antibodies used, batch differences in antibody performance may lead to deviations in the results, and non-specific ligation of oligonucleotides may produce background signals.

[0004] Therefore, there is an urgent need in this field for a PLA-based protein detection technology with good specificity, high stability, and high sensitivity. Summary of the Invention

[0005] The purpose of the present invention is to provide a protein detection technology based on PLA with good specificity, high stability and high sensitivity.

[0006] The first aspect of the present invention provides an antigen detection method, comprising the steps of:

[0007] (s1) mixing a sample to be tested with a first antibody and a second antibody, so that the first antibody and the second antibody bind to the target antigen in the sample to be tested to form a first antibody-antigen-second antibody complex, wherein the first antibody is coupled to a first linking element, and the second antibody is coupled to a second linking element;

[0008] (s2) mixing the first antibody-antigen-second antibody complex with a first loop element, a second loop element, and a ligase, so that the first linker coupled to the first antibody complements the terminal bases of the first loop element and the second loop element to form a double-stranded structure, and the second linker coupled to the second antibody complements the other terminal bases of the first loop element and the second loop element to form a double-stranded structure;

[0009] There are a first gap and a second gap of length ≤1 nt between the first ring element and the second ring element;

[0010] The first gap and the second gap are connected under the action of ligase, thereby forming a circular template;

[0011] (s3) cutting the linear nucleic acid under the action of an exonuclease to obtain a circular template; and

[0012] (s4) performing a nucleic acid amplification reaction on the circular template, detecting a signal, and obtaining a detection result;

[0013] The first loop element, the second loop element, the first connecting element and the second connecting element are single-stranded nucleic acids.

[0014] In another preferred embodiment, the length of the first loop element is 30 to 80 nucleotides, preferably 40 to 60, and more preferably 45 to 60.

[0015] In another preferred embodiment, the length of the second loop element is 60 to 130 nucleotides, preferably 80 to 120, and more preferably 90 to 110.

[0016] In another preferred embodiment, the first connecting element has a structure shown in formula (I):

[0017] Z0-Z1-Z2-Z3 (I);

[0018] Wherein, Z0 is 0 to 5 nucleotides;

[0019] Z1 and Z2 are each independently 5 to 15 nucleotides;

[0020] Z3 is 10 to 30 nucleotides;

[0021] The second connecting element has a structure shown in formula (II):

[0022] X0-X1-X2-X3 (II);

[0023] Wherein, X0 is 5 to 15 nucleotides;

[0024] X1 and X2 are each independently 5 to 15 nucleotides;

[0025] X3 is 15 to 30 nucleotides;

[0026] The first cyclic element has a structure represented by formula (III):

[0027] Z1'-L1-X1' (III);

[0028] Wherein, Z1' is complementary to Z1;

[0029] X1' is complementary to X1;

[0030] L1 is 20 to 50 nucleotides;

[0031] The second cyclic element has a structure represented by formula (IV):

[0032] Z2'-L2-X2' (IV);

[0033] Wherein, Z2' is complementary to Z2;

[0034] X2' is complementary to X2;

[0035] L2 is 50 to 100 nucleotides.

[0036] In another preferred embodiment, L1 is 20 to 40 nucleotides

[0037] In another preferred embodiment, L2 is 60 to 100 nucleotides.

[0038] In another preferred embodiment, Z1, Z2, X1 and X2 are each independently 7 to 13 nucleotides, preferably 8 to 12, more preferably 9 to 11, for example 10 nucleotides.

[0039] In another preferred embodiment, Z3 is 10 to 25 nucleotides, preferably 10 to 20, more preferably 12 to 16, for example, 14 nucleotides.

[0040] In another preferred embodiment, X3 is 15 to 25 nucleotides, preferably 17 to 22, more preferably 18 to 11, for example, 20 nucleotides.

[0041] In another preferred embodiment, Z0 is 1 to 4 nucleotides, preferably 1 to 3, for example, 2 nucleotides.

[0042] In another preferred embodiment, X0 is 6 to 13 nucleotides, preferably 8 to 12, for example, 10 nucleotides.

[0043] In another preferred embodiment, L1 is 20 to 40 nucleotides, preferably 25 to 35, more preferably 30 to 35, for example, 32 nucleotides.

[0044] In another preferred embodiment, L2 is 70 to 100 nucleotides, preferably 80 to 90, more preferably 85 to 90, for example, 87 nucleotides.

[0045] In another preferred example, the first connecting element has a nucleotide sequence as shown in SEQ ID NO: 1.

[0046] In another preferred example, the second connecting element has a nucleotide sequence as shown in SEQ ID NO: 2.

[0047] In another preferred embodiment, the first loop element has a nucleotide sequence as shown in SEQ ID NO: 3.

[0048] In another preferred embodiment, the second loop element has a nucleotide sequence as shown in SEQ ID NO:4.

[0049] In another preferred embodiment, the volume of the sample to be tested is 1 to 100 μL, preferably 1 to 50 μL.

[0050] In another preferred embodiment, the first antibody is linked to one or more first linking elements.

[0051] In another preferred embodiment, the second antibody is linked to one or more second linking elements.

[0052] In another preferred embodiment, the antibody is linked to the linker via a covalent bond.

[0053] In another preferred embodiment, the antibody is linked to the linker via a click chemistry reaction.

