Microbial composition for preventing and treating eggplant rhizome diseases and application thereof

Abstract

The invention relates to a microbial composition for preventing and treating eggplant rhizome diseases and application thereof, and the composition comprises a) Bacillus velezensis and Aspergillus oryzae, and b) fulvic acid, alginic acid, amino acid, rape pollen polysaccharide, oyster peptide, berberine and potassium phosphite. Wherein the preservation number of the bacillus velezensis is CCTCC (China Center For Type Culture Collection) NO: M2022923, and the preservation number of the aspergillus oryzae is CCTCC NO: M2021249. The composition provided by the invention has a relatively good prevention and control effect on root and stem diseases caused by infection of Ralstonia solanacearum, Rhizoctonia solani, Verticillium dahlii, Fusarium solani, Choanephra cucurbitarum and Basidiomycetes, and when the composition is applied to soil, the enzyme activity of the soil and the enzyme activity of the root system of the eggplant can be effectively improved. The composition provided by the invention has a relatively good prevention and control effect on the root and stem diseases caused by infection of the Ralstonia solanacearum, the Rhizoctonia solani, the Verticillium dahlii, the Fusarium solani, the Choanephra cucurbitarum and the Basidiomycetes.

Description

Technical Field

[0001] The invention belongs to the technical field of microorganisms and organic fertilizers, and in particular relates to a microbial composition for preventing and treating eggplant root and stem diseases and an application thereof. Background Art

[0002] In terms of production scale, in recent years, the vegetable planting area and output in Yunnan Province have continued to increase. In 2023, the planting area has exceeded 20 million mu, the output is close to 30 million tons, and the agricultural output value is more than 80 billion yuan. It is a traditional industry with obvious advantages and characteristics in Yunnan Province and a good industrial foundation, and it plays a significant role in the national vegetable supply. Among them, according to statistics in 2022, the output of eggplants in the vegetable output structure is 3.4085 million tons, accounting for 11.93%. It is a traditional vegetable with obvious advantages and characteristics and a good industrial foundation in Yunnan Province. It has played an irreplaceable and important role in the transportation of southern vegetables to the north, the adjustment of western vegetables to the east, and the export of vegetables in the country.

[0003] Ralstonia solanacearum Ralstonia solanacearum )、Rhizoctonia solani( Rhizoctonia nightshade )、Verticillium dahliae( Verticillium dahliae ) Fusarium solani ), Cordyceps sinensis ( Choanephora cucurbitarum ) and Basidiomycetes ( Poitrasia circinans ) is a typical devastating soil-borne disease distributed in vegetable producing areas around the world. The disease spreads quickly and is difficult to prevent and control. The mortality rate of infected plants is high. It is called "crop cancer" and can cause a serious reduction in production of 20% to 90%. It is the number one biological disaster in eggplant production. With the expansion of eggplant cultivation area, the exchange and transportation of commercial seeds and northern and southern vegetables, the degradation of soil quality, and the annual warming of the global climate, the area of ​​eggplant fruit and root diseases in Yunnan Province has expanded year by year in recent years, and the severity has increased year by year. Strengthening green prevention and control is imminent.

[0004] With the adjustment of agricultural production structure, eggplant has been planted on a large scale, which has changed the chemical and physical environment of natural ecosystems, leading to the widespread and serious occurrence of root and stem diseases. The cost of disease prevention and control is high, generally 10-20 times the cost of above-ground disease prevention and control, but the effect is minimal. The main reason for the difficulty in disease prevention and control is that disease prevention and control is a blind spot for chemical pesticides. In other words, chemical pesticides alone are basically unable to control underground diseases, which is determined by the two completely different environmental conditions on the ground and underground. Whether it is antibiotics or other chemical fungicides, their foothold is to "kill", but for these stubborn pathogens, the killing effect is simply unattainable. This is because, on the one hand, one of the consequences of the indiscriminate use of chemical fungicides is the cultivation of stronger and stronger drug-resistant strains from generation to generation, and on the other hand, chemical pesticides are a double-edged sword, and there are strict restrictions on the concentration and interval of use, otherwise it will harm the crop itself. Also, most of these pathogens make their homes inside the root system or microtubule bundles, which greatly increases the difficulty of killing. Therefore, a green and efficient biological control technology is urgently needed to promote the development of the eggplant industry. Summary of the invention

[0005] The purpose of the present invention is to provide a microbial composition and its application for preventing and treating root diseases of eggplants in order to solve the problems of poor effect and high environmental risk of pesticides in the prior art during eggplant planting. The microbial combination provided by the present invention can significantly improve soil quality, increase soil enzyme activity and eggplant root enzyme activity, and thus reduce the Ralstonia solanacearum ( Ralstonia solanacearum )、Rhizoctonia solani( Rhizoctonia solani )、Verticillium dahliae( Verticillium dahliae ) Fusarium solani ), Cordyceps sinensis ( Choanephora cucurbitaceae ) and Basidiomycetes ( Poitrasia circinans ) The incidence rate and disease index of eggplant rhizome diseases caused by infection are reduced, and the prevention and control effect is significant.

[0006] To achieve the above object, the present invention provides a microbial composition in a first aspect, comprising the following components: a) Bacillus velezensis with the deposit number of CCTCC NO: M2022923 and Aspergillus berwiniae with the deposit number of CCTCC NO: M2021249; b) Fulvic acid, seaweed extract, amino acids, rapeseed pollen polysaccharides, oyster peptides, berberine and potassium phosphite.

