Application of medicaginic acid in preparation of anti-plant fungus biological source medicine

Abstract

The invention discloses application of medicagenic acid in preparation of anti-plant fungus biological source drugs, and belongs to the technical field of plant disease control. The invention reveals that the medicagenic acid has a remarkable inhibition effect on the growth of the black beancurd skin fungi, and verifies that the medicagenic acid can improve the expression of resistance genes in plants and activate the defense reaction of the plants, so that the resistance of the plants to fungi is improved. The invention provides a new drug resource and theoretical basis for developing a novel plant disease-resistant agent, fills up the vacancy of antifungal terpenoids, and provides a new thought for biological control of rot diseases in Xinjiang wild fruit forests, cultivated apple orchards and other economic fruit orchards.

Description

Technical Field

[0001] The invention relates to the technical field of plant disease prevention and control, in particular to the application of alfalfa acid in the preparation of bio-source drugs for resisting plant fungi. Background Art

[0002] Plant diseases seriously threaten agricultural production safety. Their prevention and control methods can be mainly divided into: (1) agricultural control. This includes field management methods such as germplasm screening, reasonable arrangement of tillage time, and timely weeding; (2) chemical control. At different stages of crop growth, chemical agents are applied by irrigation, spraying, etc. to kill bacteria, pests or fungi; (3) biological control. Biological control refers to the use of antagonistic microorganisms, natural enemies, etc. to inhibit the growth and reproduction of pathogens or pests, and is considered to be a more environmentally friendly disease control measure.

[0003] Malus sieversii, the ancestor of modern cultivated apples, is distributed in the Tianshan Mountains in Xinjiang. It is a national second-level protected plant and a precious relict plant of the Tertiary period. As an important global fruit, the cultivation and production of apples are closely related to the healthy development of the global agricultural economy. However, apple rot caused by the ascomycete Valsa mali and its asexual generation Cytospora mali can infect Malus sieversii and cultivated apples, causing the tree to weaken or even die. After the Valsa mali infects fruit trees, its disease pattern can be divided into two types: ulcer type and dead branch type. In the early stage of the ulcer type, reddish-brown water-soaked circular spots are formed on the main trunk. As the disease worsens, the lesion further rots, hindering the nutrient transport of the fruit tree. The dead branch type is common on small branches. After the disease occurs, the lesions are black-brown or reddish-brown irregular ring-shaped and gradually dry up.

[0004] Today, the prevention and control measures for apple rot are still relatively limited, mainly relying on field management and chemical control. Field management methods for preventing and controlling apple rot include seedling management and prevention and manual scraping of the diseased parts of fruit trees after the disease occurs. Chemical control refers to the large-scale spraying of antifungal agents such as chlorothalonil and methyl thiophanate. However, these prevention and control methods have problems such as high consumption of manpower and financial resources and excessive use of chemical agents that pollute the environment.

[0005] Natural products refer to substances extracted from animals, plants, microorganisms themselves or their secondary metabolites, including alkaloids, flavonoids, terpenes, fatty acids and other substances. Since natural products are more environmentally friendly, they have become a hot spot for the research and development of new biopesticides in recent years, among which the antibacterial potential of terpenoids has also been widely studied. There are many types of terpenoids, which are widely present in plants. Among them, pentacyclic triterpenoids have been shown to have antibacterial effects on bacteria such as Staphylococcus aureus, Streptococcus mutans, and Escherichia coli. However, the antibacterial ability of various terpenoids, including pentacyclic triterpenoids, against fungi is lacking and rarely reported. Summary of the invention

[0006] The purpose of the present invention is to provide the application of alfalfa acid in the preparation of anti-plant fungus biosource drugs to solve the problems existing in the above-mentioned prior art. The present invention reveals that alfalfa acid has a significant inhibitory effect on the growth of black rot fungus, and confirms that alfalfa acid can increase the expression of resistance genes in plants, activate the defense response of plants, and thus improve the resistance of plants to fungi. The present invention provides new drug resources and theoretical basis for the development of new plant disease resistance agents, fills the gap of antifungal terpenoid compounds, and provides new ideas for the biological control of rot diseases in Xinjiang wild fruit forests, cultivated apple orchards and other economic orchards.

