Application of a STAT1 inhibitor in the preparation of a drug for treating metabolic fatty hepatitis

Abstract

The present invention relates to the use of a STAT1 inhibitor in the preparation of a drug for treating metabolic fatty hepatitis. The STAT1 inhibitor uses the transcription factor STAT1 as a target for the treatment of metabolic fatty hepatitis, inhibits abnormal differentiation of MAIT cells and the release of proinflammatory factors by downregulating the expression of STAT1, thereby reducing liver lipid deposition and fibrosis, and has a significant effect in treating metabolic fatty hepatitis. The present invention provides a new targeted drug option for the treatment of MASH.

Description

Technical Field

[0001] The present invention relates to the field of biomedical technology, and more specifically to an application of a STAT1 inhibitor in the preparation of a drug for treating metabolic fatty hepatitis. Background Art

[0002] Metabolic Dysfunction-Associated Steatotic Liver Disease (MASLD), formerly known as nonalcoholic fatty liver disease (NAFLD), is a liver disease associated with metabolic dysfunction. According to global epidemiological studies, the average prevalence of MASLD is about 30%, affecting nearly one-third of the population in Asia. The prevalence of MASLD has increased significantly in China, now reaching 32.3% (References 1 and 2). The increasing prevalence of obesity and metabolic syndrome is accelerating the prevalence of MASLD, and MASLD can progress to metabolic steatohepatitis (MASH) and even cirrhosis or hepatocellular carcinoma (HCC). Its progression is associated with an increased long-term risk of various extrahepatic cancers (References 3-5). Among them, MASH is a severe stage of MASLD, mainly manifested by hepatic steatosis, inflammation and fibrosis. If not treated in time, it can further develop into cirrhosis and even liver cancer, increasing the risk of liver failure and liver cancer. At present, the drugs used in clinical treatment of MASH include hypoglycemic drugs such as metformin and thiazolidinediones, lipid-lowering drugs such as atorvastatin and fenofibrate, and hepatoprotective and anti-inflammatory drugs such as vitamin E and silymarin. However, the existing drugs for the treatment of MASH have the following problems:

[0003] Limited applicable population: Some glucose-lowering drugs used to treat MASH may not be suitable for non-diabetic patients or people with normal blood sugar levels;

[0004] Adverse reactions: Some drugs can cause adverse reactions, such as certain drugs that regulate blood lipids. While lowering blood lipids, they may also cause liver dysfunction, gastrointestinal discomfort and other symptoms;

[0005] Limited efficacy: Some drugs may be effective in improving liver steatosis and inflammation, but it is difficult to completely restore liver histology to normal, such as vitamin E.

[0006] The pathogenesis of MASH is complex, including fatty acid accumulation, insulin resistance, and changes in immune cell homeostasis. These factors interact with each other and promote lipid accumulation and inflammation (References 6-7). Although studies have shown that liver immune cells show functional diversity and functional changes during the progression of the disease, which directly affects the severity of MASH (Reference 8), liver immune cells, including CD8+ T cells, CD4 + The molecular mechanism by which immune cell dysfunction affects the progression of MASH, such as T cells, NKT cells, and MAIT cell subsets, is still unclear. Therefore, studying the effects of immune cells on MASH is conducive to exploring the molecular mechanism of MASH progression and finding potential therapeutic targets for MASH.

[0007] References:

[0008] 1. Liu J, Tian Y, Fu

[0009] 2. Younossi Z, Anstee QM, Marietti M, Hardy T, Henry L, Eslam M, George J, Bugianesi E: Global burden of NAFLD and NASH: trends, predictions, risk factors and prevention. Nat Rev Gastroenterol Hepatol 2018,15(1):11-20.

[0010] 3.Lee KC, Wu PS, Lin HC: Pathogenesis and treatment of non-alcoholicsteatohepatitis and its fibrosis. Clin Mol Hepatol 2023, 29(1):77-98.

[0011] 4. Shiha G, Korenjak M, Eskridge W, Casanovas T, Velez-Moller P, Hogstrom S, Richardson B, Munoz C, Sigurethardottir S, Coulibaly A et al: Redefining fatty liver disease: an international patient perspective. Lancet Gastroenterol Hepatol 2021, 6(1): 73-79.

[0012] 5. Mantovani A, Petracca G, Beatrice G, Csermely A, Tilg H, Byrne CD, Targher G: Non-alcoholic fatty liver disease and increased risk of incident extrahepatic cancers: a meta-analysis of observational cohort studies. Gut 2022, 71(4): 778-788.

[0013] 6. Friedman SL, Neuschwander-Tetri BA, Rinella M, Sanyal AJ: Mechanisms of NAFLD development and therapeutic strategies. Nat Med 2018, 24(7): 908-922.

[0014] 7. Mehta H, Lett MJ, Klenerman P, Filipowicz Sinnreich M: MAIT cells in liver inflammation and fibrosis. Seminars In Immunopathology 2022, 44(4): 429-444.

[0015] 8. Huby T, Gautier EL: Immune cell-mediated features of non-alcoholic steatohepatitis. Nat Rev Immunol 2022, 22(7): 429-443. Summary of the Invention

[0016] In view of the above defects or improvement needs of the prior art, the present invention provides an application of a STAT1 inhibitor in the preparation of a drug for treating metabolic fatty hepatitis, the purpose of which is to find that MAIT cells are significantly enriched in both peripheral blood and liver of MASH patients, and the transcription factor STAT1 is highly expressed in MASH patients, and its up-regulation promotes the enrichment of MAIT cells. STAT1 can be used as a potential target for the treatment of MASH, thereby solving the technical problem of the lack of existing drugs for the treatment of MASH at the molecular level.

[0017] To achieve the above objective, according to one aspect of the present invention, a use of a STAT1 inhibitor in the preparation of a drug for treating metabolic fatty hepatitis is provided.

[0018] Preferably, the STAT1 inhibitor is used in the preparation of a drug for treating metabolic fatty hepatitis caused by up-regulation of transcription factor STAT1 expression promoting MAIT cell enrichment.

[0019] Preferably, in the application, the STAT1 inhibitor in the drug for treating metabolic fatty hepatitis is Nifuroxazide, LL-K8-22 or Fludarabine.

[0020] Preferably, in the application, the STAT1 inhibitor in the drug for treating metabolic fatty hepatitis is Fludarabine.

[0021] Preferably, in the application, the dosage of Fludarabine in the drug for treating metabolic fatty hepatitis is 0.12-0.15 mg / kg for adults.

[0022] According to another aspect of the present invention, a drug for treating metabolic fatty hepatitis is provided, wherein the active ingredient of the drug comprises a STAT1 inhibitor.

[0023] Preferably, the STAT1 inhibitor in the drug is Nifuroxazide, LL-K8-22 or Fludarabine.

[0024] Preferably, the STAT1 inhibitor in the drug is Fludarabine.

[0025] Preferably, the drug is in the form of an injection preparation or an oral preparation.

[0026] Preferably, the drug further comprises a pharmaceutically acceptable excipient.