[0054] In another preferred embodiment, the step (s1) is carried out at 20-50°C, preferably 25-40°C, more preferably 30-40°C, for example, about 37°C.

[0055] In another preferred embodiment, in step (s1), the time for mixing the test sample with the first antibody and the second antibody is 0.5 to 5 hours, preferably 1 to 4 hours, more preferably 1 to 3 hours, for example, about 2 hours.

[0056] In another preferred embodiment, in step (s1), the test sample is mixed with the first antibody and the second antibody in a sample incubation buffer containing a component selected from the group consisting of: 0.01% to 1% goat IgG, 0.01 to 1 mg / mL single-stranded salmon sperm DNA, 0.01% to 1% BSA, 1 to 10 mM EDTA, 0.001% to 0.1% Triton-X100, 0.001% to 0.01% sodium azide, and 0.001% to 0.01% blocking conjugate;

[0057] Preferably, 0.01% to 0.1% goat IgG, 0.05 to 0.51 mg / mL single-stranded salmon sperm DNA, 0.1% to 1% BSA, 3 to 8 mM EDTA, 0.005% to 0.05% Triton-X100, 0.005% to 0.05% sodium azide, and 0.001% to 0.01% blocking conjugate;

[0058] For example, 0.05% goat IgG, 0.1 mg / mL single-stranded salmon sperm DNA, 0.5% BSA, 5 mM EDTA, 0.01% Triton-X100, 0.02% sodium azide, and 0.2% blocking conjugate.

[0059] In another preferred embodiment, in step (s2), the concentrations of the first ring element and the second ring element are independently 0.01 to 500 μM.

[0060] In another preferred embodiment, in step (s2), the concentrations of the first antibody and the second antibody are independently 0.01 to 5 nM, preferably 0.05 to 1 nM, more preferably 0.05 to 0.5 nM, for example, about 0.1 nM or 0.2 nM.

[0061] In another preferred embodiment, the first antibody and the second antibody are diluted in an antibody diluent containing components selected from the group consisting of: 10-50 mM Tris-HCl, 1-20 mM EDTA, 0.01-1 μg / mL biotin, 0.01-1 mg / mL single-stranded salmon sperm DNA, 0.001%-0.1% sodium azide, and 0.01%-5% PEA conjugate;

[0062] Preferably, 10-30 mM Tris-HCl, 5-15 mM EDTA, 0.01-0.5 μg / mL biotin, 0.1-0.5 mg / mL single-stranded salmon sperm DNA, 0.01%-0.05% sodium azide, and 0.1%-1% PEA conjugate;

[0063] For example, 20 mM Tris-HCl, 10 mM EDTA, 0.05 μg / mL biotin, 0.2 mg / mL single-stranded salmon sperm DNA, 0.02% sodium azide, and 0.5% PEA conjugate.

[0064] In another preferred embodiment, in step (s2), the molar ratio of the first cyclic element to the second cyclic element is 5:1 to 1:5, preferably 3:1 to 1:3, more preferably 2:1 to 1:2, for example, about 1:1.

[0065] In another preferred embodiment, in step (s2), the concentrations of the first ring element and the second ring element are independently 0.01 to 300 μM, preferably 0.05 to 100 μM, more preferably 0.5 to 50 μM, for example, 1 μM.

[0066] In another preferred embodiment, in step (s2), the double-stranded structure is formed spontaneously at 20-50°C, preferably 25-40°C, more preferably 30-40°C, for example, about 37°C.

[0067] In another preferred embodiment, in step (s2), the first antibody-antigen-second antibody complex is mixed with the first ring element and the second ring element for 0.5 to 5 hours, preferably 1 to 4 hours, more preferably 1 to 3 hours, for example, about 2 hours.

[0068] In another preferred embodiment, in step (s2), the ligase is selected from the group consisting of T4, T7, Ampligase, or a combination thereof.

[0069] In another preferred embodiment, in step (s2), the ligation is performed in a ligation mixture containing components selected from the group consisting of Tris-HCl, MgCl2, ATP and DTT.

[0070] In another preferred embodiment, in step (s2), the ligation mixture comprises the following components: 5-50 mM Tris-HCl, 0.1-10 mM MgCl2, 0.1-10 mM ATP and 1-100 mM DTT;

[0071] Preferably, 10-30 mM Tris-HCl, 0.5-5 mM MgCl2, 0.5-5 mM ATP and 5-50 mM DTT;

[0072] More preferably, 20 mM Tris-HCl, 1.5 mM MgCl2, 1.5 mM ATP and 10 mM DTT.

[0073] In another preferred embodiment, in step (s2), the amount of the ligase is 1-10 U, preferably 5-10 U, more preferably 6-8 U, for example, about 7.5 U.

[0074] In another preferred embodiment, in step (s2), the connection is performed at 20-60°C, preferably 30-50°C, more preferably 40-48°C, for example, about 45°C.

[0075] In another preferred embodiment, in step (s2), the connection time is 10 to 120 min, preferably 20 to 60 min, more preferably 20 to 40 min, for example, about 30 min.

[0076] In another preferred embodiment, in step (s3), the exonuclease is exonuclease I and exonuclease III.

[0077] In another preferred embodiment, the step (s3) is carried out at 20-50°C, preferably 25-40°C, more preferably 30-40°C, for example, about 37°C.

[0078] In another preferred embodiment, in step (s3), the exonuclease is incubated for 10 to 120 min, preferably 20 to 60 min, more preferably 20 to 40 min, for example, about 30 min.