[0007] Further, the amount of Bacillus Velez in the composition is such that the content of Bacillus Velez in the composition is 2×10 9 ~5×10 9cfu / g; the amount of Aspergillus niger in the bacterial agent is such that the content of Aspergillus niger in the composition is 1.5×10 9 ~3×10 9 cfu / g.

[0008] Furthermore, the weight ratio of fulvic acid, alginic acid, amino acid, rapeseed pollen polysaccharide, oyster peptide, berberine and potassium phosphite is 15-30:15-30:15-30:1.0-10:1.5-6.5:0.5-5.0:0.1-0.5.

[0009] Furthermore, the amount of the Bacillus Velezii used is 1% to 5% of the total weight of the bacterial agent, and the amount of the Aspergillus niger used is 1% to 5% of the total weight of the bacterial agent.

[0010] Furthermore, in the fulvic acid, the organic acid content is 50 to 70% by weight, calculated on a dry matter basis; and / or, in the alginate, the alginate content is 60 to 80% by weight, calculated on a dry matter basis; and / or, in the amino acid, the amino acid content is 30 to 40% by weight, calculated on a dry matter basis; and / or, in the rape pollen polysaccharide, the polysaccharide content is 40 to 60% by weight, calculated on a dry matter basis; and / or, in the oyster peptide, the protein content is 50 to 60% by weight, calculated on a dry matter basis; and / or, in the berberine, the berberine content is 5 to 8% by weight, calculated on a dry matter basis; and / or, in the potassium phosphite, the potassium phosphite content is 45 to 60% by weight.

[0011] The second aspect of the present invention provides the use of the above-mentioned microbial composition in improving soil enzyme activity, and / or improving crop root enzyme activity, and / or preventing and controlling eggplant root and stem diseases.

[0012] Furthermore, the crop is eggplant, and the pathogen causing the eggplant root disease is Ralstonia solanacearum ( Ralstonia solanacearum ), and / or, Rhizoctonia solani ( Rhizoctonia solani ), and / or, Verticillium dahliae ( Verticillium dahliae ), and / or, Fusarium solani ( Fusarium solani ), and / or, Choanephora cucurbitarum ), and / or, Basidiomycetes ( Poitrasia circinans ).

[0013] The third aspect of the present invention provides a method for improving soil enzyme activity and / or improving crop root enzyme activity and / or preventing and controlling eggplant rhizomes diseases, characterized in that the composition is applied to the crop rhizosphere soil, and the amount of the composition applied to the crop rhizosphere soil is 15-20 kg / 366.67 m 2 / times, application frequency 3 times during the entire reproductive period.

[0014] Through the above technical solution, the present invention can at least achieve the following beneficial effects: (1) When applied to the soil, the composition provided by the present invention can significantly increase the activities of soil enzymes such as sucrase (SC), urease (UE), arginine deaminase (FCR), leucine aminopeptidase (LAP) and asparaginase (ASNase), thereby promoting soil nutrient conversion and crop absorption, thereby indirectly improving host disease resistance.

[0015] (2) The composition provided by the present invention can produce abundant derivatives and multiple functional enzymes when applied to the soil, thereby significantly improving the activities of eggplant root cytokinin oxidase (CKO / CKK), ferric reductase (FCR), phenol oxidase (PO), NADPH oxidase (NAO) and indoleacetic acid oxidase (IAAO), thereby improving crop immunity and enhancing resistance to Ralstonia solanacearum ( Ralstonia solanacearum ), and / or, Rhizoctonia solani ( Rhizoctonia solani ), and / or, Verticillium dahliae ( Verticillium dahliae ), and / or, Fusarium solani ( Fusarium solani ), and / or, Choanephora cucurbitarum ), and / or, Basidiomycetes ( Poitrasia circinans )’s disease resistance.

[0016] (3) The composition provided by the present invention contains Bacillus velezensis and Aspergillus niger. When applied to the soil, it can inhibit the growth of pathogenic bacteria by competing for nutrient resources and producing antibiotics, thereby achieving the purpose of disease prevention and control.

[0017] Biological Deposit The Bacillus Velezii used in the present invention is classified and named Bacillus velezensis SH-1471 was deposited in the China Center for Type Culture Collection on June 20, 2022, at 299 Bayi Road, Wuchang District, Wuhan City, Hubei Province, Wuhan University, with a deposit number of CCTCC NO: M2022923. The deposit information of the strain has been disclosed in the prior invention patent application number: CN202211479280.X.

[0018] The Welwitschia spp. used in the present invention is classified and named Aspergillus welwitschiae 1-SF1 was deposited in the China Center for Type Culture Collection on March 25, 2021, at 299 Bayi Road, Wuchang District, Wuhan City, Hubei Province, Wuhan University, with the deposit number CCTCC No: M2021249. The deposit information of the strain has been disclosed in the prior invention patent application number: CN202110381505.7. DETAILED DESCRIPTION

[0019] The endpoints and any values ​​of the ranges disclosed in this article are not limited to the precise ranges or values, and these ranges or values ​​should be understood to include values ​​close to these ranges or values. For numerical ranges, the endpoint values ​​of each range, the endpoint values ​​of each range and the individual point values, and the individual point values ​​can be combined with each other to obtain one or more new numerical ranges, which should be considered as specifically disclosed in this article.

[0020] In the present invention, Bacillus Velezii SH-1471 and Bacillus Velezii CCTCC No: M2022923 are the same strain, and the two have the same meaning, and their names (numbers) can be used interchangeably. Aspergillus 1-SF1 and Aspergillus CCTCC No: M2021249 are the same strain, and the two have the same meaning, and their names (numbers) can be used interchangeably.