[0027] In general, compared with the prior art, the above technical solutions conceived by the present invention can achieve the following

[0028] Beneficial effects:

[0029] The present invention found that mucosa-associated invariant T cells (MAIT cells) were significantly enriched in the peripheral blood and liver of MASH patients, and their differentiation process was closely related to the expression of transcription factor STAT1. The experimental results showed that STAT1 can be used as an important potential target for the treatment of MASH. The results of animal experiments and clinical patient verification showed that STAT1 inhibitors can significantly reduce the level of inflammation and fibrosis in the liver of MASH model mice, and improve the expression of inflammatory factors in the peripheral blood of patients. STAT1 inhibitors can be used to prepare drugs for the treatment of metabolic fatty hepatitis. They can reduce liver lipid deposition and fibrosis by downregulating the expression of STAT1, inhibiting the abnormal differentiation of MAIT cells and the release of proinflammatory factors, and have a significant effect in treating MASH. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] Figure 1 It is a schematic diagram of the overall experimental process (left) and drug mechanism analysis (right);

[0031] Figure 2 It is the identification and validation of immune cells and T cell subsets in peripheral blood mononuclear cells (PBMCs) of healthy controls (HC) and MASH patients; Figure 2 A, B, and C are the results of differential analysis of 7 major immune cell populations in HC and MASH patients, D and E are the distribution of T cell subsets, F is the results of differential analysis of T cell subsets between HC and MASH groups, G and H are the results of FCM analysis, I is the immunohistochemical analysis of ex vivo liver tissues of MASH and HC groups (n=5 vs 5), and J is a schematic diagram of the overall experimental process of Example 1;

[0032] Figure 3 The results of the difference analysis of the proportion of major immune cells in HC and MASH patients;

[0033] Figure 4 A and B are the immunohistochemical staining results of liver tissue sections in the MASH and HC groups (n=5vs5), and C, D, and E are the differential analysis results of STAT1, T cells, and MAIT cells in the MASH and HC groups;

[0034] Figure 5A is the GSVA analysis result of MAIT cells, B is the intersection analysis of differential genes between groups of MAIT cells, transcription factor regulatory genes and INTERFERON_GAMMA_RESPONSE pathway genes, C is the pseudo-time series analysis result, D is the result of interaction between different cell types, E is the visualization analysis result of cell communication related to IFN-γ pathway, F is the qRT-PCR analysis result of peripheral blood of MASH and HC groups (n=6vs 6), G is the immunofluorescence staining analysis result of liver tissue (n=3vs 3);

[0035] Figure 6 A is a schematic diagram of the animal model experimental process, B is the results of H&E, Oil Red O staining and MASSON staining of the three groups of HC, MASH and MASH + STAT1 inhibitor, C is the results of liver immunofluorescence staining of the three groups of HC, MASH and MASH + STAT1 inhibitor, D is the results of Western blot analysis of the three groups of HC, MASH and MASH + STAT1 inhibitor, E is the results of differential analysis of the expression levels of inflammatory factors such as GzmB, IFN-γ, IL-17, IL-22 in the serum of the three groups of mice;

[0036] Figure 7 A is a schematic diagram of the in vivo experimental process of the HC group and the MASH group (n=6 vs 6), B is the difference analysis results of the protein expression levels of p-STAT1, T-bet and RORγt in PBMCs of donors in the HC and MASH groups, C is the qRT-PCR analysis results of donors in the HC and MASH groups, D is the enzyme-linked immunosorbent assay results, E is a schematic diagram of the in vitro experimental process, F is the WB analysis results on the third day, and G is the ELISA analysis results on the third day. DETAILED DESCRIPTION

[0037] In order to further explain the technical means and effects adopted by the present invention to achieve the predetermined invention purpose, the specific implementation mode, structure, characteristics and effects of the present invention are described in detail below in combination with the accompanying drawings and preferred embodiments.

[0038] Mucosal-associated invariant T cells (MAIT cells) are innate-like T lymphocytes involved in antimicrobial immunity. They are mainly enriched in mucosal and liver tissues and have strong cytotoxic activity. Mature MAIT cells are divided into MAIT1 (T-bet + ) and MAIT17(RORγt +) sublineage, which can secrete a variety of proinflammatory cytokines such as IFN-γ, TNF-α, IL-17A, IL-22, etc., but the number and expression factors of MAIT under different causes of hepatitis are significantly different. For example, the study published by Kishi H et al. in the article "Increased Number of Mucosal-Associated Invariant TCells Is Associated with the Inhibition of Nonalcoholic Fatty Liver Disease in High Fat Diet-Fed Mice" showed that mice lacking MAIT cells in the fatty liver mouse model had more severe liver steatosis and inflammation, while the study published by Mabire M et al. in the article "MAIT cell inhibition promotes liver fibrosis regression via macrophage phenotype reprogramming" showed that inhibiting MAIT cell activation in mice and macrophage fibrosis models can prevent the process of fibrosis and promote the regression of fibrosis. However, it is not clear whether MAIT cells have an effect on the progression of MASH.

[0039] The present invention is based on a cohort of 3690 patients with metabolic-associated fatty liver disease (MAFLD) and conducted an in-depth study on it. After matching the demographic information, peripheral blood mononuclear cells (PBMCs) of the MASH group and the HC group (n=4vs4) were selected, and 68,466 cells were analyzed by single-cell RNA sequencing (scRNA-seq), successfully identifying 7 immune cell populations including T cells, NK cells, B cells, plasma cells, classical monocytes, non-classical monocytes and platelets, but the proportion of T cells in the MASH group and the HC group was not statistically significant.

[0040] T cell subsets were further subdivided into 10 subtypes, including CD4-Tcm, CD4-Tem, CD4-Tn, CD4-Treg, CD8-Teff, CD8-Tem, CD8-Tn, GDT, MAIT, and NKT. The results showed that MAIT cells were significantly enriched in the MASH group. The sample size was expanded to the MASH group and the HC group (n=24 vs 25) for flow cytometry verification of peripheral blood PBMCs, and the liver tissue samples of the MASH group and the HC group (n=5 vs 5) were verified by immunohistochemistry. The results showed that MAIT cells were significantly enriched in the peripheral blood and liver of MASH patients, confirming the results of scRNA-seq.

[0041] In order to explore the molecular mechanism of the influence of MAIT cells on MASH, the present invention performed GSVA analysis on MAIT cells and found that the gene expression profiles between the MASH group and the HC group were statistically significant, and there were significant differences between the two, especially in the expression of inflammatory factors. In order to further clarify the key factors in the fate regulation of MAIT, the present invention took the intersection of the intergroup differential genes, transcription factor regulatory genes and INTERFERON_GAMMA_RESPONSE pathway genes of MAIT cells, and found that STAT1 was a highly expressed transcription factor in MASH. Pseudo-time series analysis of MAIT cells showed that with cell differentiation, the enrichment of STAT1 in MAIT cells of the MASH group increased significantly, indicating the key role of STAT1 in MAIT cell differentiation. And the cell communication of IFN-γ-related pathways was visualized and analyzed. The results showed that IFN-γ promoted the expression of STAT1 and induced MAIT cell differentiation, suggesting that STAT1 is a potential target for MASH intervention.