[0079] In another preferred embodiment, in step (s3), the concentration of the exonuclease is 0.1-20 U / μL, preferably 0.5-10 U / μL, more preferably 1-5 U / μL, for example, about 2.5 U / μL.

[0080] In another preferred embodiment, the step (s3) is carried out in an exonuclease mixture containing components selected from the group consisting of: 1-100 mM Tris-HCl, 1-50 mM MgCl2, and 0.1-10 mM DTT;

[0081] Preferably, 10-60 mM Tris-HCl, 1-30 mM MgCl2 and 0.1-5 mM DTT;

[0082] More preferably, 20-40 mM Tris-HCl, 5-20 mM MgCl2, and 0.5-3 mM DTT;

[0083] For example, about 40 mM Tris-HCl, about 10 mM MgCl2, and about 1 mM DTT.

[0084] In another preferred embodiment, the exonuclease mixture comprises the following components: Tris-HCl, MgCl2 and DTT.

[0085] In another preferred embodiment, after step (s3), a heating step (s3a) is further included, wherein the heating is performed at 60-85°C, preferably 70-85°C, more preferably 75-85°C, for example, about 80°C.

[0086] In another preferred embodiment, in the heating step (s3a), the heating time is 10 to 60 min, preferably 20 to 40 min, more preferably 20 to 30 min, for example, about 20 min.

[0087] In another preferred embodiment, the cyclic template has a structure selected from the following group:

[0088]

[0089] Wherein, Z1', L1, X1', Z2', L2 and X2' are as described above.

[0090] In another preferred embodiment, in step (s4), in the nucleic acid amplification, the upstream primer spans the first gap and the downstream primer spans the second gap.

[0091] In another preferred embodiment, the upstream primer spanning the first gap means that the region where the upstream primer is complementary to the circular template includes the first gap.

[0092] In another preferred embodiment, the length of the upstream primer is 15 to 30 nucleotides, preferably 15 to 25, and more preferably 18 to 23.

[0093] In another preferred embodiment, with the first gap as the base point, the length ratio of both sides of the upstream primer is 2:1 to 1:2.

[0094] In another preferred embodiment, the downstream primer spanning the second gap means that the region where the downstream primer is complementary to the circular template includes the second gap.

[0095] In another preferred embodiment, the length of the downstream primer is 15 to 30 nucleotides, preferably 15 to 25, and more preferably 18 to 23.

[0096] In another preferred embodiment, with the second gap as the base point, the length ratio of both sides of the downstream primer is 2:1 to 1:2.

[0097] In another preferred embodiment, the upstream primer has a nucleotide sequence as shown in SEQ ID NO: 5.

[0098] In another preferred example, the downstream primer has a nucleotide sequence as shown in SEQ ID NO: 6.

[0099] In another preferred embodiment, in step (s4), the nucleic acid amplification further includes a probe.

[0100] In another preferred embodiment, the probe has a nucleotide sequence as shown in SEQ ID NO:7.

[0101] In another preferred embodiment, in step (s4), the nucleic acid amplification reaction is selected from the following group: PCR, qPCR, dye-based PCR, ddPCR, RPA, or LAMP.

[0102] In another preferred embodiment, the nucleic acid amplification reaction is a qPCR reaction.

[0103] In another preferred embodiment, the reaction conditions of the nucleic acid amplification reaction include pre-denaturation at 95°C for 10 minutes, denaturation at 95°C for 15 seconds, and extension at 60°C for 60 seconds, for a total of 45 cycles.

[0104] In another preferred embodiment, the method is non-diagnostic and non-therapeutic.

[0105] In another preferred embodiment, the method is in vitro.

[0106] In another preferred embodiment, the antigen includes glial fibrillary acidic protein and / or IL-6.

[0107] In another preferred embodiment, the content of the target protein in the sample to be tested is ≥100 pg / mL, preferably ≥10 pg / mL, preferably ≥1 pg / mL, and more preferably ≥1 pg / mL.

[0108] In another preferred embodiment, the sample to be tested includes a plasma sample.

[0109] In a second aspect, the present invention provides an antigen detection system, comprising:

[0110] (a) a first antibody and a second antibody, wherein the first antibody and the second antibody specifically bind to a target antigen, and the first antibody is coupled to a first linking element, and the second antibody is coupled to a second linking element;

[0111] (b) a first annular element; and

[0112] (c) a second annular element;

[0113] The first connecting element, the second connecting element, the first annular element and the second annular element are defined as described in the first aspect of the present invention.

[0114] In another preferred embodiment, the concentrations of the first antibody and the second antibody in the antigen detection system are independently 0.01 to 5 nM, preferably 0.05 to 1 nM, more preferably 0.05 to 0.5 nM, for example, about 0.1 nM or 0.2 nM.

[0115] In another preferred example, in the antigen detection system, the molar ratio of the first cyclic element to the second cyclic element is 5:1 to 1:5, preferably 3:1 to 1:3, more preferably 2:1 to 1:2, for example, about 1:1.

[0116] In another preferred embodiment, in the antigen detection system, the concentrations of the first ring element and the second ring element are independently 0.01 to 300 μM, preferably 0.05 to 100 μM, more preferably 0.5 to 50 μM, for example, about 1 μM.

[0117] In another preferred embodiment, the antigen detection system further comprises primers and probes, and the definitions of the primers and probes are as described in the first aspect of the present invention.

