Application of lycorine in preparation of toxoplasma gondii infection resisting medicine and / or feed additive

Abstract

The invention belongs to the technical field of biological medicines, and discloses application of lycorine in resisting toxoplasma gondii infection. The invention finds that the safe concentration of lycorine to cells is not more than 0.6 [mu] mol / L, and the safe dose of lycorine can effectively inhibit invasion and proliferation of toxoplasma gondii to host cells and the activity of toxoplasma gondii bodies; the in-vivo safe dose of lycorine (20mg / kg) can reduce the lung insect-bearing amount of mice infected with the RH strain toxoplasma gondii, the pathological injury of the organs of the mice is relieved, the survival time of the mice is prolonged, and the survival rate can reach 80%. Therefore, the lycorine can be used for preparing drugs or feed additives for resisting toxoplasma gondii infection, has the advantages of being small in dosage and good in effect, provides a new way for effective utilization of the lycorine, and can effectively solve the problems of toxic and side effects and drug resistance of existing drugs for resisting toxoplasma gondii infection.

Description

Technical Field

[0001] The invention belongs to the technical field of biomedicine, and in particular to application of lycorine in the preparation of anti-toxoplasma infection drugs and / or feed additives. Background Art

[0002] Toxoplasma gondii (T. gondii) is an obligate intracellular, foodborne, opportunistic parasite that can infect a wide range of nucleated cells in warm-blooded animals, causing toxoplasmosis. Toxoplasma infection is prevalent worldwide, posing a serious threat to human health, the economic benefits of animal husbandry, and public health safety.

[0003] At present, there is no toxoplasmosis vaccine on the market. The commonly used anti-Toxoplasmosis drugs are pyrimethamine and sulfadiazine. However, these two drugs have low cure rates, long treatment courses, large toxic side effects, and are prone to drug resistance. Therefore, there is an urgent need to develop a new drug that is safe and effective against Toxoplasmosis infection, or to develop anti-Toxoplasmosis drugs by adopting the "new uses for old drugs" approach.

[0004] Lycorine is a natural active ingredient extracted from the bulbs of Lycoris plants. In recent years, with the continuous in-depth research, it has been found that lycorine has a variety of pharmacological effects, such as anti-tumor, anti-viral, anti-inflammatory and anti-parasitic. In addition, it can also inhibit acetylcholinesterase and topoisomerase, inhibit ascorbic acid biosynthesis, and control the length of the circadian rhythm cycle. As a natural active ingredient, lycorine has low toxicity and mild side effects, suggesting that lycorine has the potential to be a candidate drug for clinical use.

[0005] Through searching, no reports on the effect of lycorine on Toxoplasma gondii infection have been found. Summary of the invention

[0006] The purpose of the present invention is to overcome the shortcomings of the prior art and provide an application of lycorine in the preparation of anti-Toxoplasma infection drugs and / or feed additives.

[0007] The technical solution adopted by the present invention to solve its technical problem is:

[0008] Application of lycorine as a single active ingredient in the preparation of drugs and / or feed additives for resisting toxoplasma infection.

[0009] Furthermore, the in vitro anti-Toxoplasma drug concentration of the lycorine is 0.6 μmol / L, and the in vivo drug concentration is 20 mg / kg.

[0010] Furthermore, the anti-Toxoplasma includes Toxoplasma gondii.

[0011] Furthermore, the anti-Toxoplasma effect is manifested in at least one of the following aspects: inhibiting the invasion of Toxoplasma, reducing the proliferation of Toxoplasma, reducing the vitality of Toxoplasma, reducing the lung load, alleviating pathological damage to organs, prolonging survival time and increasing survival rate.

[0012] Furthermore, the drug against Toxoplasma infection is a drug that kills Toxoplasma parasites in humans or non-human animals; the feed additive is an additive in the diet of non-human animals.