[0042] By constructing a MASH mouse model and treating it with STAT1 inhibitors, the results showed that after treatment with STAT1 inhibitors, lipid deposition in the liver of mice in the MASH model group was significantly reduced, and the degree of liver fibrosis in mice was significantly reduced, which had a therapeutic effect on MASH mice. Further mechanism studies have shown that STAT1 inhibitors regulate the differentiation and development of MAIT cells by negatively regulating the expression of STAT1 and inhibiting the expression of T-bet and RORγt, thereby inhibiting the secretion of inflammatory factors and alleviating the pathological manifestations of MASH in mice. This has been verified in vivo and in vitro in MASH patients, indicating that STAT1 is a potential target for the treatment of MASH, and STAT1 inhibitors can be used to prepare drugs for the treatment of MASH.

[0043] Based on this, the present invention proposes the use of a STAT1 inhibitor in the preparation of a drug for treating metabolic fatty hepatitis. In the present invention, a STAT1 inhibitor is a class of compounds used to inhibit the expression of the transcription factor STAT1; it can inhibit the abnormal differentiation of MAIT cells and the release of proinflammatory factors by downregulating the expression of STAT1, thereby reducing liver lipid deposition and fibrosis.

[0044] The STAT1 inhibitor is used to prepare a drug for treating metabolic fatty hepatitis caused by up-regulation of transcription factor STAT1 expression promoting MAIT cell enrichment.

[0045] The STAT1 inhibitors in the drugs for treating metabolic fatty hepatitis described in the present invention include Nifuroxazide, LL-K8-22 or Fludarabine, which are used to inhibit the activity of intracellular transcription factor STAT1, thereby inhibiting the differentiation and enrichment of MAIT cells.

[0046] Preferred are inhibitors that specifically inhibit STAT1 activity, such as Fludarabine. In the prior art, Fludarabine is a chemotherapy drug used to treat certain types of cancer, such as chronic lymphocytic leukemia, but no relevant research has been found in the treatment of MASH.

[0047] The dosage of Fludarabine in the drug for treating metabolic fatty liver disease is 0.12-0.15 mg / kg for adults. In some embodiments, the dosage of Fludarabine in the drug for treating metabolic fatty liver disease is 0.12-0.13 mg / kg for adults.

[0048] In addition, the present invention also provides a drug for treating metabolic fatty hepatitis, wherein the active ingredient of the drug includes a STAT1 inhibitor.

[0049] In the present invention, the STAT1 inhibitor is Nifuroxazide, LL-K8-22 or Fludarabine, preferably Fludarabine.

[0050] The dosage form of the drug includes an injection preparation or an oral preparation; preferably, the drug also includes a pharmaceutically acceptable excipient.

[0051] The following are examples

[0052] MAFLD patients who visited the outpatient and inpatient departments of the Department of Gastroenterology of the First Affiliated Hospital of Kunming Medical University from January 2020 to December 2023 were included in this study with the informed consent of the subjects and approval of the Ethics Committee of the First Affiliated Hospital of Kunming Medical University (Ethics Number: 2020-L-08). A MAFLD cohort covering 3690 patients was constructed, including a spectrum of diseases such as metabolic-associated fatty liver (MAFL), MASH, MASH-related cirrhosis, and liver cancer, of which 174 were MASH patients. This study included MASH patients and healthy controls HC based on gender and age matching, and collected their clinical information, peripheral blood, and liver tissue for research.

[0053] Based on the CAP and LSM values ​​quantified by FibroScan (502model, Echosens, France), we determined the inclusion criteria for MASH (CAP ≥ 238 dB / m, LSM ≥ 6.6 kPa.) and HC (CAP < 238 dB / m, LSM < 6.6 kPa.). The specific grading of liver steatosis is as follows: no steatosis is CAP < 238 dB / m, mild steatosis is 238 dB / m ≤ CAP ≤ 258 dB / m, moderate steatosis is 258 dB / m < CAP ≤ 291 dB / m, and severe steatosis is CAP > 291 dB / m. At the same time, the degree of liver fibrosis is classified into: no liver fibrosis F0 <6.6 kPa, mild liver fibrosis F1 = 6.6-8.0 kPa, significant liver fibrosis F2 = 8.0-11.0 kPa, advanced liver fibrosis F3 = 11.0-15.0 kPa, and cirrhosis F4 ≥ 15.0 kPa.

[0054] Exclusion criteria include the following:

[0055] ① Fatty liver caused by specific diseases such as viral hepatitis, drug-induced liver disease, total parenteral nutrition, hepatolenticular degeneration, autoimmune liver disease, etc.;

[0056] ② The patient has a pacemaker installed in the body, an unhealed wound in the right upper abdomen, or ascites;

[0057] ③ Suffering from severe liver disease, kidney disease, heart disease, brain disease or malignant tumor.

[0058] The detailed information of the 102 HC and 174 MASH patients included in this study is shown in Table 1 .

[0059] Table 1 General clinical data analysis of HC and MASH

[0060]

[0061]

[0062] Note: The values ​​in the table are expressed as mean ± standard error (SEM), P values ​​are from chi-square test and independent sample t-test, and P values ​​less than 0.05 are indicated in bold; HC denotes healthy control; MASH denotes metabolic-associated steatohepatitis, the same below.

[0063] like Figure 1The schematic diagram of the experimental process shown in the middle left shows that by combining single-cell sequencing, peripheral blood flow cytometry and immunohistochemical staining of liver tissue sections, we found that MAIT cells in the peripheral blood and liver of MASH patients increased significantly, and qRT-PCR and WB analysis revealed a significant correlation between STAT1 expression and MAIT cell proliferation, and based on animal models, using STAT1 inhibitors to inhibit STAT1 expression can significantly reduce lipid deposition in the liver of MASH mice and reduce the degree of liver fibrosis in MASH mice ( Figure 1 Middle right), which has the effect of treating MASH.

[0064] All the following statistical analyses were performed using GraphPad Prism 6 software (GraphPad Software, San Diego, USA). Paired t-test was used to compare the data of two paired groups, and multi-factor analysis of variance and Tukey's post-test were used to compare the data of multiple paired groups. Only when P < 0.05 was considered statistically significant, where "*" indicates P < 0.05, "**" indicates P < 0.01, "***" indicates P < 0.001, and "****" indicates P < 0.0001.

[0065] Example 1 STAT1 affects the development of MAIT cells and promotes the progression of MASH

[0066] 1.1 MAIT cells are significantly enriched in the peripheral blood and liver of MASH patients

[0067] In this example, peripheral blood mononuclear cells (PBMCs) from the MASH group and HC group (n=4 vs 4) in Table 1 were selected, and a series of analyses were performed by single-cell RNA sequencing (scRNA-seq), and it was found that mucosal-associated invariant T cells (MAIT cells) were significantly enriched in the peripheral blood of MASH patients.