[0118] In another preferred embodiment, the antigen detection system further comprises a ligase and / or an exonuclease.

[0119] In another preferred embodiment, in the antigen detection system, the amount of the ligase is 1-10 U, preferably 5-10 U, more preferably 6-8 U, for example, about 7.5 U.

[0120] In another preferred embodiment, in the antigen detection system, the concentration of the exonuclease is 0.1-20 U / μL, preferably 0.5-10 U / μL, more preferably 1-5 U / μL, for example, about 2.5 U / μL.

[0121] In a third aspect, the present invention provides an antigen detection kit, comprising:

[0122] (i) a first container and a first antibody and a second antibody located in the first container; the first antibody is coupled to a first linker, and the second antibody is coupled to a second linker;

[0123] (ii) a second container and a first annular element and a second annular element located in the second container;

[0124] The first connecting element, the second connecting element, the first annular element and the second annular element are defined as described in the first aspect of the present invention.

[0125] In another preferred embodiment, the kit further comprises:

[0126] (iii) a third container and a ligase located in the third container;

[0127] (iv) a fourth container and an exonuclease located in the fourth container.

[0128] In another preferred embodiment, the kit further comprises a fifth container and primers and probes located in the fifth container, and the definitions of the primers and probes are as described in the first aspect of the present invention.

[0129] In another preferred embodiment, the first container, the second container, the third container, the fourth container and / or the fifth container are the same or different containers.

[0130] In another preferred embodiment, the kit further comprises a sample incubation buffer, and the definition of the sample incubation buffer is as described in the first aspect of the present invention.

[0131] In another preferred embodiment, the kit further comprises a ligation mixture containing components selected from the group consisting of: 5-50 mM Tris-HCl, 0.1-10 mM MgCl2, 0.1-10 mM ATP and 1-100 mM DTT;

[0132] Preferably, 10-30 mM Tris-HCl, 0.5-5 mM MgCl2, 0.5-5 mM ATP and 5-50 mM DTT;

[0133] More preferably, 20 mM Tris-HCl, 1.5 mM MgCl2, 1.5 mM ATP and 10 mM DTT.

[0134] In another preferred embodiment, the kit further comprises an exonuclease mixture containing components selected from the group consisting of: 1-100 mM Tris-HCl, 1-50 mM MgCl2, and 0.1-10 mM DTT;

[0135] Preferably, 10-60 mM Tris-HCl, 1-30 mM MgCl2 and 0.1-5 mM DTT;

[0136] More preferably, 20-40 mM Tris-HCl, 5-20 mM MgCl2, and 0.5-3 mM DTT;

[0137] For example, about 40 mM Tris-HCl, about 10 mM MgCl2, and about 1 mM DTT.

[0138] In another preferred embodiment, the kit further comprises an antibody diluent, and the antibody dilution buffer is defined as described in the first aspect of the present invention.

[0139] In another preferred embodiment, the kit further comprises a nucleic acid amplification reaction solution for nucleic acid amplification reaction.

[0140] In another preferred embodiment, the first antibody and the second antibody specifically bind to the target antigen.

[0141] In a fourth aspect, the present invention provides a use of the antigen detection system according to the second aspect of the present invention or the antigen detection kit according to the third aspect of the present invention, for detecting antigens in a sample to be tested.

[0142] In another preferred embodiment, the sample to be tested contains antigens, preferably glial fibrillary acidic protein and / or IL-6.

[0143] In another preferred embodiment, the use is for the purpose of disease diagnosis.

[0144] In another preferred embodiment, the use is for non-disease diagnosis purposes.

[0145] In another preferred embodiment, the sample to be tested includes a plasma sample.

[0146] In a fifth aspect, the present invention provides an antigen detection method, comprising the steps of:

[0147] The antigen detection system as described in the second aspect of the present invention or the antigen detection kit as described in the third aspect of the present invention is used to treat the sample to be tested, and a nucleic acid amplification reaction is performed to obtain the test result.

[0148] It should be understood that within the scope of the present invention, the above-mentioned technical features of the present invention and the technical features described in detail below (such as in the embodiments) can be combined with each other to form new or preferred technical solutions. Due to space limitations, they will not be listed here one by one. BRIEF DESCRIPTION OF THE DRAWINGS

[0149] Figure 1 A schematic diagram of the principle of the method of the present invention is shown.

[0150] Figure 2 The graph shows the results of detecting GFAP using the method of the present invention.

[0151] Figure 3 The effect of oligonucleotides of different lengths on the experimental results is shown.

[0152] Figure 4 A graph showing the results of detecting IL-6 using the method of the present invention is shown.

[0153] Figure 5 A graph showing the results of PLA detection of IL-6. DETAILED DESCRIPTION

[0154] After extensive and intensive research, numerous experiments, and screening, the inventors unexpectedly discovered a protein detection method based on a ring structure. By optimizing the length of the ring element, the inventors ultimately developed a protein detection method with excellent specificity and high detection efficiency. This method overcomes the problem of strong background signals in the prior art, improves the stability and sensitivity of protein marker detection, and exhibits excellent stability and sensitivity in applications involving low-abundance protein detection. This is the basis for the completion of the present invention.

