Traditional Chinese medicine feed additive and application thereof in partridge breeding
By adding traditional Chinese medicine feed additives composed of tangerine peel, gardenia and scutellaria baicalensis to partridge feed, the problems of the health of the intestinal tract and the quality of the quail eggs in partridge breeding were solved, and the intestinal flora and nutritional composition of the quail eggs were significantly improved.
Patent Information
- Application Number
- CN202510123760.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-01-26
- Publication Date
- 2025-04-08
AI Technical Summary
In partridge breeding, elderly partridges are prone to problems such as bad temper, less egg laying, and lower quality of eggs. There is no effective solution to the existing technology.
A traditional Chinese herbal feed additive is provided, which consists of tangerine peel, gardenia and scutellaria baicalensis. By adding it to the conventional feed of partridges, the intestinal flora of partridges is improved and the quality of the partridge egg is improved.
Significantly improve the intestinal bacterial flora of partridges, increase the abundance of probiotics such as Jeotgalibaca and Aerosphaera, reduce the abundance of harmful bacteria such as Aspergillus and Fusarium, and increase the content of taurine, protein, vitamin A, vitamin E and vitamin B2 in the eggs, significantly improve the quality of the eggs.
Smart Images
Figure CN119769615A_ABST
Abstract
Description
Technical Field
[0001] The invention relates to the technical field of poultry breeding, in particular to a traditional Chinese medicine feed additive and its application in improving intestinal flora of partridges and improving the quality of partridge eggs. Background Art
[0002] Francolinus pintadeanus is a bird of the order Galliformes, family Phasianidae, and genus Francolin. The male Francolin is 282-345mm long and weighs 292-388g; the female is 224-305mm long and weighs 255-325g. The Francolin's head is dark brown, surrounded by chestnut brown, with a wide white band extending from the eye to the ear, and the white band is inlaid with thick black lines above and below. Except for the chin and throat, the Francolin's feathers are mostly black silk, dotted with many oval white spots. The upper body is small, the lower body is slightly larger, and the lower back and waist are covered with narrow and wavy white horizontal stripes; the tail feathers are black on the lower part, and white horizontal stripes on the upper part, with a very sharp color contrast. The iris is dark brown, the beak is black, and the legs and feet are orange-yellow. Wild partridges are commonly found in open grasslands, farmlands, bushes and forest edges. They prefer sheltered areas to avoid predators, but are now less common.
[0003] Partridge has high edible and medicinal value. In the Compendium of Materia Medica written by Li Shizhen in the Ming Dynasty, it is recorded that "the southerners specialize in moxibustion food, saying that the meat is white and crispy inside, and the taste is better than chicken and pheasant". There is a folk proverb in Fujian: "People in the mountains eat partridge meat, and people in the sea eat mackerel". It can be seen that there is a habit of eating partridge in southern China for a long time. In Guangzhou, after the patients recover, they often stew partridge with adenophora, bamboo shoots, wolfberries, longan meat, etc., which is said to have a nourishing effect. The production of partridge is very large in Yongning, Chongzuo, Guiping and Bobai in Guangxi. Partridge meat is rich in protein, fat, and contains a variety of amino acids necessary for the human body and high trace elements such as zinc and strontium. It is rich in various vitamins and various minerals such as iron and potassium. It has the effects of strengthening yang, tonifying the kidney, and strengthening the body. It is a nourishing product suitable for men, women, old and young. Folks regard partridge as a good medicine for strengthening the spleen and eliminating malnutrition, and it has a significant effect in treating anorexia, emaciation, and stunted growth in children. Women who eat partridge during breastfeeding have a significant effect on promoting the physical and intellectual development of infants. It can treat anemia and eliminate eye fatigue, improve human body functions, prevent rheumatism and neuralgia, reduce inflammation and pain, reduce fever and relieve pain, nourish and nourish, eliminate age spots, make the skin smooth, treat women's dysmenorrhea and infertility, treat insomnia and neurasthenia, treat dizziness and hypertension, treat elderly asthma, prevent pregnant women from miscarriage, replenish deficiency and strengthen muscles and bones, etc.
[0004] In recent years, my country's quail farming has gradually moved towards scale and industrialization, mainly concentrated in Zhejiang, Guangxi, Guangdong, Jiangsu, Hebei, Shandong, Sichuan, Yunnan, Henan and other places. Some farms have begun to produce quails in an intensive way, mainly for quail egg production, meat production, breeding of breeding poultry and ornamental needs. The breeding methods of quails include traditional captive breeding and free-range breeding that simulates the wild environment. They mostly adopt scientific and technological management, pay attention to feed formulation, environmental factor control and breeding of breeding poultry. However, in quail farming, old quails are prone to problems such as bad temper, low egg production, and reduced egg quality, and there is currently no good solution.