[0068] Furthermore, the sample size was expanded to perform two types of validation. The sample size was expanded to include the MASH group and the HC group (n=24 vs. 25) for flow cytometry detection of peripheral blood PBMCs. Liver tissue samples from the MASH group and the HC group (n=5 vs. 5) were selected to validate the results of scRNA-seq by immunohistochemistry. The specific experimental process is as follows Figure 2 As shown in J.

[0069] 1.1.1 RNA sequencing of peripheral blood mononuclear cells (PBMCs) in the MASH group and the HC group (n=4 vs 4). The specific experimental process is as follows:

[0070] (1) Patient enrollment and sample collection

[0071] Four healthy donor HC and four MASH patients were selected from Table 1. The general clinical information of the healthy donor HC and MASH (4VS 4) patients is shown in Table 2-1 and Table 2-2, and the analysis results are shown in Table 2-3.

[0072] Table 2-1 Clinical information of healthy donor HC and MASH (4VS 4) patients

[0073]

[0074]

[0075] Table 2-2 Blood biochemical parameters of healthy donor HC and MASH (4VS 4) patients

[0076]

[0077] Table 2-3 General clinical data analysis of HC and MASH in single-cell RNA sequencing

[0078]

[0079]

[0080] (2) Preparation of mononuclear cells (PBMCs)

[0081] A total volume of 8 ml of fresh peripheral blood was collected from each person aseptically into an EDTA tube (Weigao Company, China) and diluted with an equal volume of phosphate buffer (Haoyang Biotechnology Company, China). Then, PBMCs were separated using Ficoll (Solarbio, China) density gradient centrifugation (700 g, 20 min). After that, PBMCs were washed twice with 1× PBS (Liji Biotechnology, China) and frozen in liquid nitrogen for later use.

[0082] (3) Single-cell RNA sequencing

[0083] PBMCs were transferred to the 10x Chromium system (10x Genomics) and LC Sciences, and the gel beads containing barcode information were combined with a mixture of cells and enzymes, and then encapsulated by oil-surfactant droplets located in the microfluidic system to form GEMs (Gel Beads-In-Emulsions). GEMs flowed into the reservoir and were collected, the gel beads dissolved to release the barcode sequence, the cDNA fragments were reverse transcribed, and the samples were labeled. The gel beads were broken and the oil droplets were broken, and PCR amplification was performed using cDNA as a template. The products of all GEMs were mixed to construct the scRNA-SEQ library. scRNA-SEQ was completed using the HiSeq4000 system (Illumina, USA), and quality control was performed using 10x Cell Ranger software v1.2.0 (10×Genomics, USA). The cell samples were evaluated and a total of 68,466 PBMCs (6,441-10,505 cells per sample, median number of genes 1,221-1,789) were enriched for further bioinformatics analysis. The gene expression matrix obtained from Cell Ranger was filtered and normalized using the Seurat R package (version 3.2). All data analyses were performed in R (version 4.1.0). Cluster analysis was performed using the R package Seurat (version 4.0.5). The raw sequence data of this example has been stored in the National Genomics Data Center (Nucleic Acids Res 2022) genome sequence archive (Genomics, Proteomics & Bioinformatics 2021) (GSA-Human: HRA006681) of the China Bioinformatics Center / Beijing Institute of Genomics, Chinese Academy of Sciences, and is publicly available at the following website: https: / / ngdc.cncb.ac.cn / gsa-human.

[0084] Single-cell sequencing analysis was performed using the 10X Genomics platform, and the 68,466 enriched PBMCs were identified based on differential markers and mapped into seven major immune cell populations (e.g. Figure 2 (as shown in Figure AC).

[0085] These seven major immune cell groups include T cells, NK cells, B cells, plasma cells, classical monocytes, non-classical monocytes and platelets; it is worth noting that these cell groups are mainly composed of T cells, NK cells and B cells. In addition, the results of the differential analysis of the proportion of these cells in immune cells in HC and MASH patients are as follows Figure 3 As shown in A, the results showed that the proportion of T cells was not statistically significant in HC and MASH patients.

[0086] Furthermore, the T cell subsets were subdivided into 10 subtypes including CD4-Tcm, CD4-Tem, CD4-Tn, CD4-Treg, CD8-Teff, CD8-Tem, CD8-Tn, GDT, MAIT, and NKT for analysis. The results are as follows Figure 2 D and E and the difference analysis of these subtypes between HC and MASH groups are shown in Figure 2 As shown in F.

[0087] The results of the differential analysis of the proportions of these T cell subsets between HC and MASH patients are shown in Figure 2. Figure 2 As shown in F. Figure 2 The results in Figure F showed that MAIT cells were significantly enriched in the peripheral blood of MASH patients compared with HC.

[0088] 1.1.2 Validation of peripheral blood flow cytometric analysis in patients with MASH

[0089] The samples were expanded to the MASH group and the HC group (n=24 vs 25, excluding 4 vs 4 in 1.1.1), and human PBMCs flow cytometry was performed to detect MAIT cells to verify the results in 1.1.1, as follows:

[0090] (1) Patient enrollment and sample collection

[0091] Another different group of MASH and HC groups in Table 1 were selected, their clinical data information and blood biochemical index test data were collected, and general clinical data were analyzed. The results are shown in Table 3:

[0092] Table 3 General clinical data analysis of HC and MASH

[0093] Variable HC (n=25) MASH (n=24) P Age 58.04±3.07 50.37±2.57 0.063 Gender 0.199 male 10(40％) 14(58％) female 15(60％) 10(42％) height 162.20±1.54 166.58±1.86 0.076 weight 51.60±1.92 75.58±2.55 <0.0001 BMI 19.44±0.66 27.10±0.56 <0.0001 PLT 215.84±13.48 227.33±16.85 0.595 AST 21.79±2.16 43.70±6.13 0.001 ALT 23.25±4.74 85.76±20.15 0.003 TBIL 11.00±1.10 19.11±4.28 0.068 DBIL 4.93±0.39 6.49±0.55 0.025 IBIL 6.07±0.75 8.45±1.08 0.075 CHE 7.49±0.36 9.60±0.49 0.001 GGT 41.64±16.73 101.45±30.11 0.086 TBA 5.18±0.90 7.82±1.32 0.104 ALP 72.66±4.96 90.11±4.36 0.011 TP 70.41±1.17 74.95±1.76 0.036 ALB 42.08±0.72 45.88±1.09 0.005 CRE 81.82±3.66 78.49±3.00 0.488 BUN 5.54±0.29 4.75±0.23 0.039 TC 1.24±0.08 3.13±0..71 0.010 TG 1.35±0.06 1.55±0.31 0.538 HDL-C 2.69±0.14 2.70±0.23 0.967 LDL-C 12.55±0.10 11.83±0.47 0.137 CAP 202.92±24.03 322.70±43.26 <0.0001 E 4.50±0.91 10.43±3.78 <0.0001

[0094] (2) Flow Cytometry (FCM)

[0095] PBMCs were resuspended in 1% BSA buffer (Life Technologies, USA) and 7-AAD (BioLegend, USA) was added. The percentage of live cells was detected using BD FACS Aria I (BD Biosciences, USA) software and analyzed using BD FACS Diva 8.0.1 software (BD Biosciences, USA). The antibody information for FCM detection is shown in Table 4.

