II-type fructose-1, 6-diphosphate aldolase inhibitor, pharmaceutical composition and application of II-type fructose-1, 6-diphosphate aldolase inhibitor

Abstract

The invention discloses a type II fructose-1, 6-diphosphate aldolase inhibitor, a pharmaceutical composition and application of the type II fructose-1, 6-diphosphate aldolase inhibitor, and belongs to the technical field of biological medicine. The II-type fructose-1, 6-diphosphate aldolase inhibitor provided by the invention is selected from epigallocatechin gallate, epigallocatechin, quercetin or marigold flavin, and has a good activity inhibition effect on II-type fructose-1, 6-diphosphate aldolase, the median inhibitory concentrations (IC50) of the II-type fructose-1, 6-diphosphate aldolase inhibitor are respectively 0.5136 mu M, 33.58 mu M, 4.339 mu M and 1.145 mu M, and the II-type fructose-1, 6-diphosphate aldolase inhibitor has a good activity inhibition effect on II-type fructose-1, 6-diphosphate aldolase. The compound has potential application in treatment and prevention of diseases related to 2, 6-diphosphate aldolase activity. Meanwhile, when the compound is combined with a common antifungal drug for use, the compound shows a good synergistic inhibition effect on drug-resistant candida albicans, and is beneficial to improving the problems of strong toxic and side effects and large drug resistance of the traditional antifungal drug.

Description

Technical Field

[0001] The present invention relates to the field of biomedicine technology, and in particular to a type II fructose-1,6-bisphosphate aldolase inhibitor, a pharmaceutical composition and application thereof. Background Art

[0002] The information disclosed in the background of the invention is only intended to enhance the understanding of the overall background of the invention and should not be necessarily regarded as an acknowledgment or any form of suggestion that the information constitutes the prior art already known to a person skilled in the art.

[0003] Fructose-1,6-bisphosphate aldolase (FBA) is widely present in various organisms, such as bacteria, higher plants and animals. It is an essential enzyme involved in carbohydrate metabolism, including gluconeogenesis, glycolysis and the Calvin-Benson cycle (CBC). It catalyzes the reversible cleavage of fructose-1,6-bisphosphate (FBP) into glyceraldehyde-3-phosphate (GAP) and dihydroxyacetone phosphate (DHAP), thereby providing ATP and other substrates for organisms.

[0004] FBAs can be divided into two categories based on their catalytic mechanism and evolutionary origin. Type I fructose-1,6-bisphosphate aldolase (FBA-I) utilizes lysine residues to generate Schiff base intermediates, and its activity can be inhibited by hydrogen boron. FBA-I is mainly found in higher plants and animals, and has two isoforms with different subcellular locations: chloroplast / plastid FBA (CpFBA) and cytosolic FBA (cFBA). CpFBA catalyzes the condensation reaction of FBP and heptaheptanone-1,7-bisphosphate, while cFBA plays an important role in glycolysis and gluconeogenesis. Type II fructose-1,6-bisphosphate aldolase (FBA-II) is mainly found in lower organisms such as bacteria, fungi and algae, and requires divalent metal cations (usually Zn 2+ ) as a cofactor to stabilize the carbonate intermediate formed by the substrate within the active site, and therefore, the activity of FBA-II is competitively inhibited by the metal ion chelator EDTA. FBA-I and FBA-II have the same overall fold and catalyze the same overall reaction, but they do not share any significant sequence homology or common catalytic residues.

[0005] Because fungal FAB enzymes are type II, different from mammalian cell FAB-I, and FAB is an enzyme essential for fungal survival, the development and screening of new FBA-II inhibitors is of great significance for the development of new antifungal drugs with high efficiency and low toxicity. Summary of the invention

[0006] In view of this, the present invention provides a type II fructose-1,6-bisphosphate aldolase inhibitor, a pharmaceutical composition and its application. The present invention screens out compounds with high FBA-II inhibitory activity and successfully applies them in combination with conventional antifungal drugs, which can reduce the dosage of conventional antifungal drugs and improve problems such as high drug resistance.