[0005] Chinese herbal feed additives refer to Chinese herbal ingredients added to animal feed to enhance animal health, improve feed utilization, promote growth or prevent and treat diseases. As a green and natural feeding method, Chinese herbal feed additives have significant advantages and have gradually been widely used in China's animal husbandry. Feeds added with Chinese medicine have the advantages of enhancing animal immunity, accelerating animal growth, improving meat quality and yield, reducing the use of antibiotics, being environmentally friendly, highly safe, and having no toxic side effects. In chicken farming, the use of Chinese herbal feed additives such as astragalus and wolfberry can improve broiler immunity by 30%-40%, increase broiler growth rate by 10%-15%, increase egg production by 5%-10%, and improve eggshell quality. In pig farming, the use of Chinese herbal ingredients such as coptis chinensis, salvia miltiorrhiza, and angelica can increase the weight growth rate of pigs by 8%-12%, reduce the incidence of diarrhea in pigs by 20%-30%, and increase the feed conversion rate of pigs by 5%-8%.
[0006] However, there are no reports on the application of Chinese herbal feed additives to improve the intestinal flora of partridges and enhance the quality of partridge eggs. Summary of the invention
[0007] The purpose of the present invention is to provide a Chinese medicinal feed additive and its application in improving the intestinal flora of partridges and improving the quality of partridge eggs in view of the deficiencies of the prior art.
[0008] The first aspect of the present invention provides a traditional Chinese medicine feed additive, which is prepared from the following components in parts by weight: 5-7 parts of dried tangerine peel, 3-5 parts of gardenia, and 2-3 parts of scutellaria.
[0009] Furthermore, the Chinese medicinal feed additive is prepared from the following components in parts by weight: 5 parts of dried tangerine peel, 3 parts of gardenia, and 2 parts of scutellaria.
[0010] The Chinese medicinal feed additive of the present invention has an overall yellow-white appearance, is powdery, and has a slight aromatic smell. Figure 1 shown.
[0011] The second aspect of the present invention provides the use of the above-mentioned Chinese medicinal feed additive in improving the intestinal flora of partridges and improving the quality of partridge eggs. Specifically: (1) Mix the components according to the proportion of 5-7 parts of tangerine peel, 3-5 parts of gardenia, and 2-3 parts of scutellaria, grind them in a grinder, pass through a 40-mesh sieve, take an appropriate amount and add it to 500-700 parts of corn, 250-400 parts of barley, 200-300 parts of black beans, 50-70 parts of wheat bran, and 2-3 parts of cod liver oil. Grind them again in a grinder and mix them well according to the ratio of feed to water of 1:1; (2) Take 90 partridges of the same age and divide them into Chinese medicinal feed The additive feeding group and the control group, the Chinese medicine feed additive feeding group was fed with the Chinese medicine feed additive + conventional feed, and the control group was fed with conventional feed without Chinese medicine feed additive, and the feeding was uniformly fed at a dosage of 50 g / time / head, and the feeding frequency was 3 times / day for 3 months; (3) A certain amount of partridge feces was taken, placed in a sterile test tube, quickly cooled with liquid nitrogen, and placed in dry ice for sample delivery, and the total DNA of partridge feces was extracted using a microbial DNA kit, and ITS1-F (SEQ ID NO: 1) was used to extract the total DNA of partridge feces. The fungal sequence was amplified by primers ITS2-R (SEQ ID NO.1: CTTGGTCATTTAGAGGAAGTAA) and ITS2-R (SEQ ID NO.2: GCTGCGTTCTTCATCGATGC), and the bacterial sequence was amplified by primers 16S 338F (SEQ ID NO.3: ACTCCTACGGGAGGCAGCAG-3') and 806R (SEQ ID NO.4: GGACTACHVGGGTWTCTAAT), and high-throughput sequencing analysis was performed. The results showed that the abundance of probiotics such as Jeotgalibaca, Aerosphaera, and Candida in the intestine of partridges was significantly increased after feeding with Chinese medicinal feed, and the abundance of harmful bacteria such as Aspergillus and Fusarium was significantly reduced, and the intestinal flora of partridges was significantly improved ( Figure 2 , Figure 3 , Figure 4 ); (4) taking a number of quail eggs, determining the protein content in the quail eggs by the Kjeldahl method, determining the taurine content by the high performance liquid chromatography HPLC method, and determining the content of vitamin A, vitamin E, and vitamin B2 by ultraviolet spectrophotometry. The results showed that after feeding the Chinese medicinal feed, the content of taurine, protein, vitamin A, vitamin E, and vitamin B2 in the quail eggs was significantly increased ( Figure 5 The Chinese medicinal feed additive of the present invention has a significant improvement and enhancement effect on the intestinal flora of farmed quails and the quality of quail eggs, and brings broad application prospects for the development of the quail industry.