[0096] Table 4 Antibody information detected by FCM

[0097] Antibody Name Product Number Manufacturer PE anti-human CD3 300307 Biolegend APC anti-human CD56 362503 Biolegend APC / Cy7 anti-human CD4 357415 Biolegend PE / Cy7 nti-human CD8 344711 Biolegend FITC anti-human CD3 300406 Biolegend APC anti-human CD161 339912 Biolegend PE anti-human TCR Vα7.2 351706 Biolegend

[0098] The results of FCM analysis are as follows Figure 2 Middle G and H, confirmed the enrichment of MAIT cells in MASH patients (p < 0.05).

[0099] 1.1.3 Immunohistochemical validation of liver tissues of MASH patients

[0100] To verify the above results, we selected another batch of MASH group and HC group (5 vs 5) in Table 1 that were different from the samples in 1.1.1 and 1.1.2 for immunohistochemical verification of ex vivo liver tissues, as follows:

[0101] (1) Patient enrollment and sample collection

[0102] Another group of MASH group and HC group in Table 1 were selected, and their clinical data information was collected as shown in Table 5-1, the blood biochemical index test results were shown in Table 5-2, and the general clinical data were analyzed, and the results are shown in Table 5-3.

[0103] Table 5-1 Clinical data information of MASH group and HC group (5 vs 5)

[0104]

[0105] Table 5-2 Results of blood biochemical indexes in the MASH group and the HC group (5 vs 5)

[0106]

[0107] Table 5-3 General clinical data analysis of MASH group and HC group (5 vs 5)

[0108] Variable HC (n=5) MASH (n=5) P Age 45.00±6.44 33.80±4.74 0.199 Gender 1.000 male 3(60％) 3(60％) female 2(40％) 2(40％) height 166.00±2.89 171.60±5.62 0.402 weight 67.40±2.65 76.00±9.69 0.417 BMI 24.55±1.28 25.38±1.84 0.720 PLT 241.00±9.36 279.80±9.04 0.018 AST 21.06±3.29 41.50±4.52 0.006 ALT 20.56±2.91 66.58±21.50 0.067 TBIL 10.02±2.33 13.86±1.28 0.187 DBIL 3.86±0.88 5.04±0.61 0.307 IBIL 6.16±1.48 8.94±1.32 0.201 CHE 10.32±1.15 8.96±1.44 0.484 GGT 44.92±16.84 102.68±39.70 0.217 TBA 6.42±3.65 5.80±1.25 0.876 ALP 74.52±7.86 72.50±4.47 0.829 TP 70.88±3.25 73.74±4.72 0.632 ALB 42.58±2.05 46.42±2.11 0.229 CRE 67.82±3.64 71.00±8.47 0.739 BUN 4.12±0.20 4.06±0.21 0.849 TC 5.04±0.39 5.00±0.31 0.933 TG 4.01±1.65 2.58±0.11 0.415 HDL-C 1.25±0.25 0.99±0.11 0.378 LDL-C 2.74±0.16 3.28±0.19 0.064 CAP 183.4±2.58 306.6±31.30 <0.0001 E 4.78±1.06 8.28±0.76 <0.0001

[0109] Immunohistochemical staining was performed on ex vivo liver tissues of the MASH and HC groups (n=5 vs 5), focusing on the lobular area and portal area. Figure 2 The immunohistochemical staining of liver tissue sections of the MASH and HC groups (n=5 vs. 5) is shown in Figure 1. Figure 4 As shown in A, B and C, Figure 4 As shown in result C, the expression of STAT1 in the MASH group was much higher than that in the normal group. Figure 4 As shown in D and E. Figure 4 The results in middle E show that the number of MAIT cells in both areas of the liver of MASH patients was significantly increased (p<0.001).

[0110] This experiment analyzed 68,466 cells using scRNA-seq technology and successfully identified seven immune cell populations, including T cells. Combined with peripheral blood flow cytometry analysis of MASH patients and immunohistochemistry of ex vivo liver tissue, it was confirmed that compared with the healthy control group, the number of MAIT cells in MASH patients increased significantly in both peripheral blood and liver tissue.

[0111] 1.2 Transcription factor STAT1 is a key factor in the development of MAIT cells in MASH disease progression

[0112] MAIT cells are innate-like T lymphocytes involved in antimicrobial immunity, mainly enriched in mucosal and liver tissues, and have strong cytotoxic activity. Mature MAIT cells are divided into MAIT1 (T-bet+) and MAIT17 (RORγt+) sublineages, which can secrete a variety of proinflammatory cytokines such as IFN-γ, TNF-α, IL-17A, IL-22, etc., which may be related to their role in liver inflammation and fibrosis. However, due to the differences in the number and expression factors of MAIT under different causes of hepatitis, the research results are not uniform, and the molecular mechanism by which immune cell dysfunction affects the progression of MASH is still unclear.

[0113] We further found through bioinformatics analysis of single-cell sequencing of MASH and HC groups (n=4 vs 4) that STAT1 plays a role in the differentiation and development of MAIT cells, suggesting that STAT1 promotes the progression of MASH by regulating MAIT, as follows:

[0114] (1) Bioinformatics analysis of scRNA-SEQ data

[0115] The gene expression matrix generated by 10×Cell Ranger software v1.2.0 (10×Genome, USA) was transferred into R software (Seurat, version 3.0) for further data screening for bioinformatics analysis. The data were then normalized using a scaling factor (default 10,000), and logarithmic transformation and data normalization were performed using the Seurat embedding function. The correlation and clustering relationships of the indicated data sets were comprehensively analyzed according to the RunPCA function in the Seurat software and visualized using the t-distributed random neighbor embedding (t-SNE) of the principal components. Finally, the average gene expression matrix of each cluster was retrieved, and the differentially expressed genes (DEGs) between clusters were performed using the FindAllMarkers function (only.Pos=FALSE, min.pct=0.2, thresh.Use=0.2) to determine candidate biomarkers with particularly high expression in the indicated single-cell subpopulations. Cellphonedb v5.0.0, Monocle2: v2.22.0, GSVA: 1.42.0 were used for analysis of cell communication. The results showed that there were 20,453 differentially expressed genes in MAIT cells between HC and MASH, of which the top 20 genes were GIMAP7, STAT1, GIMAP4, SYNE2, S100A11, RPL38, DENND2D, CD8A, TMSB4X, CCL4, ACTB, RPL23, RBL2, SUN2, RPS11, JAK1, CORO1A, SLC9A3R1, YWHAH, and LFNG.

[0116] (2) GSVA analysis of MAIT cells

[0117] Based on the gene expression data of MAIT cells in the MASH and HC groups (n=4 vs 4), GSVA analysis of MAIT cells was performed to explore the expression activity of MAIT cell-related gene sets in the samples of the HC and MASH groups. The gene set enrichment scores were calculated using the sample gene expression matrix to evaluate the activity of gene sets in different samples. The GSVA analysis results of MAIT cells are shown in Figure 2. Figure 5 As shown in A.