[0021] The inventors of the present invention isolated and obtained a strain of Bacillus Velezii ( Bacillus velezensis ), named SH-1471, was deposited in China Center for Type Culture Collection on June 20, 2022, with the deposit number CCTCC No: M2022923. And a strain of Aspergillus sibiricum ( Aspergillus welwitschiae ), named 1-SF1, and deposited in the China Center for Type Culture Collection on March 25, 2021, with the deposit number CCTCC No: M2021249.

[0022] The inventors of the present invention also found in the study that applying a composition prepared by mixing fulvic acid, seaweed extract, amino acids, rapeseed pollen polysaccharides, oyster peptides, berberine and potassium phosphite in a certain proportion to the rhizosphere soil of eggplant can significantly increase the activities of enzymes such as sucrase (SC), urease (UE), arginine deaminase (FCR), leucine aminopeptidase (LAP) and asparaginase (ASNase) in the soil, thereby promoting the conversion of soil nutrients; it can significantly increase the activities of enzymes such as cytokinin oxidase (CKO / CKK), ferric reductase (FCR), phenol oxidase (PO), NADPH oxidase (NAO) and indoleacetic acid oxidase (IAAO) in the eggplant root system, promote crop growth and improve disease resistance.

[0023] After further research, the inventors cleverly found that applying Bacillus Velezii SH-1471 and Aspergillus 1-SF1 alone or together with the above-mentioned composition to the rhizosphere soil of eggplant can significantly reduce the Ralstonia solanacearum ( Ralstonia solanacearum ), and / or, Rhizoctonia solani ( Rhizoctonia solani ), and / or, Verticillium dahliae ( Verticillium dahliae ), and / or, Fusarium solani ( Fusarium solani), and / or, Choanephora cucurbitarum ), and / or, Basidiomycetes ( Poitrasia circinans ) The incidence rate and disease index of rhizome diseases caused by infection, and the prevention and control effect is significant.

[0024] Based on the above findings, the present invention provides a composition, comprising: Component 1: optional Bacillus velez SH-1471 and Aspergillus serrata 1-SF1; Component 2: fulvic acid, seaweed extract, amino acids, rapeseed pollen polysaccharides, oyster peptides, berberine and potassium phosphite.

[0025] That is, the composition provided by the present invention is formulated as any one of the following: (1) Bacillus velezensis and Aspergillus niger, fulvic acid, seaweed extract, amino acids, rapeseed pollen polysaccharides, oyster peptides, berberine and phosphorous acid; (2) Fulvic acid, seaweed extract, amino acids, rapeseed pollen polysaccharides, oyster peptides, berberine and phosphorous acid.

[0026] The inventors found in their research that when the components of the composition are used in a specific weight ratio, the obtained Ralstonia solanacearum ( Ralstonia solanacearum ), and / or, Rhizoctonia solani ( Rhizoctonia solani ), and / or, Verticillium dahliae ( Verticillium dahliae ), and / or, Fusarium solani ( Fusarium solani ), and / or, Choanephora cucurbitarum ), and / or, Basidiomycetes ( Poitrasia circinans ) has better prevention and control effect on rhizome diseases caused by infection.

[0027] Therefore, according to a preferred embodiment of the present invention, based on the total weight of the composition, the amount of Bacillus Velezii is 1 to 5% by weight, preferably 2 to 5% by weight, and more preferably 3 to 5% by weight; the amount of Aspergillus niger is 1 to 5% by weight, preferably 2 to 5% by weight, and more preferably 3 to 5% by weight.

[0028] Preferably, the amount of the bacterial agent is such that the content of Bacillus Velezii in the composition is 0.5×10 9 ~5×10 9 cfu / g, preferably 1×10 9 ~5×10 9 cfu / g, more preferably 2×10 9 ~5×10 9 cfu / g.

[0029] Preferably, the amount of the bacterial agent is such that the content of Aspergillus niger in the composition is 0.5×10 9 ~3×109 cfu / g, preferably 1×10 9 ~3×10 9 cfu / g, more preferably 1.5×10 9 ~3×10 9 cfu / g.

[0030] According to a preferred embodiment of the present invention, the weight ratio of fulvic acid, seaweed extract, amino acid, rape pollen polysaccharide, oyster peptide, berberine and potassium phosphite is 15-30: 15-30: 15-30: 1.0-10: 1.5-6.5: 0.5-5.0: 0.1-0.5, preferably 20-30: 20-30: 20-30: 3.0-10: 2.5-6.5: 1.0-5.0: 0.15-0.5, more preferably 26-30: 26-30: 26-30: 5.0-10: 3.3-6.5: 1.5-5.0: 0.2-0.5.

[0031] In the present invention, there is no particular limitation on the raw materials used for the above-mentioned composition (such as fulvic acid, seaweed extract, amino acids, rapeseed pollen polysaccharides, oyster peptides, berberine and potassium phosphite), which can be any related product in the art that can be used to prepare bacterial agents, and can be either commercially available related products or related products prepared by themselves according to existing technologies.