[0013] The advantages and positive effects achieved by the present invention are:

[0014] 1. The effective drug concentration of lycorine in vitro against Toxoplasma gondii screened out by the present invention within the safe concentration range is 0.6 μmol / L. Specifically, the killing effect of lycorine on Toxoplasma gondii is enhanced in a dose-dependent manner, and 0.6 μmol / L of lycorine can achieve the effect of completely killing Toxoplasma gondii, and the toxicity of lycorine is relatively low. The present invention has opened up a new way for the effective utilization and development of lycorine, and has improved its application potential and market prospects.

[0015] 2. The present invention has proved through experiments that lycorine can inhibit the invasion of Toxoplasma gondii into host cells. Specifically, after Toxoplasma gondii is treated with 0.6 μmol / L lycorine solution for 2h, 4h, and 6h, the invasion rate of Toxoplasma gondii into host cells is less than 50%, and increases in a time-dependent manner. This indicates that lycorine can be used to treat or prevent Toxoplasma infection.

[0016] 3. The present invention has proved through experiments that lycorine can inhibit the proliferation of Toxoplasma gondii in host cells. Specifically, when cells infected with Toxoplasma gondii were treated with 0.4 μmol / L lycorine solution, the number of Toxoplasma tachyzoites did not increase significantly. This once again proves that lycorine can be used to control the proliferation of Toxoplasma gondii after infection.

[0017] 4. The present invention has found that the treatment of infected mice with lycorine can prolong the survival time of mice, reduce the amount of parasites in the lungs, and alleviate pathological damage to organs. Specifically, the dose of lycorine not exceeding 20 mg / kg for mice is a safe dose, and after the 20 mg / kg dose of lycorine was used to treat mice infected with the RH strain of Toxoplasma gondii, the survival time of the mice was significantly prolonged, and the protection rate reached 80%; the amount of parasites in the lung tissues of mice on the 7th day of infection was extremely significantly reduced, and the pathological damage of various tissues was slight. It shows that lycorine can be used to prepare new drugs or feed additives for resisting Toxoplasma infection. The drug for resisting Toxoplasma infection is: a drug that kills Toxoplasma parasites in humans or non-human animals; the feed additive is: an additive in the daily diet of non-human animals.

[0018] 5. The present invention found that the safe concentration of lycorine for cells is no more than 0.6 μmol / L. A safe dose of lycorine can effectively inhibit the invasion and proliferation of Toxoplasma gondii to host cells, as well as the vitality of the parasite. A safe dose of lycorine (20 mg / kg) in vivo can reduce the lung load of mice infected with RH strain Toxoplasma gondii, reduce the pathological damage of mouse organs, prolong the survival time of mice and the survival rate can reach 80%. Therefore, lycorine can be used as a drug or feed additive for preparing anti-Toxoplasma infection, with the advantages of small dosage and good effect, providing a new way for the effective use of lycorine, and can effectively solve the toxic side effects and drug resistance problems of current anti-Toxoplasma drugs. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 The toxicity diagram of different concentrations of lycorine on different cells in the present invention;

[0020] Figure 2 The plaque analysis diagram of the Toxoplasma gondii inhibition activity of Lycorine at different concentrations in the present invention;

[0021] Figure 3 The figure is an analysis diagram of the inhibition of Toxoplasma gondii invasion in vitro by Lycorine in the present invention; wherein A is a figure showing the Toxoplasma gondii plaque results after different time periods of Lycorine action, and B is a figure showing the Toxoplasma gondii invasion rate analysis results;

[0022] Figure 4 This is an analysis diagram of the effect of lycorine on inhibiting the proliferation of Toxoplasma gondii in the present invention;

[0023] Figure 5 This is a biochemical index detection diagram of mice given intragastric administration of different doses of lycorine in the present invention;

[0024] Figure 6 The diagram is a test chart of the worm load in the organs of mice infected with Toxoplasma gondii treated with Lycorine in the present invention; wherein A is the worm load in the liver tissue of the mouse; B is the worm load in the lung tissue of the mouse; C is the worm load in the kidney tissue of the mouse; and D is the worm load in the brain tissue of the mouse;

[0025] Figure 7 This is a histopathological observation diagram of mouse organs in the present invention;

[0026] Figure 8 This is a survival curve of mice infected with Toxoplasma gondii treated with lycorine in the present invention. DETAILED DESCRIPTION

[0027] The present invention will be further described below in conjunction with the embodiments. The following embodiments are descriptive rather than restrictive, and the protection scope of the present invention cannot be limited by the following embodiments.