[0118] Figure 5 The results in Figure A showed that there were significant differences in gene expression profiles between the MASH group and the HC group, especially in the expression of inflammatory factors. Among them, the INTERFERON_GAMMA_RESPONSE pathway is involved in T cell differentiation and inflammatory response. As an immune cell activation and inflammation-related pathway, it is related to the regulation of MAIT cell proliferation.

[0119] Among the known differential pathways, G2M_CHECKPOINT showed that the mitosis of MAIT cells in the MASH group was more active, reflecting the characteristics of proliferation and differentiation. INFLAMMATORY_RESPONSE, as a key inflammatory response pathway, is closely related to the downstream inflammatory release of MASH. The enrichment results of these pathways indicate that MAIT cells in the MASH group are regulated and activated, and actively participate in the progression of the disease.

[0120] In order to clarify the key factors regulating the fate of MAIT, we took the intersection of the intergroup differential genes, transcription factor regulatory genes and INTERFERON_GAMMA_RESPONSE pathway genes of MAIT cells. The results are as follows: Figure 5 As shown in B. Figure 5 The intersection results of the three in B revealed only one intersection gene, and STAT1 was found to be a transcription factor highly expressed in MASH.

[0121] (3) Quasi-series analysis

[0122] Pseudo-time trajectory analysis was performed in R software with default settings of Moncle Version 2.4.0. Specifically, pseudo-time sorting was performed using the dimensionality reduction function (parameter settings: Max_Components = 2, Reduction_Method = DDRTree), and Kyoto Encyclopedia of Genes and Genomes and Gene Ontology analysis were performed on the https: / / www.omicstudio.cn / tool ​​(LC-BIO, China) platform. The results are shown in the figure. Figure 5 As shown in C.

[0123] Figure 5 The results in middle C showed that the enrichment of STAT1 in MAIT cells of the MASH group increased significantly with cell differentiation, which emphasized the key role of STAT1 in MAIT cell differentiation.

[0124] The results of the interaction between different cell types are as follows Figure 5 As shown in D, the results showed that compared with the HC group, the number of interactions between monocytes and all other cells in the MASH group was significantly increased, and the interaction between MAIT cells and CD8_Teff and CD4_Tcm cells was enhanced.

[0125] Monocytes, as antigen-presenting cells, can induce the activation and differentiation of other immune cells. Our results suggest that monocytes may play a role in inducing the differentiation of MAIT cells.

[0126] Visual analysis of cell communication related to IFN-γ pathways. Figure 5 As shown in E.

[0127] Figure 5 The results in E showed that IFNG_Type_II_IFNR was not present in MAIT cells and other immune cells in the HC group, while in the MASH group, IFNG_Type_II_IFNR was significantly enhanced between CD4 and CD8 positive effector T cells and MAIT cells. These results indicate that IFN-γ promotes the expression of STAT1 and induces MAIT cell differentiation.

[0128] In addition, the results of peripheral blood and liver tissues from two different groups of MASH patients in Table 1 showed that peripheral blood qRT-PCR showed that STAT1 was highly expressed in the MASH group (n=6 vs 6) ( Figure 5 F), immunofluorescence staining of liver tissue (n=3 vs 3) showed that the signaling pathways of STAT1 and MAIT cells in the liver tissue of MASH patients were significantly enhanced ( Figure 5 Middle G).

[0129] Example 2 Inhibition of STAT1 expression can significantly improve liver pathological progression in MASH mice

[0130] The animal experiment protocol was approved by the Animal Experiment Ethics Review Committee of Kunming Medical University (approval number: kmmu20230574). C57BL / 6J mice were purchased from the Department of Experimental Animals of Kunming Medical University and kept in different cages in a specific pathogen-free (SPF) animal facility and raised freely. The light / dark cycle was 12h / 12h, the temperature was 21°C, and the humidity was 50%. C57BL / 6J male mice were 8 to 10 weeks old and weighed 18 to 20g. The mice were randomly divided into a control group, a MASH model group, and a MASH model + STAT1 inhibitor group. The experimental process is as follows Figure 6 As shown in A, the details are as follows:

[0131] The control group was fed with a standard diet (Synergy Biotech, China) and intraperitoneally injected with normal saline. The MASH model group was fed with a choline / methionine-deficient diet (Synergy Biotech, China) for 4 weeks and intraperitoneally injected with a mixture of olive oil (Betis, Spain) and carbon tetrachloride (Merck, Germany) (2 ml / kg, twice a week, for 4 weeks) to construct the MASH model; the MASH model + inhibitor group was given 1.5 mg / kg of STAT1 inhibitor (Selleck Chemicals, USA) intraperitoneally every day on the basis of the MASH model group for 1 week. After the treatment, the mice were euthanized by cervical dislocation for subsequent experiments.

[0132] (1) Hematoxylin and eosin (H&E) staining

[0133] Liver tissues of mice in each group were taken and freshly frozen in isopentane (Thermo Fisher, USA) at -80°C to prepare paraffin sections. The sections were dewaxed with xylene and then hydrated with ethanol from high to low concentrations. Hematoxylin-eosin dye (Biosharp, China) was used for staining, and excess dye was washed off with running water. After washing with water, the sections were dehydrated with ethanol from low to high concentrations, and the sections were transparentized with xylene. After sealing with resin, the sections were observed and photographed under a microscope.

[0134] (2) Oil Red O staining to observe liver lipidation

[0135] Weigh 0.5 g of pre-ground Oil Red O powder (Solarbio, China), dissolve it in a small amount of isopropanol, then add isopropanol to 100 mL, and seal the brown bottle at 4°C. Prepare the staining solution by diluting the storage solution: deionized water = 3:2. Take the liver tissue of each group of mice and prepare frozen sections. Let the sections return to room temperature and add distilled water to wash. Soak in 60% isopropanol for 2 minutes, then add Oil Red working solution and stain for about 2-5 minutes. Rinse with 60% isopropanol to remove excess dye. Restain with hematoxylin for 1 minute and observe the staining results under a microscope.

[0136] (3) MASSON staining to detect liver fibrosis

[0137] First, take the liver tissue of each group of mice and use the MASSON trichrome staining kit (Solarbio, China) for operation. Prepare paraffin sections and dewax to water. Prepare weak acid working solution according to the ratio of distilled water: weak acid solution = 2:1. Stain with Ponceau fuchsin staining solution for 5-10 minutes, and add weak acid working solution to wash for 30 seconds. Pour off excess liquid, add phosphomolybdic acid solution for 1-2 minutes, and add weak acid working solution to wash for 30 seconds. Pour off excess liquid, add aniline blue staining solution for 1-2 minutes, and add weak acid working solution to wash for 30 seconds. Dehydrate quickly with 95% ethanol for 2-3 seconds, and dehydrate twice with anhydrous ethanol, each time for 5-10 seconds. Transparent with xylene twice, each time for 1-2 minutes, and seal with neutral resin. Observe and take pictures under a microscope.