[0032] The inventors found in their research that when specific raw materials are used, the disease control effect is better. Therefore, according to a preferred embodiment of the present invention, the organic acid content of the fulvic acid is 30-70% by weight, preferably 40-70% by weight, and more preferably 50-70% by weight, calculated on a dry matter basis; the alginic acid content is 40-80% by weight, preferably 50-80% by weight, and more preferably 60-80% by weight, calculated on a dry matter basis; the amino acid content is 10-40% by weight, preferably 20-40% by weight, and more preferably 30-40% by weight, calculated on a dry matter basis; the rapeseed pollen polysaccharide content is 10-20% by weight, preferably 20-20% by weight, and more preferably 30-40% by weight, calculated on a dry matter basis; In the oyster peptide, the content of polysaccharides is 20-60% by weight, preferably 30-60% by weight, and more preferably 40-60% by weight, calculated on dry matter; in the oyster peptide, the content of protein is 30-60% by weight, preferably 40-60% by weight, and more preferably 50-60% by weight, calculated on dry matter; in the berberine, the content of berberine is 3-8% by weight, preferably 4-8% by weight, and more preferably 5-8% by weight, calculated on dry matter; in the potassium phosphite, the content of potassium phosphite is 25-60% by weight, preferably 35-60% by weight, and more preferably 45-60% by weight.

[0033] The present invention further provides a method for preparing the above-mentioned composition. According to a preferred embodiment of the present invention, the method comprises uniformly mixing the fulvic acid, seaweed extract, amino acids, rapeseed pollen polysaccharides, oyster peptides, berberine and potassium phosphite of the above-mentioned component 2 to obtain a basic formula, and adding optional raw materials such as Bacillus velezensis and Aspergillus miltiorrhiza (or its bacterial agent) to the basic bacterial agent according to the above-mentioned dosage ratio and mixing them evenly.

[0034] In the present invention, there is no particular restriction on the specific storage and use form of the microbial agent. Since the raw materials used in the microbial agent are basically solid, the preparation method is only to mix the components in proportion. Therefore, the microbial agent can be directly stored or used in the form of a solid preparation. Considering the differences in different crops or planting methods and planting conditions, the microbial agent can also be mixed with a certain amount of water to prepare a liquid or slurry (suspension) preparation for storage or use.

[0035] The second aspect of the present invention provides Bacillus Velezii and Aspergillus berwiniae, or the composition described in the first aspect, for use in improving soil enzyme activity and / or improving crop root enzyme activity and / or preventing and controlling eggplant root and stem diseases.

[0036] According to a preferred embodiment of the present invention, the crop is eggplant.

[0037] In the present invention, soil enzyme activity refers to enzyme activities such as sucrase (SC), urease (UE), arginine deaminase (FCR), leucine aminopeptidase (LAP) and asparaginase (ASNase); root enzyme activity refers to enzyme activities such as eggplant root cytokinin oxidase (CKO / CKK), ferric reductase (FCR), phenol oxidase (PO), NADPH oxidase (NAO) and indoleacetic acid oxidase (IAAO).

[0038] In the present invention, preventing and controlling crop root diseases refers to preventing or reducing the occurrence of crop diseases, or reducing the losses caused by the diseases after the diseases occur.

[0039] Preferably, the crop diseases are selected from eggplant root and stem diseases.

[0040] According to some preferred embodiments of the present invention, the pathogen causing the eggplant root disease is Ralstonia solanacearum ( Ralstonia solanacearum ), and / or, Rhizoctonia solani ( Rhizoctonia solani ), and / or, Verticillium dahliae ( Verticillium dahliae ), and / or, Fusarium solani ( Fusarium solani ), and / or, Choanephora cucurbitarum ), and / or, Basidiomycetes ( Poitrasia circinans ).

[0041] The third aspect of the present invention provides a microbial composition for preventing and controlling eggplant root and stem diseases and its application. The method comprises applying the composition of the first aspect to the rhizosphere soil of the eggplant.

[0042] That is, the above method may include the following ways: (1) Applying Bacillus Velez and / or Aspergillus berwinii directly to the rhizosphere soil of crops (usually this can be done by applying a solid bacterial agent directly to the rhizosphere soil of crops, or by culturing Bacillus Velez and / or Aspergillus berwinii and then applying the culture to the soil); (2) applying a composition that does not contain Bacillus velezensis and / or Aspergillus niger to the rhizosphere soil of the crop; (3) Applying a composition containing Bacillus velezensis and / or Aspergillus niger to the rhizosphere soil of crops.

[0043] In the present invention, the crop is eggplant.

[0044] Preferably, the pathogen causing the eggplant root disease is Ralstonia solanacearum ( Ralstonia solanacearum ), and / or, Rhizoctonia solani ( Rhizoctonia solani ), and / or, Verticillium dahliae ( Verticillium dahliae ), and / or, Fusarium solani ( Fusarium solani ), and / or, Choanephora cucurbitarum ), and / or, Basidiomycetes ( Poitrasia circinans ).

[0045] The specific features of the Bacillus Velezii and / or Aspergillus velifolia and the composition used in the method provided by the present invention are as described above and will not be repeated here.

[0046] In the present invention, there is no particular limitation on the specific dosage of Bacillus Velezii and / or Aspergillus welwitschia and the composition, as long as they can prevent and treat root and rhizome diseases.

[0047] According to a preferred embodiment of the present invention, in the above method (1), the amount of Bacillus Velez is such that the content of Bacillus Velez in the composition is 2×10 9 ~5×10 9 cfu / g, and the amount of Aspergillus niger used is such that the content of Aspergillus niger in the composition is 1.5×10 9 ~3×10 9 The dosage of Bacillus Velez and / or Aspergillus welwitschiae is calculated according to the application amount of the composition and the amount of Bacillus Velez and / or Aspergillus welwitschiae contained therein, wherein the liquid bacterial agent is converted according to 1 g / mL.