[0155] the term

[0156] In order to make the present invention easier to understand, certain technical and scientific terms are specifically defined below. Unless otherwise clearly defined in this article, all other technical and scientific terms used herein have the meanings commonly understood by those of ordinary skill in the art to which the present invention belongs. Before describing the present invention, it should be understood that the present invention is not limited to the specific methods and experimental conditions, because such methods and conditions can change. It should also be understood that the terms used herein are intended only to describe specific embodiments, and are not intended to be restrictive, and the scope of the present invention will be limited only by the appended claims.

[0157] As used herein, the term “comprise” or variations thereof such as “include” or “comprising”, etc., is understood to include the stated elements or components but does not exclude other elements or components.

[0158] The term "about" can refer to a value or composition that is within an acceptable error range for a particular value or composition as determined by one of ordinary skill in the art, which will depend in part on how the value or composition is measured or determined. For example, as used herein, the expression "about 100" includes all values ​​between 99 and 101 (e.g., 99.1, 99.2, 99.3, 99.4, etc.).

[0159] As used herein, unless otherwise indicated, any concentration range, percentage range, ratio range, or integer range should be understood to include the value of any integer within the range and, where appropriate, fractional values ​​thereof (e.g., tenths and hundredths of an integer).

[0160] As used herein, the term "and / or" refers to and encompasses any and all possible combinations of one or more of the associated listed items.

[0161] As used herein, the terms "first / second connecting element of the present invention" and "probe 1 / 2" are used interchangeably.

[0162] As used herein, the terms "first / second circular element of the present invention" and "oligonucleotide 1 / 2" are used interchangeably.

[0163] glial fibrillary acidic protein

[0164] Glial Fibrillary Acidic Protein (GFAP) is an intermediate filament protein found in astrocytes of the central nervous system (CNS). GFAP plays an important role in maintaining cell structure, providing cellular support, and regulating intracellular signaling. In neurological diseases, GFAP expression and function may be altered, and these changes are often closely linked to the disease pathology.

[0165] Method of the present invention

[0166] As used herein, the terms "the method of the present invention" and "the antigen detection method of the present invention" are used interchangeably and both refer to the method according to the first aspect of the present invention, comprising the steps of:

[0167] (s1) mixing a sample to be tested with a first antibody and a second antibody, so that the first antibody and the second antibody bind to the target antigen in the sample to be tested to form a first antibody-antigen-second antibody complex, wherein the first antibody is coupled to a first linking element, and the second antibody is coupled to a second linking element;

[0168] (s2) mixing the first antibody-antigen-second antibody complex with a first loop element, a second loop element, and a ligase, so that the first linker coupled to the first antibody complements the terminal bases of the first loop element and the second loop element to form a double-stranded structure, and the second linker coupled to the second antibody complements the other terminal bases of the first loop element and the second loop element to form a double-stranded structure;

[0169] There are a first gap and a second gap of length ≤1 nt between the first ring element and the second ring element;

[0170] The first gap and the second gap are connected under the action of ligase, thereby forming a circular template;

[0171] (s3) cutting the linear nucleic acid under the action of an exonuclease to obtain a circular template; and

[0172] (s4) performing a nucleic acid amplification reaction on the circular template, detecting a signal, and obtaining a detection result;

[0173] The first loop element, the second loop element, the first connecting element and the second connecting element are single-stranded nucleic acids.

[0174] In a preferred embodiment, the first connecting element has a structure shown in formula (I):

[0175] Z0-Z1-Z2-Z3 (I);

[0176] Wherein, Z0 is 0 to 5 nucleotides;

[0177] Z1 and Z2 are each independently 5 to 15 nucleotides;

[0178] Z3 is 10 to 30 nucleotides;

[0179] The second connecting element has a structure shown in formula (II):

[0180] X0-X1-X2-X3 (II);

[0181] Wherein, X0 is 5 to 15 nucleotides;

[0182] X1 and X2 are each independently 5 to 15 nucleotides;

[0183] X3 is 15 to 30 nucleotides;

[0184] The first cyclic element has a structure represented by formula (III):

[0185] Z1'-L1-X1' (III);

[0186] Wherein, Z1' is complementary to Z1;

[0187] X1' is complementary to X1;

[0188] L1 is 20 to 50 nucleotides;

[0189] The second cyclic element has a structure represented by formula (IV):

[0190] Z2'-L2-X2' (IV);

[0191] Wherein, Z2' is complementary to Z2;

[0192] X2' is complementary to X2;

[0193] L2 is 50 to 100 nucleotides.

[0194] In a preferred embodiment, the first connecting element has a nucleotide sequence as shown in SEQ ID NO: 1.

[0195] In a preferred embodiment, the second connecting element has a nucleotide sequence as shown in SEQ ID NO: 2.

[0196] In a preferred embodiment, the first loop element has a nucleotide sequence as shown in SEQ ID NO: 3.

[0197] In a preferred embodiment, the second loop element has a nucleotide sequence as shown in SEQ ID NO:4.

[0198] In a preferred embodiment, in the nucleic acid amplification, the upstream primer spans the first gap, and the downstream primer spans the second gap.