[0012] Furthermore, the partridge feed is made of the following components in parts by weight: 500 parts of corn, 250 parts of barley, 200 parts of black beans, 50 parts of wheat bran, and 2 parts of cod liver oil.
[0013] The present invention has the advantages that:
[0014] After feeding partridges with the traditional Chinese medicine feed additive of the present invention, the intestinal flora of partridges can be significantly improved, the abundance of probiotics such as Jeotgalibaca, Aerosphaera, Candida, etc. is significantly increased, the abundance of harmful bacteria such as Aspergillus, Fusarium, etc. is significantly reduced, and the contents of taurine, protein, vitamin A, vitamin E, and vitamin B2 in partridge eggs are increased, the quality of partridge eggs is significantly improved, and broad application prospects are brought to the development of the partridge industry. BRIEF DESCRIPTION OF THE DRAWINGS
[0015] The present invention is further described below in conjunction with the accompanying drawings and embodiments;
[0016] Figure 1 : The partridge Chinese medicinal feed additive of the present invention;
[0017] Figure 2 : The partridge feed with added traditional Chinese medicine of the present invention;
[0018] Figure 3 : Venn diagram of intestinal flora of partridges fed with Chinese herbal feed additives;
[0019] Figure 4 :PCoA diagram of intestinal flora of partridges after feeding with Chinese medicine feed additives;
[0020] Figure 5 : A bar graph showing changes in intestinal flora of partridges after feeding with Chinese medicinal feed additives;
[0021] Figure 6 : The quality of partridge eggs improved after feeding with Chinese herbal feed additives. DETAILED DESCRIPTION
[0022] In the following examples, unless otherwise indicated, % refers to volume percentage.
[0023] Embodiment 1:
[0024] The Chinese medicine feed additive for partridge is prepared according to the following steps: (1) mixing the feed components according to the ratio of 5 parts of dried tangerine peel, 3 parts of gardenia and 2 parts of scutellaria, and mixing well; (2) crushing in a grinder and passing through a 40-mesh sieve to obtain the Chinese medicine additive. Figure 1 As shown in A and B.
[0025] Embodiment 2:
[0026] 10 parts of the traditional Chinese medicine additive prepared in Example 1 were added to 500 parts of corn, 250 parts of barley, 200 parts of black beans, 50 parts of wheat bran, and 2 parts of cod liver oil according to the proportion, and the mixture was crushed again by a grinder, and mixed at a ratio of 1:1 between the mass ratio of feed and water. Figure 2 As shown; 90 partridges of the same age were taken and divided into a Chinese medicine feed additive feeding group and a control group. The Chinese medicine feed additive feeding group was fed with the Chinese medicine feed additive + conventional feed, and the control group was fed with conventional feed without Chinese medicine feed additive. The feeding was uniformly fed at an amount of 50 g / time / partridge, and the feeding frequency was 3 times / day for 3 months; some partridge feces were taken, placed in a sterile test tube, quickly cooled with liquid nitrogen, and placed in dry ice for sample delivery, and the total DNA of the partridge feces was extracted using a microbial DNA kit, and the fungal sequence was amplified using ITS1-F (SEQ ID NO.1: CTTGGTCATTTAGAGGAAGTAA) and ITS2-R (SEQ ID NO.2: GCTGCGTTCTTCATCGATGC) primers, and the 16S primers 338F (SEQ ID NO.3: ACTCCTACGGGAGGCAGCAG-3') and 806R (SEQ ID NO.4: GGACTACHVGGGTWTCTAAT) primers were used to amplify bacterial sequences and perform high-throughput sequencing analysis. The results showed that compared with the control group, the group treated with Chinese herbal additives had 14.09% of specific bacterial flora in terms of bacteria, and 39.13% of specific bacterial flora in terms of fungi, such as Figure 3 As shown in the figure, the principal coordinates analysis (PCoA) analysis (using the bary_curtis distance algorithm) showed that the samples in the Chinese medicine additive group and the control group could be clearly distinguished. For bacteria, the PC1 and PC2 coordinate values were 56.87% and 19.69%, respectively, and for fungi, the PC1 and PC2 coordinate values were 75.10% and 19.45%, respectively. Figure 4 As shown in the figure. The feeding of Chinese herbal additives significantly changed the intestinal flora structure of partridges. After feeding with Chinese herbal feed additives, the abundance of probiotics such as Jeotgalibaca and Aerosphaera in the intestinal tract of partridges was significantly increased, and the abundance of harmful bacteria such as Aspergillus and Fusarium was significantly reduced. Figure 5 As shown (test method: Kruskal-Wallis rank sum test).
