Antibacterial peptide CL18 and application thereof

Abstract

The invention discloses an antibacterial peptide CL18 and application thereof, and the amino acid sequence of the antibacterial peptide CL18 is shown as SEQ ID NO.1. The antibacterial peptide disclosed by the invention is strong in antibacterial ability, and can play a role in bacteriostasis at a relatively small concentration. In addition, the antibacterial peptide provided by the invention is not influenced by the drug resistance of salmonella, has an obvious inhibition effect on salmonella, and can effectively prevent and control salmonellosis. The antibacterial peptide disclosed by the invention is prepared into an antibacterial drug, a feed additive or a feeding material, and has important significance on healthy development of livestock and poultry breeding industry.

Description

Technical Field

[0001] The invention belongs to the field of molecular biotechnology, and specifically relates to an antimicrobial peptide CL18 and an application thereof. Background Art

[0002] Salmonella is the most common zoonotic pathogen in the Enterobacteriaceae family. It often parasitizes in the intestines of animals and humans. Its hosts include humans and various animals, especially poultry. Salmonella is an important foodborne bacteria that causes human infection. Food poisoning caused by Salmonella is the most common and harmful of all bacterial food poisoning, accounting for about 42.6% to 60% of bacterial food poisoning. The most easily transmitted sources of Salmonella include: cut fruits, unclean vegetables and raw food. Various raw meats and raw eggs are important sources of infection.

[0003] Antimicrobial drugs are usually used to treat Salmonella at home and abroad to reduce its harm, but there is confusion in the selection of drug types, routes of administration, methods, dosages and maintenance time. There is a considerable degree of blindness, and abuse or waste is very common. At the same time, long-term and repeated use of drugs not only increases the cost of treatment, but also leads to a series of problems such as increased bacterial resistance and drug residues in livestock and poultry products. Facts have proved that relying solely on drug control is not a good way to prevent and control Salmonella. With the current large-scale prevalence of broad-spectrum resistant Salmonella (such as Indiana Salmonella, Salmonella Typhimurium, Kentucky Salmonella, etc.), and the implementation of the policy of banning and limiting antibiotics, it is urgent to find other alternative antibiotic prevention and control solutions.

[0004] Antimicrobial peptides (AMPs) are small molecule polypeptides composed of multiple amino acids, which are an important component of the natural immune defense system of organisms. Existing studies have shown that antimicrobial peptides have broad-spectrum antibacterial, antiviral, antifungal, antiparasitic and immunomodulatory biological activities. Currently, many antimicrobial peptide drugs have entered the clinical stage, showing good application prospects. The present invention aims to provide an antimicrobial peptide that can effectively inhibit Salmonella, laying the foundation for further development of new drugs to prevent and block Salmonella infection. Summary of the invention

[0005] The purpose of this section is to summarize some aspects of embodiments of the present invention and briefly introduce some preferred embodiments. Some simplifications or omissions may be made in this section and the specification abstract and the invention title of this application to avoid blurring the purpose of this section, the specification abstract and the invention title, and such simplifications or omissions cannot be used to limit the scope of the present invention.

[0006] In view of the above problems and / or the problems existing in the prior art, the present invention is proposed.

[0007] Therefore, the purpose of the present invention is to overcome the deficiencies in the prior art and provide an antimicrobial peptide CL18.

[0008] In order to solve the above technical problems, the present invention provides the following technical solution: the amino acid sequence of the antimicrobial peptide CL18 is shown as SEQ ID NO.1, and the nucleotide sequence is shown as SEQ ID NO.2.

[0009] Furthermore, the antimicrobial peptide also includes a polypeptide having an amino acid sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% homologous to the polypeptide as shown in SEQ ID NO.1 and having antimicrobial activity.

[0010] It should be noted that homology in the present invention refers to the "sequence identity" between two amino acid sequences, i.e., the percentage of identical amino acids between the sequences. Methods for evaluating the degree of sequence identity between amino acids or nucleotides are known to those skilled in the art. For example, amino acid sequence identity is usually measured using sequence analysis software. For example, it can be determined using the BLAST program of the NCBI database.

[0011] The above-mentioned polypeptides have 70%, 75%, 80%, 85%, 90%, 95%, 99% or more (such as 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 98.5%, 99%, 99.5%, 99.6%, 99.7%, 99.8% or more, or even 99.9% or more) homology with the polypeptide shown by the antimicrobial peptide CL18 and have antibacterial activity, and their active sites, active pockets, active mechanisms, polypeptide structures, etc. are most likely the same as those of the antimicrobial peptide CL18.