[0028] The various experimental operations involved in the specific embodiments are all routine techniques in the art. For parts not specially annotated in this document, ordinary technicians in the art can implement them by referring to various commonly used reference books, scientific and technological literature or related instructions, manuals, etc. before the filing date of this invention.

[0029] The lycorine standard product (HPLC≥98%) used in the present invention was purchased from Beijing Solebow Company, and the quality of each substance is the conventional quality; the Toxoplasma gondii used in the implementation case is the standard strong strain of Toxoplasma gondii (RH strain).

[0030] Application of lycorine as a single active ingredient in the preparation of drugs and / or feed additives for resisting toxoplasma infection.

[0031] Preferably, the in vitro anti-Toxoplasma drug concentration of lycorine is 0.6 μmol / L, and the in vivo drug concentration is 20 mg / kg.

[0032] Preferably, the anti-Toxoplasma vaccine includes Toxoplasma gondii.

[0033] Preferably, the anti-Toxoplasma effect is manifested in at least one of the following aspects: inhibiting the invasion of Toxoplasma, reducing the proliferation of Toxoplasma, reducing the activity of Toxoplasma, reducing the lung load, alleviating pathological damage to organs, prolonging the survival time and increasing the survival rate.

[0034] Preferably, the anti-Toxoplasma infection drug is a drug that kills Toxoplasma parasites in humans or non-human animals; the feed additive is an additive in the diet of non-human animals.

[0035] Specifically, the relevant preparation and detection are as follows:

[0036] 1 Method

[0037] 1.1 Analysis of the toxicity of different concentrations of lycorine to Toxoplasma gondii invading host cells

[0038] Vero cells were cultured at a rate of 1×10 3 100 μL / well was added to a 96-well plate, and the cells were cultured in a CO2 incubator until the confluence was 60% to 70%; the solution was discarded, and 100 μL of lycorine solution was added at concentrations of 0, 0.2, 0.4, 0.6, 0.8, and 1 μmol / L. Four replicates were set for each group, and four blank wells were set up. They were incubated at 37°C in a 5% CO2 incubator for 12 hours. 10 μL of CCK-8 solution (CCK-8 kit) was added to each well, incubated in the above incubator for 0.5 hours, the absorbance value was detected at 450nm, and the cell viability was calculated according to the instructions. The effect of lycorine on the viability of macrophages RAW264.7 and HEK293A cells was detected by the same method.

[0039] 1.2 Analysis of the inhibitory effect of lycorine on Toxoplasma gondii activity

[0040] Vero cells were plated in 6-well plates. When the cells grew to about 90%, the medium was changed to DMEM containing 2% fetal bovine serum. Each well was inoculated with 1×10 4 100 μL of RH strain of Toxoplasma gondii with a concentration of 0, 0.2, 0.4, and 0.6 μmol / L were added; the cells were treated with lycorine solution with a concentration of 0, 0.2, 0.4, and 0.6 μmol / L, respectively, with 3 replicates in each group; after culturing for 7 days, the worm bodies were washed away with 1×PBS, and 1mL of 4% fixative solution was added to each well to fix the plaques, and after standing at room temperature for 30 minutes, they were washed with 1×PBS, and 1mL of 0.2% crystal violet solution was added to each well, and stained in the dark for 30 minutes; then washed with 1×PBS, dried at room temperature, and the number and size of worm plaques in each group were observed and counted.

[0041] 1.3 Analysis of the inhibitory effect of lycorine on the invasion of Toxoplasma gondii

[0042] Vero cells were plated on 6-well plates and cultured for 12 hours until the cell confluence reached about 90%; Toxoplasma RH tachyzoites were cultured and collected, purified and counted; 1 mL of the above parasite suspension (500) and 1 mL of 1.2 μmol / L lycorine solution were added to centrifuge tubes; the parasites without drug addition were negative controls, and 3 replicates were set for each. The 6 tubes of parasites were inoculated for 2, 4, and 6 hours respectively, the culture medium was discarded, and the incubated parasites were added to the Vero cell culture wells for culture; after 4 hours of culture, the culture medium was discarded, the parasites that did not invade the cells were washed with 1×PBS, and DMEM containing 2% FBS was added to the incubator for continued culture for 7 days; the culture medium in the above culture wells was discarded, washed twice with 1×PBS, and stained with crystal violet; photographed and the number of plaques was counted; the parasite invasion rate was calculated according to the formula (invasion rate = number of infected cells / 500×100%).