[0007] In a first aspect, the present invention provides a type II fructose-1,6-bisphosphate aldolase inhibitor, wherein the type I fructose-1,6-bisphosphate aldolase inhibitor is selected from epigallocatechin gallate, epigallocatechin, quercetin or tagetin.

[0008] In a second aspect, the present invention provides use of the above-mentioned type II fructose-1,6-bisphosphate aldolase inhibitor in the preparation of a drug for inhibiting the activity of type I fructose-1,6-bisphosphate aldolase.

[0009] In a third aspect, the present invention provides use of the above-mentioned type II fructose-1,6-bisphosphate aldolase inhibitor in the preparation of a medicament for treating or preventing a disease associated with type I fructose-1,6-bisphosphate aldolase activity.

[0010] In a fourth aspect, the present invention provides a pharmaceutical composition comprising the above-mentioned type II fructose-1,6-bisphosphate aldolase inhibitor and an antifungal drug.

[0011] Preferably, the antifungal drug comprises one or more of fluconazole, amphotericin B or terbinafine.

[0012] Furthermore, the mass ratio of the type II fructose-1,6-bisphosphate aldolase inhibitor to the antifungal drug is (1:8) to (20:1).

[0013] Preferably, the dosage form of the pharmaceutical composition includes effervescent tablets, suppositories, ointments, creams, gels, paints or lotions.

[0014] Preferably, in the pharmaceutical composition, the concentration of the type II fructose-1,6-bisphosphate aldolase inhibitor is 0.25 to 64 μg / mL.

[0015] In a fifth aspect, the present invention provides use of the above-mentioned pharmaceutical composition in the preparation of drugs against drug-resistant Candida albicans.

[0016] Preferably, the drug-resistant Candida albicans is fluconazole-resistant Candida albicans.

[0017] Compared with the prior art, the present invention has achieved the following beneficial effects:

[0018] (1) The present invention found that epigallocatechin gallate (EGCG), epigallocatechin (EGC), quercetin and quercetagetin have a good inhibitory effect on the activity of type II fructose-1,6-bisphosphate aldolase, and their half inhibitory concentration (IC 50 ) were 0.5136 μM, 33.58 μM, 4.339 μM and 1.145 μM, respectively, and can be used as a type II fructose-1,6-bisphosphate aldolase inhibitor, and has potential applications in the treatment and prevention of diseases related to type I fructose-1,6-bisphosphate aldolase activity.

[0019] (2) The pharmaceutical composition of the present invention combines a type II fructose-1,6-bisphosphate aldolase inhibitor with a commonly used antifungal drug, which can not only significantly enhance the inhibitory effect on drug-resistant Candida albicans, but also effectively reduce the usage of the two, thus playing a significant synergistic role and having a strong inhibitory effect, which is beneficial to improving the problems of strong toxic side effects and high drug resistance of traditional antifungal drugs. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] The drawings constituting part of the present invention are used to provide a further understanding of the present invention. The exemplary embodiments of the present invention and their description are used to explain the present invention and do not constitute an improper limitation of the present invention. Obviously, for those skilled in the art, other drawings can be obtained based on these drawings without creative work.

[0021] Figure 1 The SDS-PAGE analysis of FBA1 protein expression in Example 1 of the present invention;

[0022] Figure 2 1 is the inhibition curve of EGCG, EGC, quercetin and tagetes yellow on the activity of recombinant FBA1 in Example 1 of the present invention; wherein (a) is EGCG, (b) is EGC, (c) is quercetin, and (d) is tagetes yellow;

[0023] Figure 3 is the expression level of the gene after FBA1 knockout or low expression in Example 1 of the present invention;

[0024] Figure 4 is the growth curve of the SN152 strain and the FBA1 / fba1Δ strain after adding EGCG in Example 1 of the present invention;

[0025] Figure 5 1 is the growth curve of the SN152 strain and the FBA1 / fba1Δ strain after adding TEB in Example 1 of the present invention. DETAILED DESCRIPTION

[0026] It should be noted that the following detailed descriptions are exemplary and are intended to provide further explanation of the present invention. Unless otherwise specified, all technical and scientific terms used herein have the same meanings as those commonly understood by those skilled in the art to which the present invention belongs.