[0012] A person skilled in the art may also perform conservative substitutions on amino acids according to amino acid substitution rules well known to those skilled in the art, such as the "blosum62 scoring matrix" in the prior art.

[0013] Conservative amino acid substitutions or replacements are well known in the art. For example, conservative amino acid substitutions preferably involve replacing an amino acid residue in the following groups (1)-(5) with another amino acid residue in the same group: (1) smaller aliphatic non-polar or weakly polar residues: Ala, Ser, Thr, Pro and Gly; (2) polar negatively charged residues and their (uncharged) amides: CL, Asn, Glu and Gln; (3) polar positively charged residues: His, Arg and Lys; (4) larger aliphatic non-polar residues: Met, Leu, Ile, Val and Cys; and (5) aromatic residues: Phe, Tyr and Trp. Particularly preferred conservative amino acid substitutions are as follows: Ala is replaced by Gly or Ser; Arg is replaced by Lys; Asn is replaced by Gln or His; CL is replaced by Glu; Cys is replaced by Ser; Gln is replaced by Asn; Glu is replaced by CL; Gly is replaced by Ala or Pro; His is replaced by Asn or Gln; Ile is replaced by Leu or Val; Leu is replaced by Ile or Val; Lys is replaced by Arg, Gln or Glu; Met is replaced by Leu, Tyr or Ile; Phe is replaced by Met, Leu or Tyr; Ser is replaced by Thr; Thr is replaced by Ser; Trp is replaced by Tyr; Tyr is replaced by Trp or Phe; and Val is replaced by Ile or Leu.

[0014] In the present invention, the preparation method of the antimicrobial peptide is not strictly limited. For example, it can be prepared by artificial synthesis, or the corresponding gene sequence can be obtained by bioinformatics means according to the amino acid sequence, and the antimicrobial peptide of the corresponding amino acid sequence can be obtained by expressing the gene sequence.

[0015] As used herein, the terms "antimicrobial peptide", "antimicrobial polypeptide", "antimicrobial protein" and "antimicrobial protein" are synonymous and are used herein to refer to polymers of amino acid residues having antimicrobial, bacteriostatic or bactericidal functions. The term is applicable to amino acid polymers in which one or more amino acid residues are artificial chemical mimetics of the corresponding naturally occurring amino acids, as well as to naturally occurring amino acid polymers and non-naturally occurring amino acid polymers. Unless otherwise stated, a specific polypeptide sequence also implicitly encompasses conservatively modified variants thereof.

[0016] The term "amino acid" means the twenty common naturally occurring amino acids. Naturally occurring amino acids include alanine (A), arginine (R), asparagine (N), aspartic acid (D), cysteine ​​(C); glutamic acid (E), glutamine (Q), glycine (G), histidine (H), isoleucine (I), leucine (L), lysine (K), methionine (M), phenylalanine (F), proline (P), serine (S), threonine (T), tryptophan (W), tyrosine (Y) and valine (V).

[0017] Another object of the present invention is to provide the use of antimicrobial peptide CL18 in inhibiting Salmonella.

[0018] As a preferred embodiment of the use of the antimicrobial peptide CL18 in the present invention in inhibiting Salmonella, wherein: the Salmonella includes Salmonella enterica and Salmonella bongori;

[0019] Among them, the enteric Salmonella includes enteric Salmonella enterica subspecies (S. enterica subsp. enterica), enteric Salmonella salamae subspecies (S. enterica subsp. salamae), enteric Salmonella Arizona subspecies (S. enterica subsp. arizonae), enteric Salmonella diarizonae subspecies (S. enterica subsp. diarizonae), enteric Salmonella Houtenae subspecies (S. enterica subsp. houtenae), and enteric Salmonella Indica subspecies (S. enterica subsp. indica).

[0020] As a preferred embodiment of the use of the antimicrobial peptide CL18 of the present invention in inhibiting Salmonella, the minimum inhibitory concentration of the antimicrobial peptide CL18 for enteric Salmonella enterica subspecies is 64 μg / ml; the minimum inhibitory concentration for enteric Salmonella salam subspecies is 32 μg / ml; the minimum inhibitory concentration for enteric Salmonella arizona subspecies is 32 μg / ml; the minimum inhibitory concentration for enteric Salmonella biphasic arizona subspecies is 64 μg / ml; the minimum inhibitory concentration for enteric Salmonella Houghton subspecies is 32 μg / ml; the minimum inhibitory concentration for enteric Salmonella indyka subspecies is 32 μg / ml; and the minimum inhibitory concentration for Salmonella bongori is 64 μg / ml.