[0043] 1.4 Analysis of the inhibitory effect of lycorine on Toxoplasma gondii proliferation

[0044] Vero cells were plated into 12-well plates and cultured for 12 h until the cell confluence reached about 90%. The cell culture medium was discarded and 2 mL of 2 × 10 4 The 12-well plate was placed in an incubator and cultured for 4 hours, after which the culture medium was discarded and the non-invaded parasites were washed away with 1×PBS. A 0.6 μmol / L lycorine solution was added to the experimental group, and a fresh DMEM culture medium containing 2% FBS was added to the control group, and the culture was continued; the cells in the wells were scraped at 0, 8, 16, 24, 32, 40, and 48 hours, and the cells were repeatedly blown and aspirated 5 times with a 5 mL syringe until the cells were broken, the total DNA was extracted, and the parasite load was measured by fluorescence quantitative method.

[0045] 1.5 Analysis of toxicity of lycorine to mice

[0046] Twenty-four BALB / c mice were randomly divided into 4 groups, with 6 mice in each group. They were given 0, 5, 10, and 20 mg / kg lycorine by gavage for 7 days. The mouse serum was collected and the liver function indicators (ALT and AST) and renal function indicators (CRE and URE) in the mouse serum were detected by blood biochemical analyzer. The changes in the indicators in the blood of mice among the groups were statistically analyzed to evaluate the damage and toxic effects of lycorine on various organs.

[0047] 1.6 Detection of parasite load in organs of mice infected with Toxoplasma gondii

[0048] Mice infected with 500 tachyzoites of Toxoplasma were treated with daily oral administration of 20 mg / kg lycorine. On the 7th day, 3 mice were taken from each group. 30 mg of each of the three different parts of the liver, lung, kidney and brain of each mouse were taken and homogenized. The total DNA of the tissue was extracted using a tissue genomic DNA extraction kit. The highly conserved B1 gene partial sequence of the RH strain of Toxoplasma was amplified by fluorescent quantitative PCR to detect the load of Toxoplasma in the tissue samples. The average value of three different parts of the same tissue was a repeated data. The upstream primer B1-F: GGAACTGCATCCGTTCATGAG, the downstream primer B1-R: TCTTTAAAGCGTTCGTGGTC, the expected amplified fragment length was 194 bp, and the real-time quantitative fluorescent PCR amplification conditions were: 95℃ pre-denaturation for 10 min, {95℃ pre-denaturation for 10 s, 60℃ annealing for 20 s, 72℃ extension for 15 s} for a total of 40 cycles.

[0049] 1.7 Histopathological observation of mouse organs

[0050] On the 7th day, the heart, liver, spleen, lung and kidney of mice were taken out and quickly fixed with 10% formalin for 48 hours. The tissue sections were prepared by trimming, washing, dehydrating, transparentizing, wax dipping, embedding, slicing, spreading, fishing, baking, HE staining, transparentizing and sealing the fixed tissues. The sections were observed and images were collected under an optical microscope.

[0051] 1.8 Analysis of the therapeutic effect of lycorine on mice infected with Toxoplasma gondii

[0052] Forty healthy BALB / c female mice were selected and randomly divided into four groups, namely, blank control group, 20 mg / kg lycorine control group, Toxoplasma gondii infection model group and 20 mg / kg lycorine treatment group. The mice in the model group and the treatment group were intraperitoneally injected with 500 tachyzoites. After 4 hours of infection, the mice in the lycorine control group and the treatment group were gavaged with 20 mg / kg lycorine. The blank control group and the model group were gavaged with the same amount of sterile saline, which was recorded as the first day, and the day before infection was the 0th day. Subsequently, the mice were given the drug once a day at the same time from the 2nd to the 7th day. The drinking water and feeding conditions, mental state and survival time of the mice were observed every day. The mice that did not die were continuously observed until the 21st day, and the survival curve of the mice was recorded and drawn.