[0027] The technical solution of the present invention is further described below in conjunction with specific embodiments.

[0028] In the following examples, the strain sources and culture medium are as follows:

[0029] 1. Strains

[0030] Candida albicans SC5314 was kindly donated by Shandong Qianfoshan Hospital, and G5, Gu5, and DSY296 were kindly donated by the University of Würzburg, Germany.

[0031] Candida albicans SN152 and plasmid pSN52 were donated by the School of Pharmacy of the Second Military Medical University. Plasmid pSN52 carries the HIS selection marker.

[0032] Candida auris CBS12774, CBS12776, CBS14918, and CBS15108 were kindly donated by Dr. Fang Wenjie from the Second Military Medical University of the Chinese People's Liberation Army.

[0033] 2. Culture medium

[0034] 1) YPD liquid medium:

[0035] Peptone 8g, glucose 8g, yeast starch 4g, add triple distilled water to make up to 400mL, sterilize by high pressure (121℃, 20min), and store at 4℃ for later use.

[0036] 2) YPD solid medium:

[0037] Peptone 8g, glucose 8g, yeast starch 4g, agar 8g, add triple-distilled water to make up to 400mL, sterilize by high pressure (121℃, 20min), and store at 4℃ for later use.

[0038] 3) RPMI 1640 liquid medium:

[0039] RPMI 1640 solid powder 10g, NaHCO3 2.0g, morpholinepropanesulfonic acid 34.5g, add triple distilled water 900mL to dissolve, 1M NaOH to adjust pH to 7.0 (25℃), triple distilled water to 1000mL, filter through 0.22μm microporous filter membrane for sterilization, and store at 4℃ for later use.

[0040] 4) LB solid medium:

[0041] LB medium powder 10g, agar 8g, add triple distilled water to make up to 400mL, autoclave (121℃, 20min) and store at 4℃ for later use.

[0042] 5) LB liquid medium:

[0043] LB medium powder 10g, add triple distilled water to make up to 400mL, autoclave (121℃, 20min) and store at 4℃ for later use.

[0044] 6)SD solid medium:

[0045] 0.67% yeast nitrogen base, 0.5% (NH4)2SO4, 0.136% mixed amino acid powder and 2% glucose. Glucose was placed in a separate container, and the other components were placed in another container, and sterilized and mixed according to the YPD liquid medium method.

[0046] Example 1

[0047] (A) Heterologous expression of FBA1 protein

[0048] 1. Main reagents: Reverse transcription kit and high-fidelity polymerase were purchased from Toyobo, Japan; nucleic acid gel recovery kit was purchased from Omega Biotechnology, USA; restriction endonucleases XhoⅠ and EcoRⅠ of plasmid mini-extraction kit, seamless cloning ligase and Taq polymerase were purchased from TakaRa Biotechnology; other reagents were domestically produced or imported analytical grade reagents.

[0049] 2. Experimental methods:

[0050] DNA of Candida albicans SC5314 was extracted and used as a template for amplifying the target gene (fructose-1,6-bisphosphate aldolase in Candida albicans is abbreviated as FBA1 below, which is type II fructose-1,6-bisphosphate aldolase, and the corresponding gene is abbreviated as FBA1). The target gene FBA1 was amplified by PCR using the specific primers shown below.

[0051] Upstream primer:

[0052] GCCATGGCTGATATCGGATCCGAATTCATGGCTCCTCCAGCAGTTTT;

[0053] Downstream primer:

[0054] GTGGTGGTGGTGCTCGAGTGCGTTACAATTGTCCTTTAGTGTGGAAA.