[0138] The results of H&E, Oil Red O and MASSON staining are as follows Figure 6 As shown in B, the results of liver HE staining showed that the hepatocytes of mice in the MASH model group were of different sizes and loosely arranged, with lipid vacuoles and a large number of inflammatory cell infiltration (p<0.001); after the mice in the model group were treated with STAT1 inhibitors, the inflammatory cell infiltration was significantly reduced (p<0.01) ( Figure 6 Middle B).

[0139] Oil red O results showed that compared with the control group, the fat deposition in the liver of mice in the MASH model group was significantly increased (p<0.01); after treatment with STAT1 inhibitors, the lipid deposition in the liver of mice in the MASH model group was significantly reduced (p<0.05) ( Figure 6 (in B).

[0140] The results of MASSON showed that compared with the control group, the liver of the mice in the MASH model group had a large amount of fibrous tissue hyperplasia and obvious fibrous septa (p<0.0001); and the treatment with STAT1 inhibitor significantly reduced the degree of liver fibrosis in the mice in the model group (p<0.001) ( Figure 6 Middle B lower).

[0141] The above results reflect the promoting effect of STAT1 inhibitors in inhibiting liver steatosis and fibrosis in MASH model mice, suggesting that STAT1 is a potential therapeutic target for MASH.

[0142] T-bet and RORγt are two markers of MAIT cell maturation. The fluorescence intensity of T-bet and RORγt in mouse liver was further detected by liver immunofluorescence staining. The process included fixing the liver tissue with 4% paraformaldehyde, preparing thin sections, and performing antigen retrieval. The sections were then blocked with normal serum to reduce nonspecific binding. Specific primary antibodies were added and incubated overnight at 4°C, followed by incubation with fluorescently labeled secondary antibodies at room temperature for 1 hour in the dark, followed by nuclei staining with DAPI, and finally sealing with anti-fluorescence quenching sealing fluid. The distribution and intensity of the fluorescence signal were observed and recorded under a fluorescence microscope or confocal microscope. Results Figure 6 As shown in C, the results of liver immunofluorescence staining showed that the STAT1 inhibitor significantly reduced the fluorescence intensity of T-bet (p < 0.001) and RORγt (p < 0.05) in the liver of mice in the model group.

[0143] The mouse liver tissue was subjected to Western Blot analysis (WB), as follows:

[0144] The cells were collected and lysed using RIPA buffer containing protease inhibitors, and the total protein concentration was determined using a BCA protein concentration assay kit (Keygen Biotechnology, China). For quantitative analysis of the indicated proteins, protein samples were separated on a 10% SDS-PAGE gel and transferred to a PVDF membrane (Bio-Rad, USA). After blocking with 1× PBS buffer containing 5% skim milk powder for 2 h, the PVDF membrane was incubated with primary antibodies at 4°C for 12 h. The dilution ratio of the primary antibodies used was: anti-p-STAT1 (1:1000; Abcam, UK), anti-T-bet (1:1000; Abcam, UK), anti-RORγt (1:1000; Thermo Fisher, USA), and anti-β-ACTIN (1:2000; Abcam, UK). The membranes were rinsed three times with 1× PBST buffer (1× PBS containing 0.1% Tween20), and the corresponding secondary antibodies were added. After incubation at 37°C for 4 h, the membranes were developed with ECL detection reagent (Keygen Biotechnology, China). Finally, the protein in the membrane was detected by Super-Signal West Pico chemiluminescent substrate, the bands were exposed, and the grayscale value of the target protein was analyzed by Image J software (NIH, USA). β-ACTIN was used as the internal reference, and the antibody information is shown in Table 6. Figure 6 As shown in D.

[0145] Table 6 Antibody information used for Western blot analysis

[0146]

[0147]

[0148] The same results were obtained by WB analysis of mouse liver tissue, in which phosphorylated STAT1 (p-STAT1) is a key element of STAT1 homodimerization (STAT1-STAT1) or heterodimerization (STAT1-STAT2-IRF9 complex, ISGF3), regulating host immune response and immune cell growth. After adding STAT1 inhibitors, in addition to the significant decrease in T-bet and ROTγt protein levels in the model group, the protein expression of p-STAT1 was also significantly reduced (p < 0.001) ( Figure 6 (middle D).

[0149] Inflammatory factors such as GzmB, IFN-γ, IL-17, and IL-22 are associated with the progression of MASH. Then, enzyme-linked immunosorbent assay (ELISA) was used to measure GzmB, IFN-γ, IL-17, and IL-22 in mouse serum, as follows:

[0150] The expression levels of GzmB, IFN-γ, IL-17, and IL-22 in mouse serum were measured using ELISA kits (FUYUBIO, China) and the optical density was measured at 450 nm using a microplate reader (Biobase, China) according to the manufacturer's detailed instructions. The results are shown in Figure 6 As shown in E.

[0151] Compared with the HC group, the levels of inflammatory factors in the peripheral plasma of mice in the MASH model group were significantly upregulated; however, treatment with STAT1 inhibitors reversed this trend ( Figure 6 Middle E). Our experiments showed that STAT1 inhibitors regulate the differentiation and development of MAIT cells by negatively regulating the expression of STAT1 and further inhibiting the expression of T-bet and RORγt, thereby inhibiting the secretion of inflammatory factors and alleviating the pathological manifestations of MASH in mice.

[0152] According to the "Conversion of Equivalent Dose Between Animals and Between Animals and Humans in Pharmacological Experiments" published by Huang Jihan et al., according to the mg / kg dose conversion table from animal a to animal b for standard weight animals (the value in the table is the conversion factor Rab), the R value in the mouse a row and the adult b column is ab =0.081, which is converted into an adult dose of 1.5mg / kg×0.081=0.12mg / kg.

[0153] Example 3 Inhibition of STAT1 expression can significantly inhibit MAIT cell maturation and inflammatory factor secretion

[0154] To verify the results of Example 2, we collected two batches of HC groups and MASH groups in Table 1 that were different from the samples in Example 2 for in vivo and in vitro experiments, as follows:

[0155] (1) Patient enrollment and sample collection

[0156] The clinical data of the MASH group and the HC group (6 vs 6) were collected as shown in Table 7-1, the blood biochemical index test results were shown in Table 7-2, and the general clinical data were analyzed, and the results are shown in Table 7-3.

[0157] Table 7-1 Clinical information of MASH group and HC group (6 vs 6)

[0158]

[0159]

[0160] Table 7-2 Blood biochemical index test results of MASH group and HC group (6 vs 6)

[0161]

[0162] Table 7-3 General clinical data analysis of MASH group and HC group (6 vs 6)

[0163]

[0164]

[0165] The clinical data of the MASH group and the HC group (3 vs 3) were collected as shown in Table 8-1, the blood biochemical index test results were shown in Table 8-2, and the general clinical data were analyzed, and the results are shown in Table 8-3.