[0199] like Figure 1 As shown, the principle of the method of the present invention is that two antibodies specifically recognize the target antigen (target protein) and bind thereto, and the two antibodies are respectively modified with a first connecting element and a second connecting element, thereby shortening the distance between the first connecting element and the second connecting element. In the presence of the first annular element and the second annular element, the first connecting element coupled to the first antibody complements the terminal bases of the first annular element and the second annular element to form a double-stranded structure, and the second connecting element coupled to the second antibody complements the other terminal bases of the first annular element and the second annular element to form a double-stranded structure, thereby forming a structure of the first gap and the second gap. The first gap and the second gap are connected under the action of a ligase to form a circular template. An exonuclease is added to remove the linear nucleic acid in the system to obtain a highly pure circular template. The circular template is subjected to a nucleic acid amplification reaction to obtain a test result.

[0200] The main advantages of the present invention include:

[0201] 1. The method of the present invention has good repeatability, high accuracy, simple operation, low cost and does not require large instruments.

[0202] 2. The method of the present invention is suitable for micro-volume detection and can detect 1 μL of sample.

[0203] 3. The method platform of the present invention has wide applicability, can detect multiple targets simultaneously, and is suitable for high-throughput detection.

[0204] 4. The method of the present invention can achieve rapid detection.

[0205] The present invention will be further described below in conjunction with specific examples. It should be understood that these examples are intended to illustrate the present invention only and are not intended to limit the scope of the present invention. The experimental methods in the following examples, for which specific conditions are not specified, are generally performed under conventional conditions, such as those described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or according to the conditions recommended by the manufacturer. Unless otherwise stated, percentages and parts are calculated by weight.

[0206] General Methods

[0207] 1. Prepare affinity probes: Polyclonal antibodies are conjugated to oligonucleotides modified with amine groups using aromatic hydrazide chemistry to form affinity probes with phosphorylated 5' or 3' ends. Oligonucleotide and antibody conjugates can be linked directly by chemical reaction, directly linking the terminal functional groups (e.g., amine or hydroxyl) of the oligonucleotide to the corresponding functional groups (e.g., carboxyl) on the antibody.

[0208] Alternatively, the oligonucleotide and antibody can be linked via a spacer arm. The linker typically contains one or more reactive chemical groups, such as isothiocyanate, N-hydroxysuccinimide ester (NHSester), or maleimide, which can react with lysine or cysteine ​​residues on the antibody.

[0209] Affinity probes can also be constructed by linking oligonucleotides with corresponding functional groups and antibodies using click chemistry principles, such as copper-catalyzed azide-alkyne cycloaddition reaction.

[0210] 2. Sample Incubation: Add the sample to the affinity probe mixture and incubate at 37°C for 2 hours to allow the target analyte to bind to the antibodies in the affinity probes (two antibodies at 0.1 nM and 0.2 nM concentrations, respectively). The sample volume can be 5-50 μL.

[0211] 3. Ligation step: Add a ligation mixture containing two circular oligonucleotides (at a 1:1 molar ratio), ligase, NAD, DTT, etc. to the incubated sample and incubate at 45°C for 30 minutes to perform the ligation reaction. Commercially available ligases such as T4, T7, and Ampligase can be used.

[0212] 4. Exonuclease treatment: After the ligation reaction, add an exonuclease mixture containing exonuclease I and exonuclease III, incubate at 37°C for 30 minutes, and then heat at 80°C for 20 minutes to inactivate the exonucleases to degrade the DNA that has not formed a circular shape.

[0213] 5. qPCR quantification: Add the exonuclease-treated ligation product to the qPCR mixture (containing primer sequence 3, primer sequence 4, probe sequence, and qPCR reaction solution) and perform quantitative analysis using real-time qPCR. The qPCR conditions are 95°C pre-denaturation for 10 minutes, followed by 95°C denaturation for 15 seconds and 60°C extension for 60 seconds, for a total of 40 cycles. Detection methods can also use dye-based PCR, isothermal amplification methods such as RPA and LAMP, which can amplify the signal.

[0214] 6. Data Analysis: Convert qPCR Ct values ​​to estimated numbers of bound molecules and calculate detection limits.

[0215] Sample incubation buffer formulation: 0.05% goat IgG, 0.1 mg / mL single-stranded salmon sperm DNA, 0.5% BSA, 5 mM EDTA, 0.01% Triton-X100, 0.02% sodium azide, and 0.2% blocking conjugate.

[0216] Antibody diluent formula: 20 mM Tris-HCl, 10 mM EDTA, 0.05 μg / mL biotin, 0.2 mg / mL single-stranded salmon sperm DNA, 0.02% sodium azide, and 0.5% PEA conjugate.

[0217] Ligation mix formula: 20mM Tris-HCl, 1.5mM MgCl2, 1.5mM ATP, 10mM DTT, T4 ligase, oligonucleotides 1 and 2. Oligonucleotide concentration is 1μM, and T4 ligase concentration is 7.5U / reaction.

[0218] Exonuclease mixture formula: 40mM Tris-HCl, 10mM MgCl2, 1mM DTT, 2.5U / μL exonuclease I and / or exonuclease III.

[0219] Example 1

[0220] 1.1 Methods

[0221] The detection target of this example is glial fibrillary acidic protein, and the antibody used is an antibody developed by Shanghai Biopharmaceuticals Co., Ltd.

[0222] The experiment was conducted according to the general method using 10 μL clinical plasma samples (supplemented with different concentrations of GFAP: 0.1 pg / mL, 1 pg / mL, 10 pg / mL, and 100 pg / mL). The CK group consisted of plasma samples without GFAP. The probes used in this example are listed in Table 1.

[0223] Table 1

[0224]

[0225]

[0226] Note: The identically labeled sequences are the circular complementary regions where the ligation reaction occurs. Probes 1 and 2 are oligonucleotides attached to the antibody.