[0055] The pET32a vector was double-digested with XhoⅠ and EcoRⅠ, and the target gene was inserted into the pET32a vector using DNA ligase to construct a recombinant plasmid. The ligation product was transformed into E. coli competent cells, and positive clones were obtained by antibiotic screening. Positive clones containing the inserted target gene were screened, and further sequencing was performed to verify whether the insertion sequence of the target gene was correct. After sequencing was correct, it was transferred to BL21 competent cells for subsequent protein expression.

[0056] Pick the positive clones, inoculate them into LB medium containing ampicillin, and culture them at 37°C with shaking until OD600 reaches 0.6-0.8. Add IPTG (isopropyl β-D-1-thiogalactoside) to a final concentration of 0.5mM and continue to culture at 16°C for 16 hours. After the induction expression is completed, collect the bacterial cells by centrifugation.

[0057] The cells were lysed by ultrasonication and protease inhibitors were added. Cell debris was removed by centrifugation and the supernatant containing the recombinant protein was collected. The recombinant protein was purified by Ni-NTA affinity chromatography and the target protein was eluted using different concentrations of Imidazole. The expressed and purified protein (recombinant FBA1 protein) was detected by SDS-PAGE.

[0058] 3. Experimental results: The positive clones were induced by the above-mentioned induction method and then identified by SDS-PAGE. Figure 1 As shown, after IPTG induction, the expression product showed an obvious protein band at the relative molecular weight of 39KDa.

[0059] (II) FBA1 enzyme activity test

[0060] 1. Reagents: Epigallocatechin gallate (EGCG), (-)-epigallocatechin (EGC), quercetin and quercetagetin (also known as quercetin) were purchased from Shanghai Taoshu Biotechnology Co., Ltd.

[0061] 2. Experimental methods:

[0062] Fructose-1,6-bisphosphate aldolase (FBA) catalyzes fructose 1,6-bisphosphate to produce 3-phosphoglyceraldehyde and dihydroxyacetone phosphate, and catalyzes NADH and dihydroxyacetone phosphate to produce NAD and α-glycerol phosphate under the action of triosephosphate isomerase and α-glycerol phosphate dehydrogenase. The change of absorbance at 340nm can reflect the activity of fructose-1,6-bisphosphate aldolase.

[0063] The inhibitory activities of EGCG, EGC, quercetin and quercetagetin on FBA1 were determined by the following method.

[0064] Preheat the microplate reader for more than 30 minutes, adjust the wavelength to 340nm, and adjust the distilled water to zero. Add 100μL fructose-1,6-bisphosphate, 20μL rabbit muscle glycerol 3-phosphate dehydrogenase (GPDH), 20μL rabbit muscle triosephosphate isomerase (TIM), 20μL potassium acetate buffer, 20μL recombinant FBA1 protein in step (I), and 20μL inhibitor (EGCG, EGC, quercetin or marigold yellow) to the 96-well plate, mix thoroughly, and measure the absorbance value A1 at 10s at 340nm, quickly place it in a 25℃ water bath for 5min, take it out and quickly wipe it dry to measure the absorbance value A2 at 310s. In the control group, replace the sample with distilled water, and measure A1 and A2 in the same way, which are recorded as A1 blank and A2 blank. Calculate ΔA assay tube = A1 assay - A2 assay, ΔA blank tube = A1 blank - A2 blank, ΔA = ΔA assay tube - ΔA blank tube.

[0065] FBA enzyme activity (U / mL) = ΔA ÷ (ε × d) × 10 9 ×V 反总 ÷V 样 ÷T=321.54×ΔA

[0066] In the above formula, V 反总 is the total volume of the reaction system, 2×10 -4 L; ε: NADH molar extinction coefficient, 6.22×10 3 L·mol -1 cm -1 ; d: 96-well UV plate light path, 0.6 cm; V 样 : added sample volume, 0.02mL; T: reaction time, 5min; 10 9 : Unit conversion factor, 1mol = 10 9 nmol.

[0067] 3. Experimental results:

[0068] The results are as follows Figure 2 As shown in the results, epigallocatechin gallate (EGCG), (-)-epigallocatechin (EGC), quercetin, and quercetagetin directly inhibited the activity of recombinant FBA1, with a half inhibitory concentration (IC 50) were 0.5136μM, 33.58μM, 4.339μM, and 1.145μM, respectively, among which EGCG expressed relatively stronger inhibitory activity compared with the other substances.