[0053] 1.9 Statistical analysis

[0054] GraphPad Prism 7.0 was used for statistical analysis and drawing, and T test was used to analyze the toxicity of lycorine to cells, the inhibitory effects on worm vitality, worm invasion ability, and proliferation ability, as well as the toxicity of lycorine to mouse organs, tissue load, and survival curve differences. **: P<0.01, extremely significant difference; *: P<0.05, significant difference; P>0.05, insignificant difference.

[0055] 2 Results

[0056] 2.1 Analysis of toxicity of different concentrations of lycorine on different cells

[0057] In the range of 0-1 μmol / L, lycorine solution had no significant effect on the activity of HEK293A and RAW264.7 cells (P>0.05); within 0.6 μmol / L (inclusive), there was no significant effect on the toxicity of Vero cells (P>0.05), and lycorine at a concentration of more than 0.8 μmol / L significantly (P<0.01) reduced the activity of Vero cells ( Figure 1 ). The results showed that the safe drug concentration range of lycorine for cells in vitro is 0-0.6μmol / L.

[0058] 2.2 Lycorine can inhibit the activity of Toxoplasma gondii in vitro

[0059] In order to further screen the effective concentration of lycorine against Toxoplasma gondii, a concentration gradient was set to conduct plaque experiments. The results showed that with the increase of concentration (0-0.4 μmol / L), the inhibition of Toxoplasma gondii activity by lycorine increased in a dose-dependent manner, and the number and size of plaques gradually decreased ( Figure 2 ); When the concentration of lycorine reached 0.6μmol / L, no Toxoplasma plaques were found, and the inhibition rate of Toxoplasma reached 100% ( Figure 2). The results showed that 0.6 μmol / L lycorine was a safe and effective concentration for anti-Toxoplasma gondii in vitro.

[0060] 2.3 Lycorine inhibits the ability of Toxoplasma gondii to invade host cells

[0061] In order to analyze the inhibitory effect of lycorine on the invasion of Toxoplasma gondii, the inhibition of Toxoplasma gondii invasion by lycorine was analyzed. The results showed that after the Toxoplasma tachyzoites were treated with 0.6 μmol / L lycorine solution for 2, 4, and 6 hours, the number of plaques was significantly reduced, and the invasion rate of Toxoplasma gondii gradually decreased with the extension of the treatment time of lycorine solution ( Figure 3 A and 3B); Whether it was 2h, 4h or 6h, the invasion rate of Toxoplasma gondii in the lycorine-treated group was lower than 50%, and was significantly lower than that in the control group (P<0.01; Figure 3 B) The results suggest that lycorine has a significant inhibitory effect on Toxoplasma gondii invasion of host cells.

[0062] 2.4 Lycorine inhibits the proliferation of Toxoplasma gondii in vitro

[0063] To analyze the effect of lycorine on the proliferation of Toxoplasma gondii, the number of Toxoplasma gondii was detected by fluorescence quantitative PCR. Figure 4 As shown, 8 hours after Toxoplasma infection, the number of Toxoplasma tachyzoites in the control group cells was significantly increased (P<0.01) compared with the number of tachyzoites in the lycorine solution-treated group cells, and the number of tachyzoites in the lycorine solution-treated group cells did not increase significantly. The results show that lycorine can inhibit the proliferation of Toxoplasma in host cells.

[0064] 2.5 Determination of safe dose of lycorine in mice

[0065] In order to further clarify the safe dose of lycorine for mice, the safety of different doses of lycorine for mice was evaluated. The results showed that there were no obvious abnormalities in the drinking water and food intake, mental state, weight changes, and organ tissues of mice gavaged with 0, 5, 10, and 20 mg / kg lycorine solution, and no deaths occurred. In addition, compared with the control group mice, there were no significant differences in the ALT, AST, CRE, and URE indicators in the serum of the mice treated with lycorine solution in the experimental group (P>0.05; Figure 5 ). The results showed that 5, 10, and 20 mg / kg of lycorine were safe doses for mice.