[0007] To achieve the above object, the present invention provides the following solutions:

[0008] The invention provides application of alfalfa acid in preparing a biogenic drug against plant fungi, wherein the plant fungi include Cordyceps sinensis.

[0009] The invention also provides a biogenic drug for resisting plant fungi, wherein the active ingredient of the drug comprises alfalfa acid.

[0010] Optionally, the concentration of alfalfa acid in the drug is not less than 0.63 μg / mL.

[0011] Optionally, the drug further comprises a pharmaceutically acceptable carrier or excipient.

[0012] Furthermore, the plant fungus includes Sophora flavescens.

[0013] The invention also provides the use of alfalfa acid in preparing a composition for improving plant disease resistance.

[0014] Furthermore, the improving of plant disease resistance is to improve the ability of plants to resist black rot fungus.

[0015] Optionally, the plants include Xinjiang wild apple and cultivated apple.

[0016] The invention also provides a composition for improving plant disease resistance, wherein the effective component of the composition comprises alfalfa acid.

[0017] Optionally, the composition further comprises a pharmaceutically acceptable carrier or excipient.

[0018] Furthermore, the improving of plant disease resistance is to improve the ability of plants to resist black rot fungus.

[0019] The present invention discloses the following technical effects:

[0020] The present invention reveals that alfalfa acid has a significant inhibitory effect on the growth of black rot fungus, and alfalfa acid at a concentration of 0.63 μg / mL and above can significantly inhibit the growth of black rot fungus. The present invention also confirms that alfalfa acid can increase the expression of resistance genes in plants, activate the defense response of plants, and thus improve the resistance of plants to fungi. The present invention provides a new drug resource and theoretical basis for the development of new plant disease resistance agents, fills the gap in antifungal terpenoid compounds, and provides a new idea for the biological control of rot diseases in Xinjiang wild fruit forests and cultivated apple orchards. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0022] Figure 1 The results are the preliminary verification results of the ability of alfalfa acid to resist black rot fungus; A is the mycelial growth state of black rot fungus on the 7th day under the treatment of different concentrations of alfalfa acid; B is the mycelial growth curve of black rot fungus;

[0023] Figure 2 The results of the in vivo experiment on the ability of alfalfa acid to resist black rot fungus in the tissue culture seedlings of Xinjiang wild apple; A is the disease situation of the tissue culture seedlings of Xinjiang wild apple; B is the determination result of the pathogen content of the tissue culture seedlings of Xinjiang wild apple; C is the statistical result of the length of the lesions of the tissue culture seedlings of Xinjiang wild apple;

[0024] Figure 3 These are the results of quantitative detection of resistance genes in tissue culture seedlings of Xinjiang wild apple. DETAILED DESCRIPTION

[0025] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but should be understood as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0026] It should be understood that the terms described in the present invention are only for describing a particular embodiment and are not intended to limit the present invention. In addition, for the numerical range in the present invention, it should be understood that each intermediate value between the upper and lower limits of the scope is also specifically disclosed. The intermediate value in any stated value or stated range, and each smaller range between any other stated value or intermediate value in the described range is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded in the scope.

[0027] Unless otherwise indicated, all technical and scientific terms used herein have the same meanings as those generally understood by those skilled in the art. Although the present invention describes only preferred methods and materials, any methods and materials similar or equivalent to those described herein may also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of a conflict with any incorporated document, the content of this specification shall prevail.

[0028] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments of the present invention description without departing from the scope or spirit of the present invention. Other embodiments derived from the present invention description will be apparent to those skilled in the art. The present invention description and examples are exemplary only.