[0069] (III) Knockout of FBA1 gene

[0070] 1. Primers: Primers were designed by Primer Premier 5 software and sent to Sangon Biotech (Shanghai) Co., Ltd. for synthesis.

[0071] 2. DNA extraction of strains: The SN152 strain was cultured overnight in YPD medium, the cells were collected, washed once with sterile water, and DNA was extracted using the yeast genome extraction kit.

[0072] 3. Plasmid transformation and extraction: Use the calcium chloride method to transform plasmids pSN40 and pSN52 into the prepared competent DH5α, and evenly spread the bacterial solution on the LB medium containing ampicillin for overnight incubation. Use an inoculation loop to pick up a monoclonal colony on the plate and inoculate it into the LB culture medium containing ampicillin, culture it overnight, and extract the plasmid according to the instructions of the UNIQ-10 column plasmid small-scale extraction kit.

[0073] 4. Construction of gene knockout components:

[0074] Using SN152 strain DNA as a template, Primer 1 (GACCTGAATTCACAGGATCAG) and Primer 3 (cacggcgcgcctagcagcggGTATGGTGGTGGTGCTAATC) were used as primers to amplify the upstream fragment up of the FBA1 gene coding region, and Primer 4 (gtcagcggccgcatccctgcCACAGAACTCGCCAAGATATCT) and Primer 6 (TTAATCACAGGTGATGGTGAT) were used as primers to amplify the downstream fragment down, and the pSN52 plasmid was used as a template to amplify the screening marker HIS fragment. The PCR products of the above three fragments were subjected to 1% agarose gel electrophoresis and purified and recovered according to the instructions of the Biomiga kit. The purified PCR products up, HIS, and down were mixed, and used as a template, Primer 1 and Primer 6 were used as primers to perform a fusion PCR reaction to obtain the homologous knockout component up-HIS-down. Transfect the homologous knockout assembly up-HIS-down into SN152 using the lithium acetate transfection method, spread the bacterial solution evenly on the SD-HIS selective medium with a sterile glass rod, culture at 30°C for 48 hours, pick a single clone and culture it in YPD medium overnight, and extract genomic DNA. Identify whether the first homologous recombination fragment is correctly inserted into the location of the target gene. Identify the correct FBA1+ / - strain.

[0075] Since the FBA1 gene is an essential gene and cannot be knocked out, the two copies were regulated by the low-copy promoter CYC1, and then fluorescent quantitative PCR was used to detect the expression levels of the two copies of FBA1.

[0076] 5. Experimental results: Using the auxotrophic strain SN152, the FBA1 single-copy knockout strain FBA1 / fba1Δ was constructed through the strategy of nutritional label screening. After regulating the second copy (fba1Δ / CYC1P-FBA1) with the low promoter CYC1, the expression level of FBA1 was detected by fluorescent quantitative PCR with the SN152 strain as the control. Figure 3 As shown, the FBA1 expression levels in the FBA1 single-copy knockout strain FBA1 / fba1Δ and the strain with the second copy regulated by low promoter CYC1 (fba1Δ / CYC1P-FBA1) were significantly decreased.

[0077] (IV) Survival dynamics after FBA1 gene knockdown

[0078] 1. Experimental method: Dilute the overnight cultured SN152 and FBA1 / fba1Δ to 1×10 6CFU / mL. Take 100μL of cell suspension and add it to a 96-well plate. Set the concentrations of EGCG and terbinafine (TEB) to 16, 8, and 4μg / mL and set up a blank control group, with three parallels in each group. Place the 96-well plate in an ELISA instrument and set up the kinetic run program: set the incubation temperature to 30℃, measure the OD600 value of each well every 30min, and measure for a total of 12h. Draw a growth curve with time as the horizontal axis and OD600 as the vertical axis.