[0048] The inventors of the present invention also found in their research that when planting different crops, the dosage of the aforementioned Bacillus Velezii and / or Aspergillus miltiorrhiza or the bacterial agent is also adjusted accordingly, which can further improve the systemic resistance and disease prevention effects of the crops.

[0049] According to some preferred embodiments of the present invention, for the above method (1): when applied to the rhizosphere soil of crops, the total amount of the Bacillus Velezii and / or Aspergillus berwinii is not less than 7-20 kg / 366.67 m 2 / time, preferably 10-20kg / 366.67m 2 / time, more preferably 15-20kg / 366.67m 2 / Second-rate.

[0050] The bacterial agent provided by the present invention has a synergistic effect when used together with Bacillus Velezii and / or Aspergillus berwinii. Therefore, when adopting the above-mentioned method (1), in order to obtain better effect, the amount of Bacillus Velezii and / or Aspergillus berwinii used can be appropriately increased compared with the amount of Bacillus Velezii and / or Aspergillus berwinii used with the bacterial agent in method (3).

[0051] Preferably, for the above method (3): when applied to crops, the total amount of the Bacillus Velezii and / or Aspergillus niger is not less than 5-20 kg / 366.67 m 2 , preferably 7-20kg / 366.67m 2 , more preferably 10 to 20 kg / 366.67 m 2 , more preferably 15 to 20 kg / 366.67 m 2 .

[0052] The present invention will be described in detail below by way of examples. It should be understood that the following examples are only used to further explain and illustrate the present invention, and are not intended to limit the present invention. Example

[0053] The fulvic acid used in this example was purchased from Wuhan Jiyesheng Chemical Co., Ltd., alginic acid was purchased from Yancheng Runyu Biotechnology Co., Ltd., amino acids were purchased from Shandong Ruifeng New Materials Co., Ltd., rapeseed pollen polysaccharides, oyster peptides and berberine were purchased from Xi'an An'ao Biotechnology Co., Ltd., and potassium phosphite was purchased from Hebei Hongtao Bioengineering Co., Ltd. The microbial agent was a liquid culture obtained by expanding Bacillus velez (for the acquisition method, please refer to CN202211479280.X) and Aspergillus berwinii (for the acquisition method, please refer to CN202210551025.5), wherein the content of Bacillus velez was 2.5×10 9 cfu / g, the Aspergillus content of Welwitschia was 2×10 9 cfu / ml.

[0054] Table 1 lists the test results of the basic formula raw material components used in the composition, among which, the organic acid in fulvic acid was determined by acid-base titration, the phenolic compounds were determined by high performance liquid chromatography (HPLC), the sugar compounds were determined by Fehling's method, and the aromatic compounds were determined by high performance liquid chromatography (HPLC); the alginic acid in alginate was determined by acid-base titration, the polysaccharides were determined by anthrone-sulfuric acid method, the protein was determined by biuret method, and the terpenes were determined by high performance liquid chromatography (HPLC); the protein in amino acids was determined by biuret method, and the amino acids were determined by high performance liquid chromatography (HPLC); the polysaccharides in rapeseed pollen polysaccharides were determined by anthrone-sulfuric acid method, the amino acids were determined by high performance liquid chromatography (HPLC), and the flavonoids and phenols were determined by high performance liquid chromatography (HPLC); the protein in oyster peptides was determined by biuret method, the polysaccharides were determined by anthrone-sulfuric acid method, and the lipids were determined by Soxhlet extraction; berberine, flavonoids and phenolic acids in berberine were determined by high performance liquid chromatography (HPLC). Each component in the test results is calculated based on the dry matter in the material.

[0055] Table 1 Basic material composition

[0056] The microbial agent was prepared according to the formula in Table 2. The specific preparation method included: weighing the raw materials according to the proportions in Table 2, and mixing them evenly to obtain the microbial agent.

[0057] Table 2 Microbial agent formula

[0058] According to a preferred embodiment of the present invention, the application frequency of the Bacillus Velez and the Aspergillus miltiorrhiza agent is 1 to 3 times per crop. In order to obtain a better disease prevention effect, according to some preferred embodiments of the present invention, when the Bacillus Velez and the Aspergillus miltiorrhiza agent are applied to Angelica sinensis, fertilizer is applied once every 10 to 15 days starting from the time of planting, for a total of 3 applications. According to the formula of the microbial agent in Table 2, 10 to 20 kg / 366.67 m 2 / times (100 plants were planted in each test group).

[0059] During the harvest period, the Ralstonia solanacearum ( Ralstonia solanacearum )、Rhizoctonia solani( Rhizoctonia solani )、Verticillium dahliae( Verticillium dahliae ) Fusarium nightshade ), Cordyceps sinensis ( Choanephora cucurbitarum ) and Basidiomycetes ( Poitrasia circinans) and determine the prevention and control effect of root and tuber diseases caused by infection, and the rhizosphere soil enzyme activity and crop enzyme activity.

[0060] Ralstonia solanacearum Ralstonia solanacearum ) Survey and classification standards for bacterial wilt: Level 0: The whole plant is disease-free.

[0061] Level 1: There are occasional chlorotic spots on the stem, or less than 1 / 2 of the leaves on the diseased side wilt.

[0062] Level 3: There are black streaks on the stem, but they do not exceed 1 / 2 of the stem height, or 1 / 2 to 2 / 3 of the leaves on the diseased side are withered.

[0063] Level 5: The black streaks on the stem exceed 1 / 2 of the stem height but do not reach the top of the stem, or more than 2 / 3 of the leaves on the diseased side wilt.

[0064] Level 7: Black streaks on the stem reach the top of the stem, or all the leaves of the diseased plant wilt.