[0027] Embodiment 5:
[0028] Add the Chinese medicine additive to the conventional feed according to the above method for feeding. After the feeding period is over, take some partridge eggs, break up the eggs, absorb 2g into the dry digestive tube, add 10mL of concentrated sulfuric acid, add an appropriate amount of copper sulfate, place the digestive tube on the digestion furnace and heat it, gradually increase the temperature until the sample is completely decomposed, and the solution becomes transparent light green or colorless. After complete digestion, cool to room temperature. Add an excess of 40% sodium hydroxide solution, connect the digestive tube to the distillation device, and start heating distillation. Introduce ammonia into an absorption bottle filled with boric acid solution (or other absorbents). Use 0.1mol / L hydrochloric acid to titrate the ammonium salt in the absorption solution, and record the volume of the titrated acid. The titration endpoint is indicated by the methyl red-bromocresol green mixed indicator, and the solution changes from green to gray purple. According to the titration data, the nitrogen content in the sample (%) is calculated as [(V1-V2)×C×14.01×100] / m, where V1 is the standard acid volume of the sample (mL), V2 is the standard acid volume of the blank test (mL), C is the standard acid concentration (mol / L), and m is the sample mass (g). The protein content is calculated as nitrogen content × 6.25. The protein content of the Chinese medicine additive treatment group was 15.82g / kg, and the protein content of the control group was 11.33g / kg, which increased by 39.63% ( Figure 6 A, B).
[0029] Weigh 2g of partridge eggs, add 25mL of 50% methanol solution, extract by ultrasonic at room temperature for 30min, centrifuge the extract at 10000rpm for 10min, take the supernatant, and filter with a 0.45μm filter membrane to obtain taurine extract. Prepare 10mg / mL of o-phthalaldehyde methanol solution, add appropriate amount of 2-mercaptoethanol to obtain o-phthalaldehyde derivatization reagent. Take appropriate amount of extract and o-phthalaldehyde derivatization reagent in equal proportions and let stand at room temperature for 2min. 18 (4.6mm×250mm, 5μm); mobile phase acetonitrile (A)-0.1 phosphoric acid aqueous solution (B), gradient elution (0~60min, 35%~65% A); volume flow rate 1.0mL / min; column temperature 30℃; detection wavelength 338nm chromatographic analysis, the results showed that the taurine content of the Chinese medicine feed additive group was 16.98mg / kg, which was 38.84% higher than that of the control group (12.23%). Figure 6 C. Take an appropriate amount of partridge eggs, prepare sample solutions, and use HPLC to detect the contents of vitamin A, vitamin B2, and vitamin E. The results show that after feeding with Chinese medicine additives, the contents of vitamin A, vitamin B2, and vitamin E in partridge eggs are 379.32 mg / kg, 1.26 mg / kg, and 4.89 mg / kg, respectively, which are 33.15%, 93.85%, and 31.45% higher than those in the control group (284.88 mg / kg, 0.65 mg / kg, and 3.72 mg / kg), respectively. Figure 6 As shown in EF.
[0030] The preferred embodiments of the present invention have been specifically described above, but the present invention is not limited to the embodiments. Those skilled in the art may make various equivalent modifications or substitutions without violating the spirit of the present invention. These equivalent modifications or substitutions are all included in the scope defined by the claims of this application.
Claims
1. A Chinese medicinal feed additive, characterized in that: The traditional Chinese medicine feed additive is prepared from the following components in parts by weight: 5-7 parts of dried orange peel, 3-5 parts of gardenia, and 2-3 parts of scutellaria.
2. An application of the Chinese medicinal feed additive according to claim 1, characterized in that: The traditional Chinese medicine feed additive is added into partridge feed for feeding, so as to improve the intestinal flora of the farmed partridges and improve the quality of partridge eggs.
3. The use according to claim 2, characterized in that: The Chinese medicinal feed additive improves the intestinal flora of partridges by increasing the abundance of probiotics Jeotgalibaca, Aerosphaera and Candida and reducing the abundance of harmful bacteria Aspergillus and Fusarium.
4. The use according to claim 2, characterized in that: The traditional Chinese medicine feed additive improves the quality of the partridge eggs by increasing the contents of taurine, protein, vitamin A, vitamin E and vitamin B2 in the partridge eggs.
5. The use according to claim 2, characterized in that: The partridge feed is prepared from the following components in parts by weight: 500-700 parts of corn, 250-400 parts of barley, 200-300 parts of black beans, 50-70 parts of wheat bran and 2-3 parts of cod liver oil.
6. The use according to claim 5, characterized in that: The feeding method is: feed evenly at a dosage of 50g / time / bird, and the feeding frequency is 3 times / day.