[0079] 2. Experimental results: The growth curves of SN152 strain and FBA1 / fba1Δ strain after adding EGCG are shown in Figure 4 The growth curves of the SN152 strain and the FBA1 / fba1Δ strain after adding TEB are shown in Figure 5 As shown, it can be seen that after FBA1 gene knockdown, the strain became more sensitive after adding EGCG and TEB compared with the control SN152.

[0080] Example 2 Antifungal Activity Test

[0081] 1. Experimental methods

[0082] (1) Antifungal activity determination method:

[0083] According to the M27-A3 document of the Clinical and Laboratory Standards Institute (CLSI), the minimum inhibitory concentration (MIC80) of EGCG, EGC, quercetin and quercetagetin against different fungal strains was determined by microbroth dilution method. The fungal strains were activated from the seed tubes to YPD solid plates by streaking method, and the activation was repeated at least once to ensure the viability of the strains. Single clones were picked from the activated plates and placed in 1 mL YPD liquid medium, and cultured in a shaker at 30 ° C and 200 rpm for 12 hours until they grew to the logarithmic phase. The experimental strains growing in the logarithmic phase were collected by centrifugation and the culture medium was washed with PBS buffer. The OD value was measured by spectrophotometer to determine the cell density and diluted to 1×10 with RPMI 1640 medium. 3 cells / mL. Add the bacterial solution to a 96-well sterile microplate, add the drug to be tested by two-fold dilution method and mix thoroughly, use the group without drug as negative control, use terbinafine (TEB) or fluconazole (FLC) as positive control, and use only RPMI1640 medium as blank control well, with three parallels for each group. Place the well plate in a 35℃ incubator for 24h, and use the naked eye to determine the results. The lowest drug concentration that can inhibit 80% fungal growth is the final result MIC80 value.

[0084] (2) Drug combination trials

[0085] The experimental strains growing in the logarithmic phase were collected by centrifugation and the culture medium was washed with PBS buffer. The OD value was measured by a spectrophotometer to determine the cell density and the cells were diluted to 1×10 with RPMI1640 medium. 3 cells / mL, and the diluted bacterial solution was used to prepare working solutions of FBA1 enzyme inhibitors (EGCG, EGC, quercetin and marigold yellow), terbinafine (TEB) or fluconazole (FLC) with different drug concentration gradients. In a 96-well plate, different concentrations of FBA1 enzyme inhibitor working solutions were set in columns 1-11, and different concentrations of TEB or FLC working solutions were added to the wells in rows AG, and blank bacterial solutions were added to the wells in columns 12 and H of the 96-well plate. The well plate was placed in a 35℃ incubator for 24 hours, and the OD value of each well was detected at a wavelength of 600nm. The control well was a blank well without drug addition. The growth rate of each well = the value of the drug-added well / the control well × 100%, the growth rate of the control well was 100%, and the drug concentration of the well whose absorbance decreased by 80% compared with the control well was identified as the MIC. The combined inhibition index (FICI) was calculated and analyzed to determine whether there was a synergistic effect between the drugs. When FICI ≤ 0.5, the interaction was considered synergistic (SYN), when FICI > 0.5 and ≤ 1, it was considered additive (ADD), and when FICI > 1, it was considered no interaction (IND).

[0086] 2. Experimental results:

[0087] The antibacterial effects of EGCG, EGC, quercetin and quercetagetin alone or in combination with terbinafine (TEB) or fluconazole (FLC) on different fungi (including various Candida albicans and multi-drug resistant Candida auris) are shown in Tables 1, 2, 3 and 4, respectively.