[0166] Table 8-1 Clinical data information of MASH group and HC group (3 vs 3)

[0167]

[0168] Table 8-2 Results of blood biochemical indexes in MASH group and HC group (3 vs 3)

[0169]

[0170] Table 8-3 General clinical data analysis of MASH group and HC group (3 vs 3)

[0171]

[0172]

[0173] (2) In vivo verification of peripheral blood between MASH group and HC group (6 vs 6)

[0174] The expressions of T-bet and RORγt, the transcription factors related to the maturation of MAIT cells, in the peripheral blood of the HC group and the MASH group (n=6 vs 6) were detected. Figure 7 As shown in A, the details are as follows:

[0175] First, Western blot analysis was used to compare the protein expression levels of p-STAT1, T-bet, and RORγt in PBMCs of the two groups of donors. Figure 7 As shown in Figure 2B, the protein levels of transcription factors p-STAT1, T-bet, and RORγt were significantly higher in PBMCs of MASH patients compared with HC (p<

[0176] 0.001).

[0177] Then, qRT-PCR was used to analyze the expression levels of T-bet and RORγt mRNA in PBMCs of the two groups of donors, as follows:

[0178] Total mRNA was extracted using Trizol reagent (Invitrogen, USA) according to the manufacturer's instructions. Quantification was performed using a spectrophotometer, and reverse transcription-polymerase chain reaction was performed using a reverse transcription kit (Promega, USA) after DNase treatment. The cDNA product was placed in an EP tube and PCR was performed using the SYBR Green Master Mix reaction system (QIGEN, Germany) and ABI PRISM on a real-time fluorescence quantitative PCR system.

[0179] qRT-PCR was performed using ELISA 7900 (Applied, USA) to detect the expression of target genes. GAPDH was used as an internal reference, and the relative expression level was determined by the 2-ΔΔ-Ct method. The gene-specific primer sequences used are shown in Table 9.

[0180] Table 9 Target gene specific primer sequences

[0181] ID Primers 5' to 3' 1 T-bet-F-Homo sapiens CCGTGACTGCCTACCAGAAT 2 T-bet-R-Homo sapiens ATCTCCCCCAAGGAATTGAC 7 RORγt-F-Homo sapiens GAGGAAGTCCATGTGGGAGA 8 RORγt-R-Homo sapiens TCCTAACCAGCACCACTTCC 9 GAPDH-F-Homo sapiens CAGCCTCAAGATCATCAGCA 10 GAPDH-R-Homo sapiens ATGATGTTCTGGAGAGCCCC

[0182] The results of qRT-PCR analysis were as follows Figure 7 As shown in C, the results showed that the expression levels of T-bet (p < 0.01) and RORγt (p < 0.0001) mRNA in PBMCs of MASH patients were significantly increased, confirming the increase in MAIT cell population observed in the MASH group, which is consistent with the above results.

[0183] Enzyme-linked immunosorbent assay (ELISA): Same as Example 2, the results are as follows Figure 7 As shown in D, the results showed that the concentrations of GzmB and proinflammatory factors IFN-γ, IL-17, and IL-22 were also increased in MASH patients.

[0184] (2) MASH group and HC group (3 vs 3) PBMCs and MAIT cells in vitro culture verification

[0185] The IL-12 / IL-18 culture system can effectively stimulate the maturation and differentiation of MAIT cells in normal PBMCs. We cultured PBMCs from the HC group and treated them with the IL-12 / IL-18 system and STAT1 inhibitor. The in vitro experimental process is as follows Figure 7 As shown in E, the in vitro culture of PBMCs and MAIT cells is as follows:

[0186] PBMCs were isolated from the peripheral blood of three healthy donors, mixed evenly, and cultured in groups in a well plate containing RPMI-1640 medium (Yaji Biotechnology, China). The medium was supplemented with 10% fetal bovine serum (Yaji Biotechnology, China) and 1% penicillin and streptomycin (Solarbio, China), and the cells were cultured in a cell culture incubator at 37°C with 5% CO2.

[0187] The PBMC group was used as the control group, and the PBMC+IL group and PBMC+IL+inhibitor group were used as the experimental groups. The cells were cultured for 7 days using the 50ng / ml IL-12 and IL-18 (PeproTech, USA) induction stimulation system. For in vitro treatment with STAT1 inhibitors, 5μg / mL fludarabine (HY-D0715, MedChemExpress) was applied 2 hours before culture. The cell suspension was collected on the 3rd and 7th days for WB and ELISA experimental analysis. 0.2μl IL-2 (20IU / μl) (PeproTech, USA) was added to the three groups to maintain cell activity.

[0188] The results of WB analysis on day 3 were as follows Figure 7 F, ELISA analysis results are as follows Figure 7 As shown in G. On day 3, we observed that stimulation with the IL-12 / IL-18 system significantly upregulated the MAIT cell maturation markers T-bet and RORγt (p<0.001). Interestingly, the use of STAT1 inhibitors effectively counteracted this effect, reducing the expression of T-bet and RORγt to near baseline levels; consistent results were also observed on day 7.

[0189] The above results indicate that STAT1 plays a vital role in mediating the differentiation of MAIT cells. Inhibition of STAT1 can significantly inhibit the maturation of MAIT cells, suggesting that STAT1 is a potential target for the treatment of MASH. STAT1 inhibitors can be used to prepare drugs for the treatment of MASH.

[0190] The above description is only a preferred embodiment of the present invention and does not limit the present invention in any form. Although the present invention has been disclosed as a preferred embodiment as above, it is not used to limit the present invention. Any technical personnel in this field can make some changes or modify the technical contents disclosed above into equivalent embodiments without departing from the scope of the technical solution of the present invention. However, any brief modifications, equivalent changes and modifications made to the above embodiments based on the technical essence of the present invention without departing from the content of the technical solution of the present invention are still within the scope of the technical solution of the present invention.

Claims

1. Use of a STAT1 inhibitor in the preparation of a drug for treating metabolic fatty hepatitis.

2. The use according to claim 1, characterized in that The STAT1 inhibitor is used to prepare a drug for treating metabolic fatty hepatitis caused by up-regulation of transcription factor STAT1 expression promoting MAIT cell enrichment.

3. The use according to claim 1 or 2, characterized in that: The STAT1 inhibitor in the drug for treating metabolic fatty hepatitis is Nifuroxazide, LL-K8-22 or Fludarabine.

4. The use according to claim 3, characterized in that The STAT1 inhibitor in the drug for treating metabolic fatty hepatitis is Fludarabine.

5. The use according to claim 4, characterized in that The dosage of Fludarabine in the drug for treating metabolic fatty hepatitis is 0.12-0.15 mg / kg for adults.

6. A drug for treating metabolic fatty hepatitis, characterized in that: The active ingredient of the drug includes a STAT1 inhibitor.

7. The drug according to claim 6, characterized in that The STAT1 inhibitor is Nifuroxazide, LL-K8-22 or Fludarabine.

8. The drug according to claim 7, characterized in that The STAT1 inhibitor is Fludarabine.

9. The drug according to claim 8, characterized in that The dosage form of the drug includes an injection preparation or an oral preparation.

10. The drug according to claim 9, characterized in that The drug also includes pharmaceutically acceptable excipients.

Images