[0066] 2.6 Detection of organ load of Toxoplasma gondii in mice infected with Lycorine

[0067] In order to detect the number of worms in the mice treated with lycorine, the worm load in the liver, lung, kidney and brain of the mice was tested on the 7th day. The results showed that there was no significant difference in the worm load in the liver, kidney and brain of the mice treated with lycorine (P>0.05; Figure 6 A, 6C and 6D), but the load of worms in the lung was significantly reduced (P < 0.01; Figure 6 B). The results showed that lycorine could significantly reduce the amount of parasites in the lung tissue of mice.

[0068] 2.7 Histopathological analysis of lycorine-treated mice infected with Toxoplasma gondii

[0069] In order to further evaluate the effect of lycorine on reducing the damage of Toxoplasma gondii to host organ tissues, pathological histological analysis was performed. Figure 7 As shown in the figure, on the 7th day of infection, the heart of mice in the control group of the toxoplasma infection model showed obvious congestion and congestion; in the liver, the nuclei of hepatocytes collapsed and disappeared, the inflammatory cells increased significantly, the cells of the central vein wall necrotized and fell off, and the sinusoids were filled with a large number of red blood cells; the number of lymphocytes in the spleen decreased significantly, and some lymphocytes were necrotic and the white pulp disappeared; the interstitial tissue of the lungs widened, the alveoli were filled with red blood cells and serous fluid, and inflammatory cells infiltrated; some glomeruli in the kidneys atrophied, necrotic, and hemorrhaged, with a large number of inflammatory cells infiltrating, and the lumen of some distal convoluted tubules was filled with serous fluid. The white pulp structure of the spleen of mice in the lycorine treatment group was not obvious, and no serious pathological damage was found in other organs and tissues. The results show that lycorine can reduce the damage of toxoplasma infection to organ tissues.

[0070] 2.8 Survival of mice infected with Toxoplasma gondii treated with lycorine

[0071] To evaluate the therapeutic effect of lycorine on Toxoplasma gondii-infected mice, the survival of mice was analyzed. Figure 8 As shown, no abnormalities were found in the blank control group and the lycorine control group mice, and no death occurred; the mice in the Toxoplasma infection model group began to die on the 7th day after infection, and all died on the 9th day; while the mice in the lycorine treatment group began to die on the 14th day, and the protection rate reached 80%; compared with the control group mice, lycorine significantly (P<0.01) prolonged the survival time and increased the survival rate of mice. The results show that lycorine has a good therapeutic effect on acute infection of Toxoplasma gondii. It also suggests that lycorine in mice may reduce and delay the damage of Toxoplasma to the host.

[0072] Although the embodiments of the present invention are disclosed for illustrative purposes, those skilled in the art will appreciate that various substitutions, changes and modifications are possible without departing from the spirit and scope of the present invention and the appended claims. Therefore, the scope of the present invention is not limited to the contents disclosed in the embodiments.

Claims

1. The use of lycorine as a single active ingredient in the preparation of drugs and / or feed additives for resisting toxoplasma infection.

2. The use according to claim 1, characterized in that: The in vitro anti-Toxoplasma drug concentration of the lycorine is 0.6 μmol / L, and the in vivo drug concentration is 20 mg / kg.

3. The use according to claim 1, characterized in that: The anti-Toxoplasma include Toxoplasma gondii.

4. The use according to claim 1, characterized in that: The anti-Toxoplasma effect is manifested in at least one of the following aspects: inhibiting the invasion of Toxoplasma, reducing the proliferation of Toxoplasma, reducing the activity of Toxoplasma, reducing the parasite load in the lungs, alleviating pathological damage to organs, prolonging the survival time and increasing the survival rate.

5. The use according to any one of claims 1 to 4, characterized in that: The drug against Toxoplasma infection is a drug that kills Toxoplasma parasites in humans or non-human animals; the feed additive is an additive in the diet of non-human animals.

Images