[0088] Table 1 Antibacterial effects of EGCG and terbinafine alone or in combination

[0089]

[0090] Table 2 Antibacterial effects of EGC and terbinafine alone or in combination

[0091]

[0092]

[0093] Table 3 Antibacterial effects of quercetin and terbinafine or fluconazole alone or in combination

[0094]

[0095] Table 4 Antibacterial effect of marigold yellow pigment and terbinafine or fluconazole alone or in combination

[0096]

[0097]

[0098] As can be seen from Tables 1 to 4, FBA1 enzyme inhibitors (EGCG, EGC, quercetin and marigold yellow) have good antibacterial effects on various azole-resistant strains and Candida auris. EGCG has the best antibacterial effect. When combined with terbinafine, the FICI of SC5314 can reach 0.06299. There is a significant combined effect on the resistant bacteria G5 with high expression of efflux pump MDR1, Gu5 and DSY296 with high expression of efflux pump CDR, and Candida auris resistant bacteria.

[0099] Example 3 Cytotoxicity Test

[0100] 1. Drug testing

[0101] FBA1 inhibitors (EGCG, EGC, quercetin and tagetin) were stored at -20°C. Before the experiment, they were dissolved in DMSO to a 10 mM stock solution.

[0102] 2. Cell lines

[0103] HEK293 human embryonic kidney cells

[0104] RAW 264.7 mouse peritoneal macrophages

[0105] HUVEC human umbilical artery epithelial cells

[0106] 3. Experimental methods

[0107] The cells in the logarithmic growth phase were digested with trypsin and the cell suspension was collected in a sterile centrifuge tube. The cell density was adjusted to 5×10 4 cells / mL were inoculated in 96-well plates and incubated overnight to allow the cells to adhere. The supernatant was replaced with fresh 1640 medium containing different concentrations of FBA1 inhibitors. The 96-well plates were placed in an incubator at 37°C and 5% CO2 for 24 hours without FBA1 inhibitors as a negative control. After incubation, the cell morphology was observed, and 10 μL of 5 mg / mL MTT solution was added to each well. After 4 hours, the supernatant was discarded, 100 μL DMSO was added to each well and mixed, and the absorbance at 490 nm was measured using a microplate reader.

[0108] 4. Experimental results: The results are shown in Table 5. It can be seen from Table 5 that EGCG, EGC, quercetin and tagetin all showed good low cytotoxic properties to HEK293, RAW264.7 and HUVEC.

[0109] Table 5 The half inhibitory concentration (IC) of FBA1 inhibitors on different cell lines 50 )Test Results

[0110]

[0111] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. For those skilled in the art, the present invention may have various modifications and variations. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included in the protection scope of the present invention.

Claims

1. A type II fructose-1,6-bisphosphate aldolase inhibitor, characterized in that: The type II fructose-1,6-bisphosphate aldolase inhibitor is selected from epigallocatechin gallate, epigallocatechin, quercetin or tagetin.

2. Use of the type II fructose-1,6-bisphosphate aldolase inhibitor according to claim 1 in the preparation of a drug for inhibiting the activity of type II fructose-1,6-bisphosphate aldolase.

3. Use of the type II fructose-1,6-bisphosphate aldolase inhibitor according to claim 1 in the preparation of a medicament for treating or preventing a disease associated with type II fructose-1,6-bisphosphate aldolase activity.

4. A pharmaceutical composition, characterized in that These include the above-mentioned type II fructose-1,6-bisphosphate aldolase inhibitors and antifungal drugs.

5. The pharmaceutical composition according to claim 1, characterized in that The antifungal drugs include one or more of fluconazole, amphotericin B or terbinafine.

6. The pharmaceutical composition according to claim 1, characterized in that The mass ratio of the type II fructose-1,6-bisphosphate aldolase inhibitor to the antifungal drug is (1:8) to (20:1).

7. The pharmaceutical composition according to claim 1, characterized in that The dosage form of the pharmaceutical composition includes effervescent tablets, suppositories, ointments, creams, gels, paints or lotions.

8. The pharmaceutical composition according to claim 1, characterized in that In the pharmaceutical composition, the concentration of the type II fructose-1,6-bisphosphate aldolase inhibitor is 0.25-64 μg / mL.

9. Use of the pharmaceutical composition according to any one of claims 1 to 8 in the preparation of a drug against drug-resistant Candida albicans.

10. The use according to claim 9, characterized in that The drug-resistant Candida albicans is fluconazole-resistant Candida albicans.

Images