[0065] Level 9: The diseased plants are basically dead.

[0066] Rhizoctonia solani Rhizoctonia solani ) Root rot survey and grading standards: Level 0: There are no lesions on the stem and taproot.

[0067] Level 1: There are lesions on the base of the stem and the main root, and the area of ​​the lesions accounts for less than 1 / 4 of the total area of ​​the stem and the main root.

[0068] Level 3: The area of ​​lesions on the stem and taproot accounts for about 1 / 4 to 1 / 2 of the total area of ​​the stem and taproot.

[0069] Level 5: The lesions cover more than 1 / 2 of the stem and taproot area.

[0070] Level 7: The lesions on the stem base and main root are connected and have formed a stem-wrapped phenomenon, but the root system is not necrotic.

[0071] Level 9: The aboveground parts wilt or die.

[0072] Verticillium dahliae Verticillium dahliae ) Verticillium wilt survey and classification standards: Level 0: There are no lesions on the stem and taproot.

[0073] Level 1: There are lesions on the base of the stem and the main root, and the area of ​​the lesions accounts for less than 1 / 4 of the total area of ​​the stem and the main root.

[0074] Level 3: The area of ​​lesions on the stem and taproot accounts for about 1 / 4 to 1 / 2 of the total area of ​​the stem and taproot.

[0075] Level 5: The lesions cover more than 1 / 2 of the stem and taproot area.

[0076] Level 7: The lesions on the stem base and main root are connected and have formed a stem-wrapped phenomenon, but the root system is not necrotic.

[0077] Level 9: The aboveground parts wilt or die.

[0078] Fusarium solani Fusarium solani ) Root rot investigation and analysis standards: Level 0: There are no lesions on the stem and taproot.

[0079] Level 1: There are lesions on the base of the stem and the main root, and the area of ​​the lesions accounts for less than 1 / 4 of the total area of ​​the stem and the main root.

[0080] Level 3: The area of ​​lesions on the stem and taproot accounts for about 1 / 4 to 1 / 2 of the total area of ​​the stem and taproot.

[0081] Level 5: The lesions cover more than 1 / 2 of the stem and taproot area.

[0082] Level 7: The lesions on the stem base and main root are connected and have formed a stem-wrapped phenomenon, but the root system is not necrotic.

[0083] Level 9: The aboveground parts wilt or die.

[0084] Eggplant fungus Choanephora cucurbitarum ) Root rot investigation and analysis standards: Level 0: There are no lesions on the stem and taproot.

[0085] Level 1: There are lesions on the base of the stem and the main root, and the area of ​​the lesions accounts for less than 1 / 4 of the total area of ​​the stem and the main root.

[0086] Level 3: The area of ​​lesions on the stem and taproot accounts for about 1 / 4 to 1 / 2 of the total area of ​​the stem and taproot.

[0087] Level 5: The lesions cover more than 1 / 2 of the stem and taproot area.

[0088] Level 7: The lesions on the stem base and main root are connected and have formed a stem-wrapped phenomenon, but the root system is not necrotic.

[0089] Level 9: The aboveground parts wilt or die.

[0090] Eggplant Basidiomycetes ( Poitrasia circinans ) Rot investigation and analysis standards: Level 0: There are no lesions on the stem and taproot.

[0091] Level 1: There are lesions on the base of the stem and the main root, and the area of ​​the lesions accounts for less than 1 / 4 of the total area of ​​the stem and the main root.

[0092] Level 3: The area of ​​lesions on the stem and taproot accounts for about 1 / 4 to 1 / 2 of the total area of ​​the stem and taproot.

[0093] Level 5: The lesions cover more than 1 / 2 of the stem and taproot area.

[0094] Level 7: The lesions on the stem base and main root are connected and have formed a stem-wrapped phenomenon, but the root system is not necrotic.

[0095] Level 9: The aboveground parts wilt or die. The control effect is calculated using the following two formulas: Disease index = [(Σ(number of diseased plants × representative level)) / (total number of plants × highest representative level)] × 100 Control effect (%) = [(control group disease index - treatment group disease index) / control group disease index] × 100% Disease identification: Ralstonia solanacearum ( Ralstonia solanacearum )、Rhizoctonia solani( Rhizoctonia nightshade )、Verticillium dahliae( Verticillium dahliae ) Fusarium solani ), Cordyceps sinensis ( Choanephora cucurbitarum ) and Basidiomycetes ( Poitrasia circinans ) were infected with typical root and tuber diseases, and the pathogens were isolated and purified by tissue separation to obtain pure cultures of the pathogens; the pure cultures were inoculated into eggplants according to Koch's postulates to verify the pathogenicity; the pathogens were re-isolated from the diseased tissues to obtain pure cultures identical to the original inoculum. The above verifications indicate the pathogenicity of the isolates to eggplants. Based on the morphological identification of the isolates, ITS / 16S RNA was further used for molecular identification to finally determine the taxonomic status of the pure cultures.