[0227] Probe 1 was linked to the carboxyl group on the antibody via NH2 modification at the 3' end, and probe 2 was linked to the carboxyl group on the antibody via NH2 modification at the 5' end. The connections were performed using the abcam coupling kit ab218260.

[0228] 1.2 Results

[0229] Table 2 Results of GFAP detection by the method of the present invention

[0230] CK 100 pg / mL 10 pg / mL 1 pg / mL 0.1 pg / mL Ct 1 NoCt 24.6 27.8 31.12 33.74 Ct 2 NoCt 24.9 27.55 31.54 33.2 AVE NoCt 24.75 27.675 31.33 33.47

[0231] like Figure 2 As shown in Table 2, the method of the present invention can produce good correlation for gradient dilution samples, with a sensitivity of up to 0.1 pg / mL, which fully meets the needs of clinical diagnosis. At the same time, low-concentration samples are completely unaffected by background signals, and the results are very stable.

[0232] Example 2

[0233] 2.1 Methods

[0234] The inventors explored the effects of oligonucleotides of different lengths on the test results. The experimental method is as described in the general method, and the detection target is GFAP. The difference between this example and Example 1 is that the sequence of oligonucleotide 1 is different. The oligonucleotides 1 and 2 in this example are substantially the same in length.

[0235] 2.2 Results

[0236] Table 3 Detection results using oligonucleotides of substantially the same length

[0237] CK 100 pg / mL 10 pg / mL 1 pg / mL 0.1 pg / mL Ct1 39.06 33.94 36.05 37.65 38.01 Ct2 39.71 34.07 35.96 37.77 38.26 AVE 39.385 34.005 36.005 37.71 38.135

[0238] The results are as follows Figure 3 As shown in Table 3, compared with one long and one short oligonucleotide (Example 1), the use of a double long chain ring structure (this embodiment) is prone to secondary structure, and the difficulty of loop formation and connection increases, which reduces its sensitivity, affects the efficiency of subsequent amplification to a certain extent, and there is a risk of nonspecific amplification, which increases the instability of the experimental results. Therefore, the length of the oligonucleotide group is one long and one short, or the length of the oligonucleotide chain is shortened within the experimental allowable range, which has better amplification results.

[0239] Comparative Example

[0240] IL-6 was used as the target, and 20 μL of plasma samples (spiked with 0.5 pg / mL, 1 pg / mL, 10 pg / mL, and 100 pg / mL of IL-6, respectively) were used. The CK group consisted of plasma samples without IL-6. Antibodies (A21264 and A24913 from Abclonal) were used. The experimental methods were as described in the General Methods. The sequences of the oligonucleotides linked to the loop using the method of the present invention are as described in Example 1. The sequences used in the comparative examples are shown in Table 4.

[0241] Table 4

[0242] name sequence SEQ ID NO: Oligonucleotides TTTCCAGCTTAACACTGCGCGAGAAA 9 Primer 3 GTTGGCAAGATCTACTCCGG 10 Primer 4 TTCTTGGGTGGGAACTTGG 11 probe ACACTTCAGGACCCATCCAGCTTAACACTG 12

[0243] The results of the method of the present invention are shown in Table 5 and Figure 4 shown.

[0244] Table 5 Detection results of the method of the present invention

[0245] CK 100 pg / mL 10 pg / mL 1 pg / mL 0.5 pg / mL Ct 1 NoCt 27.84 30.64 33.35 34.5 Ct 2 NoCt 27.95 30.89 33.65 34.9 AVE NoCt 27.895 30.765 33.5 34.7

[0246] The results of the comparative examples are shown in Table 6 and Figure 5 shown.

[0247] Table 6 PLA test results

[0248] CK 100 pg / mL 10 pg / mL 1 pg / mL Ct 1 32.66 26.02 28.97 30.5 Ct 2 33.02 25.79 29.08 30.97 AVE 32.84 25.905 29.025 30.735

[0249] Conventional PLA detection background signals can reach around Ct32-34, and when experimental results are unsatisfactory, the signal may be stronger. Using ring detection (i.e., the method of the present invention), the experimental background (CK) can be reduced to Ct38 or even no signal, effectively reducing the impact of background on low-concentration signals and providing more stable experimental results overall. At the same time, removing the interference of background signals can achieve higher sensitivity when detecting low-abundance proteins, resulting in more accurate results in clinical diagnosis.

[0250] All documents mentioned in this application are incorporated herein by reference, just as if each document were incorporated herein by reference individually. It should also be understood that after reading the above teachings of the present invention, those skilled in the art may make various changes or modifications to the present invention, and that such equivalents also fall within the scope of the claims appended hereto.