[0029] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0030] Medicagenic acid, a drug having a molecular formula of C 30 H 46 O6, Cas number 599-07-5, was purchased from Taoshu Biotechnology Co., Ltd. (catalog number T8167, TargetMol).

[0031] The rot pathogen strain used in the antibacterial ability experiment in the embodiment of the present invention is C. mali EGI 1, which is provided by the State Key Laboratory of Desert and Oasis Ecology of Xinjiang Institute of Ecology and Geography.

[0032] Example 1 Preliminary verification of the ability of alfalfa acid to resist black rot fungus

[0033] Preparation of alfalfa acid: Dissolve 4 mg of alfalfa acid powder in 1 mL of 0.5% dimethyl sulfoxide (DMSO) to obtain a mother solution, and then gradually dilute the highest concentration mother solution with DMSO by 2 times to 0.016 mg / mL.

[0034] Preparation of drug-containing culture medium: 500 μL of the mother solution of 9 concentrations (0.016 mg / mL, 0.031 mg / mL, 0.063 mg / mL, 0.125 mg / mL, 0.25 mg / mL, 0.5 mg / mL, 1 mg / mL, 2 mg / mL, 4 mg / mL) obtained by dilution was added to 100 mL of sterilized and slightly cooled potato dextrose agar medium (PDA) to obtain culture medium containing 0.08 μg / mL, 0.16 μg / mL, 0.31 μg / mL, 0.63 μg / mL, 1.25 μg / mL, 2.5 μg / mL, 5.0 μg / mL, 10.0 μg / mL, and 20.0 μg / mL of alfalfa acid, respectively. 15 g / L agar was added to the culture medium in advance, and the plate was poured before it solidified, with about 20 mL of culture medium poured into each culture dish. Five replicates were set for each concentration of culture medium. A negative control group with 0.5% DMSO and a wild-type control group (WT) were also set up.

[0035] Experimental process: After the plate is cooled, the mycelium surface of the rot pathogen cake (5 mm in diameter) that has grown on PDA for 5 days is attached to the center of the culture medium, and the plate is inverted for culture. After that, it is observed and photographed for 7 consecutive days, and the mycelium growth area is counted to draw the mycelium growth curve.

[0036] Results Figure 1 .from Figure 1 It can be seen that alfalfa acid can inhibit the growth of mycelium. At a concentration of 0.63 μg / mL, the mycelium growth of EGI1 was significantly inhibited. At a concentration of 5 μg / mL, alfalfa acid achieved the best inhibition on mycelium growth, and the increase in concentration no longer improved its antibacterial ability.

[0037] Example 2 In vivo experiment on the ability of alfalfa acid to resist black rot fungus in Xinjiang wild apple tissue culture seedlings

[0038] Preparation of alfalfa acid: Dissolve alfalfa acid powder in 0.5% DMSO and dilute to 5 μg / mL with sterile water.

[0039] Preparation of infected tissue culture seedlings: Cut off one-month-old Xinjiang wild apple tissue culture seedlings (plant height: 3cm) and lay them flat on moist sterilized filter paper. Use the needle attached to a disposable syringe to pierce them 10 times. Prepare the rot pathogen EGI 1 that has grown on PDA for 5 days, and attach the mycelium surface of the bacterial cake to the wound. Remove the bacterial cake after 20 hours, and the twigs have been slightly diseased.

[0040] Experimental process: The infected tissue culture seedlings were divided into 3 groups, namely: wild control group (WT): no treatment; negative control group (CK): spray 0.5% DMSO on the tissue culture seedlings, use a 15mL small spray bottle, spray each seedling 2 times each time, and spray once at a fixed time every day (24h interval); alfalfa acid treatment group (Ma+C.mali): spray alfalfa acid agent on the tissue culture seedlings, use a 15mL small spray bottle, spray each seedling 2 times each time, and spray once at a fixed time every day (24h interval). At the same time, an alfalfa acid control group (Ma) was set up: spray alfalfa acid agent on the tissue culture seedlings that were not infected with bacteria, use a 15mL small spray bottle, spray each seedling 2 times each time, and spray once at a fixed time every day (24h interval).