[0096] Ralstonia solanacearum Ralstonia solanacearum ) 16S RNA gene sequence (SEQ ID NO.1): Rhizoctonia solani ITS sequence (SEQ ID NO.2): TGCGGAAGGATCATTAAATAAATGAGAAAGTAACTGGGAGCTCTTCTGCTCTCATTACTCTTCTATTTTACTGTGAACCGTTTTATTCCACAACGTTTGAGGAATGTTCTTATGCCATAGGGGTAGGCATATGAAATGTTAACCGAGTTGTGATCAAGCTTAGGCTTGGTACCCTGTTTATATACTTTTATCCATTGATCAGATTATAAAAATGTAACATAGGTAGTAATATCTATAAAACAACTTTTAACAACGGATCTCTTGGCTTTTGCATCGATGAAGAACGTAGCAAATTGCGATAACTAGTGTGAATTGCAAATTCAGTGAATCATCGAGTCTTTGAACGCATCTTGCGCTCATTGGTATTCCAGTGAGCACGCCTGTTTCAGTATCAAAAACAACCCTCATTCAAAAGTTTTTTCTTATGAATGGTTATGAAGGAAGCTTTAGCCCTTGGGCTTGGCAACCTTTTAAATTGAGTAAGGCCTGAATCTGTTTCATCTAGCCTGAACTTTTTTTTAATATAAAGGAAAGCTCTTGCGACTTGAACTTTGTTGGGGCCTCCCAAATAAAACTTTTTTCATCTTGATCTGAAATCAGGTGGGACTACCCGCTGAACTTAAGCATAT Verticillium dahliae Verticillium dahliae ITS sequence (SEQ ID NO.3): GTAACAAGGTCTCCGTTGGTGAACCAGCGGAGGGATCATTACCGAGTATCTACTCATAACCCTTTGTGAACCATATTGTTGCTTCGGCGGCTCGTTCTGCGAGCCCGCCGGTCCATCAGTCTCTCTGTTTATACCAACGATACTTCTGAGTGTTCTTAGCGAACTATTAAAACTTTTAACAACGGATCTCTTGGCTCTAGCATCGATGAAGAACGCAGCGAAACGCGATATGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATGGCGCCTTCCAGTATCCTGGGAGGCATGCCTGTCCGAGCGTCGTTTCAACCCTCGAGCCCCAGTGGCCCGGTGTTGGGGATCTACGTCTGTAGGCCCTTAAAAGCAGTGGCGGACCCGCGTGGCCCTTCCTTGCGTAGTAGTTACAGCTCGCATCGGAGTCCCGCAGGCGCTTGCCTCTAAACCCCCTACAAGCCCGCCTCGTGCGGCAAC Fusarium solani Fusarium solani ) ITS sequence (SEQ ID NO.4): TCATCAACCCTGTGAACATACCTAAACGTTGCCTCGGCGGGAACAGACGGCCCCGTGAAAACGGGCCGCCCCCGCCAGAGGACCCCCTAACTCTGTTTCTATAATGTTTCTTCTGAGTAAAACAAGCAAATAAATTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTTCGAGCGTCATTACAACCCTCAGGCCCCCGGGCCTGGCGTTGGGGATCGGCGGAGGCCCTCCGTGGGCACGCGCCGTCCCCCAAATACAGTGGCGGTCCCGCCGCAGCTTCCATCGCGTAGTAGCTAACACCTCGCGACTGGAGAGCGGCGCGGCCACGCCGTAAAACCCCCAACTCTTCTGAAGTTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAAT Choanephora Choanephora cucurbitarum ITS sequence (SEQ ID NO.5): CCTGCGGAAGGATCATTAAATAAATAAGAAGTATTTCGGGCTTGTCCTGATCTACTATCTATTTTACTGTGAACTGTTTTATTTCATGGCGTTTGAGGGATGTTCTTGTGCTATATGGGTAGGCATGAGAAATGTTAACCGAGCTATGGTCAAGCTTAGGCTTGGTACCCTGTTTATATACTTTCAATTGATCAGATTATAAAATGTAACATAGGTAGTAATATCTATAAAACAACTTTTAACAATGGATCTCTTGGCTTTTGCATCGATGAAGAACGTAGCAAATTGCGATAACTAGTGTGAATTGCAAATTCAGTGAATCATCGAGTCTTTGAACGCATCTTGCGCTCATTGGTATTCCAGTGAGCACGCCTGTTTCAGTATCAAAAACAACCCTCATTCAAATTTTTTTTTTGAATGGTCATGAAGGAAGCTAGTAATGGCGACCTTTTAAATTGAGTAAGGCCTGAATCTGTTCATCTAGCCTGAACTTTTTTTTAATATAAAGGAAAGCTCTTGCGACTTGGACTTTGTTGGGGCCTCCCAAATAAAACTCTTTCATCTTGATCTGAAATCAGGTGGGACTACCCGCTGAACTTAAGCATAT Basidiomycetes ( Poitrasia circinans ) ITS sequence (SEQ ID NO.6): TGCGGAAGGATCATTAAATAAATGAGAAAGTAACTGGGAGCTCTTCTGCTCTCATTACTCTTCTATTTTACTGTGAACCGTTTTATTCCACAACGTTTGAGGAATGTTCTTATGCCATAGGGGTAGGCATATGAAATGTTAACCGAGTTGTGATCAA GCTTAGGCTTGGTACCCTGTTTATATACTTTTATCCATTGATCAGATTATAAAAATGTAACATAGGTAGTAATATCTATAAAACAACTTTTAACAACGGATCTCTTGGCTTTTGCATCGATGAAGAACGTAGCAAATTGCGATAACTAGTGTGAATT GCAAATTCAGTGAATCATCGAGTCTTTGAACGCATCTTGCGCTCATTGGTATTCCAGTGAGCACGCCTGTTTCAGTATCAAAAACAACCCTCATTCAAAAGTTTTTTCTTATGAATGGTTATGAAGGAAGCTTTAGCCCTTGGGCTTGGCAACCTTT TAAATTGAGTAAGGCCTGAATCTGTTTCATCTAGCCTGAACTTTTTTTTAATATAAAGGAAAGCTCTTGCGACTTGAACTTTGTTGGGGCCTCCCAAATAAAACTTTTTTCATCTTGATCTGAAATCAGGTGGGACTACCCGCTGAACTTAAGCATA Eggplant root enzyme activity determination: Cytokinin oxidase (CKO / CKK), ferric reductase (FCR), phenol oxidase (PO), NADPH oxidase (NAO) and indoleacetic acid oxidase (IAAO) and other enzyme activities were determined using kits purchased from Suzhou Grace Biotechnology Co., Ltd. The usage method refers to the instruction manual.