Claims

1. An antigen detection method, characterized in that: Including steps: (s1) mixing a sample to be tested with a first antibody and a second antibody, so that the first antibody and the second antibody bind to the target antigen in the sample to be tested to form a first antibody-antigen-second antibody complex, wherein the first antibody is coupled to a first linking element, and the second antibody is coupled to a second linking element; (s2) mixing the first antibody-antigen-second antibody complex with a first loop element, a second loop element, and a ligase, such that the first linker coupled to the first antibody complements the terminal bases of the first and second loop elements to form a double-stranded structure, and the second linker coupled to the second antibody complements the other terminal bases of the first and second loop elements to form a double-stranded structure; the ligation reaction is performed in the ligation mixture; There are a first gap and a second gap of length ≤1 nt between the first ring element and the second ring element; The first gap and the second gap are connected under the action of ligase, thereby forming a circular template; (s3) cutting the linear nucleic acid under the action of an exonuclease to obtain a circular template; and (s4) performing a nucleic acid amplification reaction on the circular template, wherein the upstream primer spans the first gap, the downstream primer spans the second gap, and a probe is included to detect a signal and obtain a detection result; wherein the first loop element, the second loop element, the first connecting element, and the second connecting element are single-stranded nucleic acids; The first ring element is shown in SEQ ID NO: 3, and the second ring element is shown in SEQ ID NO: 4; The upstream primer is shown in SEQ ID NO: 5, the downstream primer is shown in SEQ ID NO: 6, and the probe is shown in SEQ ID NO: 7; The first connecting element is shown in SEQ ID NO: 1, and the second connecting element is shown in SEQ ID NO:

2.

2. The method according to claim 1, wherein In step (s4), the nucleic acid amplification reaction is PCR.

3. The method according to claim 1, wherein In step (s2), the ligation mixture includes the following components: 5-50 mM Tris-HCl, 0.1-10 mM MgCl2, 0.1-10 mM ATP and 1-100 mM DTT.

4. The method according to claim 1, wherein In step (s2), the ligation mixture includes the following components: 10-30 mM Tris-HCl, 0.5-5 mM MgCl2, 0.5-5 mM ATP and 5-50 mM DTT.

5. The method according to claim 1, wherein In step (s1), the test sample is mixed with the primary antibody and the secondary antibody in a sample incubation buffer containing a component selected from the group consisting of: 0.01% to 1% goat IgG, 0.01 to 1 mg / mL single-stranded salmon sperm DNA, 0.01% to 1% BSA, 1 to 10 mM EDTA, 0.001% to 0.1% Triton-X100, and 0.001% to 0.01% sodium azide.

6. The method according to claim 1, wherein The step (s3) is carried out in an exonuclease mixture containing components selected from the group consisting of 1-100 mM Tris-HCl, 1-50 mM MgCl2 and 0.1-10 mM DTT.

7. The method according to claim 1, wherein The sample to be tested includes a plasma sample.

8. The method according to claim 1, wherein The antigens include glial fibrillary acidic protein and / or IL-6.

9. The method according to claim 1, wherein In step (s2), the concentrations of the first ring element and the second ring element are each independently 0.01 to 300 μM.

10. The method according to claim 1, wherein In step (s4), the nucleic acid amplification reaction is selected from the group consisting of qPCR, dye-based PCR, or ddPCR.

11. The method according to claim 1, wherein In step (s2), the molar ratio of the first cyclic element to the second cyclic element is 5:1 to 1:

5.

12. The method according to claim 1, wherein In step (s2), the molar ratio of the first cyclic element to the second cyclic element is 3:1 to 1:

3.

13. The method according to claim 1, wherein In step (s2), the concentrations of the first ring element and the second ring element are each independently 0.5 to 50 μM.

14. The method according to claim 1, wherein In step (s2), the double-stranded structure is formed spontaneously at 20-50°C.

15. The method according to claim 1, wherein The ligase is selected from the group consisting of T4, T7, Ampligase, or a combination thereof.

16. An antigen detection system, characterized in that The antigen detection system comprises: (a) a first antibody and a second antibody, wherein the first antibody and the second antibody specifically bind to a target antigen, and the first antibody is coupled to a first linking element, and the second antibody is coupled to a second linking element; (b) a first annular element; (c) a second annular element; The antigen detection system also includes an upstream primer, a downstream primer and a probe; Wherein, the first ring element is shown as SEQ ID NO: 3; The second ring element is shown in SEQ ID NO: 4; The first connecting element is shown in SEQ ID NO: 1, and the second connecting element is shown in SEQ ID NO: 2; The upstream primer is shown as SEQ ID NO: 5, the downstream primer is shown as SEQ ID NO: 6, and the probe is shown as SEQ ID NO:

7.

17. An antigen detection kit, characterized in that The kit comprises: (i) a first container and a first antibody and a second antibody located in the first container, wherein the first antibody and the second antibody specifically bind to a target antigen; the first antibody is coupled to a first linker, and the second antibody is coupled to a second linker; (ii) a second container and a first annular element and a second annular element located in the second container; The kit further comprises a fifth container and an upstream primer, a downstream primer and a probe located in the fifth container; Wherein, the first ring element is shown as SEQ ID NO: 3; The second ring element is shown in SEQ ID NO: 4; The first connecting element is shown in SEQ ID NO: 1, and the second connecting element is shown in SEQ ID NO: 2; The upstream primer is shown as SEQ ID NO: 5, the downstream primer is shown as SEQ ID NO: 6, and the probe is shown as SEQ ID NO:

7.

18. The antigen detection kit according to claim 17, wherein The kit also includes (iii) a third container and a ligase located in the third container; (iv) a fourth container and an exonuclease located in the fourth container.

19. Use of the antigen detection system according to claim 16 or the antigen detection kit according to claim 17, characterized in that: Used to detect antigens in the sample to be tested.

Citation Information

Patent Citations

  • Highly specific circular proximity ligation assay

    US20190360025A1

  • Methods and kits for proximity probing

    WO2001061037A1