[0041] After the experiment started, samples were taken and photos were taken for 3 consecutive days to count the number of rot pathogens and the length of lesions. RNA was extracted from each group of tissue culture seedlings, and after reverse transcription to obtain cDNA, the relative expression levels of the classic resistance genes MsPR5, MsPR8, and MsPR10 were determined by qRT-PCR.

[0042] The primer information used in the qRT-PCR process is as follows:

[0043] MsPR5-F:CTGCACTCCGCCGAATAATA(SEQ ID NO.1);

[0044] MsPR5-R: GTCCACCACTGCAGGTAAAT (SEQ ID NO. 2);

[0045] MsPR8-F: CTGTCCCTCTTGATCCTCATTT (SEQ ID NO.3);

[0046] MsPR8-R: CATACTGGTAGTTGCCTGAGTT (SEQ ID NO.4);

[0047] MsPR10-F: CCTTTGTCCTCGATGCTGATAA (SEQ ID NO.5);

[0048] MsPR10-R: TGCTTCACGTAGCCGTATTG (SEQ ID NO. 6).

[0049] The reaction system is shown in Table 1.

[0050] Table 1 Reaction system

[0051]

[0052] The reaction program (two-step PCR amplification standard program) is: step 1: 95°C, 30 seconds; step 2: 95°C, 5 seconds; 60°C, 30 seconds; step 3: melting curve.

[0053] Results Figure 2 and Figure 3 .from Figure 2 It can be seen that alfalfa acid can inhibit the infection of rot bacteria on Xinjiang wild apple tissue culture seedlings, which is consistent with the results verified in Example 1. Spraying alfalfa acid, the length of the plaque on Xinjiang wild apple tissue culture seedlings was significantly reduced compared with the wild control (WT) and the negative control (CK), and the bacterial content was also significantly reduced compared with the wild control (WT) and the negative control (CK). Figure 3 It can be seen that after spraying only alfalfa acid, the expression levels of MsPR5, MsPR8 and MsPR10 showed an upward trend, indicating that alfalfa acid has an improving effect on the disease resistance and immunity of Xinjiang wild apple tissue culture seedlings; when rot bacteria were inoculated at the same time as spraying, the expression levels of MsPR5, MsPR8 and MsPR10 were significantly higher than those of the negative control group (CK).

[0054] The embodiments described above are only descriptions of the preferred modes of the present invention, and are not intended to limit the scope of the present invention. Without departing from the design spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by ordinary technicians in this field should all fall within the protection scope determined by the claims of the present invention.

Claims

1. The use of alfalfa acid in the preparation of anti-plant fungal biogenic drugs, characterized in that: The plant fungi include Sophora flavescens.

2. A biogenic drug for resisting plant fungi, characterized in that: The active ingredients of the medicine include alfalfa acid.

3. The drug according to claim 2, characterized in that The medicine also contains pharmaceutically acceptable carriers or excipients.

4. The drug according to claim 2, characterized in that The plant fungi include Sophora flavescens.

5. Application of alfalfa acid in preparing a composition for improving plant disease resistance.

6. The use according to claim 5, characterized in that: The improving of plant disease resistance is to improve the ability of plants to resist black rot fungus.

7. The use according to claim 6, characterized in that: The plants include Xinjiang wild apple and cultivated apple.

8. A composition for improving plant disease resistance, characterized in that: The effective ingredients of the composition include alfalfa acid.

9. The composition according to claim 8, characterized in that The composition further comprises a pharmaceutically acceptable carrier or excipient.

10. The composition according to claim 8, characterized in that The improving of plant disease resistance is to improve the ability of plants to resist black rot fungus.

Images