[0097] Soil enzyme activity determination: The activities of enzymes such as sucrase (SC), urease (UE), arginine deaminase (FCR), leucine aminopeptidase (LAP) and asparaginase (ASNase) were determined using kits purchased from Suzhou Grace Biotechnology Co., Ltd. The usage method refers to the instructions.

[0098] From the data in Tables 3, 4 and 5, it can be seen that when the microbial agent provided by the present invention is applied, the eggplant infected with Ralstonia solanacearum ( Ralstonia solanacearum )、Rhizoctonia solani( Rhizoctonia solani)、Verticillium dahliae( Verticillium dahliae ) Fusarium solani ), Cordyceps sinensis ( Choanephora cucurbitaceae ) and Basidiomycetes ( Poitrasia circinans ) has a good preventive and control effect on root and tuber diseases caused by infection; the improvement of rhizosphere soil enzyme activity and eggplant root enzyme activity is significantly stronger than the control.

[0099] Table 3 Test conditions and results of the control effect of microbial agents on eggplant root and stem diseases

[0100] *The control group was a blank control group without any bacterial agent.

[0101] Table 4 Test conditions and results of microbial agents on eggplant root enzyme activity

[0102] *The control group was a blank control group without any bacterial agent.

[0103] Table 5 Test conditions and results of microbial agents on soil enzyme activity in eggplant cultivation

[0104] *The control group was a blank control group without any bacterial agent.

[0105] Finally, it should be noted that the above preferred embodiments are only used to illustrate the technical solutions of the present invention rather than to limit it. Although the present invention has been described in detail through the above preferred embodiments, those skilled in the art should understand that various changes can be made in form and details without departing from the scope defined by the claims of the present invention.

Claims

1. A microbial composition for preventing and treating eggplant root and stem diseases, characterized in that: The microbial composition comprises: The deposit number is CCTCC NO: M 2022923 Bacillus velez and the deposit number is CCTCC NO: M 2021249 Aspergillus serrata; Fulvic acid, seaweed extract, amino acids, rapeseed pollen polysaccharides, oyster peptides, berberine and potassium phosphite.

2. The microbial composition for preventing and controlling eggplant root and stem diseases according to claim 1, characterized in that: The amount of Bacillus Velez in the composition is such that the content of Bacillus Velez in the composition is 2×10 9 ~5×10 9 cfu / g; the amount of Aspergillus spp. in the bacterial agent is such that the content of Aspergillus spp. in the composition is 1.5×10 9 ~3×10 9 cfu / g.

3. The microbial composition for preventing and controlling eggplant root and stem diseases according to claim 1, characterized in that: The weight ratio of fulvic acid, alginic acid, amino acid, rapeseed pollen polysaccharide, oyster peptide, berberine and potassium phosphite is 15-30:15-30:15-30:1.0-10:1.5-6.5:0.5-5.0:0.1-0.

5.

4. The microbial composition for preventing and controlling eggplant root and stem diseases according to claim 1, characterized in that: The dosage of the Bacillus Velezii is 1% to 5% of the total weight of the bacterial agent, and the dosage of the Aspergillus niger is 1% to 5% of the total weight of the bacterial agent.

5. A microbial composition for preventing and controlling eggplant root and stem diseases according to any one of claims 1 to 4, characterized in that: The fulvic acid has an organic acid content of 50 to 70% by weight based on dry matter; and / or, the alginate has an alginate content of 60 to 80% by weight based on dry matter; and / or, the amino acids have an amino acid content of 30 to 40% by weight based on dry matter; and / or, the rapeseed pollen polysaccharide has a polysaccharide content of 40 to 60% by weight based on dry matter; and / or, the oyster peptide has a protein content of 50 to 60% by weight based on dry matter; and / or, the berberine has a berberine content of 5 to 8% by weight based on dry matter; and / or, the potassium phosphite has a potassium phosphite content of 45 to 60% by weight.

6. Use of the microbial composition according to any one of claims 1 to 4 in increasing soil enzyme activity and / or increasing crop root enzyme activity and / or preventing and controlling eggplant root and stem diseases.

7. The use according to claim 6, characterized in that: The crop is eggplant, and the pathogen causing the eggplant root disease is Ralstonia solanacearum ( Ralstonia solanacearum ), and / or, Rhizoctonia solani ( Rhizoctonia solani ), and / or, Verticillium dahliae ( Verticillium dahliae ), and / or, Fusarium solani ( Fusarium solani ), and / or, Choanephora cucurbitarum ), and / or, Basidiomycetes ( Poitrasia circinans ).

8. A method for increasing soil enzyme activity and / or increasing crop root enzyme activity and / or preventing and controlling eggplant root diseases, characterized in that: The method comprises applying the composition of any one of claims 1 to 4 to the rhizosphere soil of the crop, wherein the amount of the composition applied to the rhizosphere soil of the crop is 10 to 20 kg / 366.67 m 2 / times, application frequency 3 times during the entire reproductive period.

Images