[0021] Another object of the present invention is to provide an antibacterial pharmaceutical composition.

[0022] In order to solve the above technical problems, the present invention provides the following technical solution: the antimicrobial pharmaceutical composition comprises the antimicrobial peptide CL18 or its homologues and a pharmaceutically active agent or other pharmaceutically acceptable excipients.

[0023] Specifically, in some embodiments, when the composition is an antimicrobial drug, the composition described herein contains, in addition to the above-mentioned antimicrobial peptide, other components, such as physiological / pharmaceutically acceptable carriers and excipients. The purpose of the composition is to facilitate administration to an organism, facilitate the absorption of the active ingredient, and thus exert biological activity. In this disclosure, "composition" and "preparation" are not mutually exclusive.

[0024] As a preferred embodiment of the antibacterial drug composition of the present invention, the drug is an anti-Salmonella drug.

[0025] As a preferred embodiment of the antibacterial pharmaceutical composition of the present invention, the pharmaceutically active agent includes an antibiotic.

[0026] Types of antibiotics include penicillins, such as penicillin G, penicillin V, methicillin, oxacillin, carbenicillin, nafcillin, ampicillin, etc.

[0027] Penicillins combined with β-lactamase inhibitors, cephalosporins (e.g. cefaclor, cefazolin, cefuroxime, ramoxef, etc.); carbapenems; monobactams; aminoglycosides; tetracyclines; macrolides; lincomycins; polymyxins; sulfonamides; quinolones; chloramphenicol; metronidazole; spectinomycin; trimethoprim; vancomycin, etc.

[0028] The pharmaceutically active agent may also be an anti-mycotic agent, including polyene compounds, such as amphotericin B, nystatin; 5-flucosyn;

[0029] and azoles, such as miconazole, ketoconazole, itraconazole and fluconazol.

[0030] As a preferred embodiment of the antibacterial drug composition of the present invention, the dosage form of the antibacterial drug composition includes an injection, preferably a sodium chloride injection.

[0031] In some embodiments, when delivering the composition to animals (eg, poultry), a variety of delivery systems are known and can be used to administer the composition. Methods of introduction include, but are not limited to, eye drops, intranasal, and oral routes.

[0032] Another object of the present invention is to provide a feed composition.

[0033] In order to solve the above technical problems, the present invention provides the following technical solution: the feed composition comprises the antimicrobial peptide CL18 or its homologues and feed components or other nutritionally acceptable auxiliary materials.

[0034] The antimicrobial peptide in the feed composition herein can be used in combination with one or more of the following: a nutritionally acceptable carrier, a nutritionally acceptable diluent, a nutritionally acceptable excipient, a nutritionally acceptable adjuvant, a nutritionally active ingredient. Specifically, for example, proteins, peptides, sucrose, lactose, sorbitol, glycerol, propylene glycol, sodium chloride, sodium sulfate, sodium acetate, sodium citrate, sodium formate, sodium sorbate, potassium chloride, potassium sulfate, potassium acetate, potassium citrate, potassium formate, potassium acetate, potassium sorbate, magnesium chloride, magnesium sulfate, magnesium acetate, magnesium citrate, magnesium formate, magnesium sorbate, sodium pyrosulfite, methyl paraben and propyl paraben.

[0035] In some embodiments, the feed composition can be fodder or a premix thereof, a compound feed or a premix thereof. The feed additive can be mixed with a compound feed, a compound feed component, or mixed into a premix of a compound feed, or mixed into fodder, a fodder component, or a premix of a fodder. The feed composition includes a feed component, and the feed component and the antimicrobial peptide together constitute the feed composition.

[0036] In some embodiments, the antimicrobial peptides of the present invention are mixed with feed components to form feed. As used herein, "feed component" means all or part of a feed. A part of a feed may mean one component of a feed or more than one (e.g., 2 or 3 or 4 or more) components of a feed. In one embodiment, the term "feed component" encompasses a premix or a premix ingredient.

[0037] Any feed material described herein may comprise one or more feed materials selected from the group consisting of

[0038] a) Cereals, such as small grain cereals (e.g. wheat, barley, rye, oats, triticale and combinations thereof) and / or large grain cereals such as maize or sorghum;

[0039] b) by-products from cereals, such as corn gluten meal, wet cake (especially corn-based wet cake), distillers dried grains (DDG) (especially corn-based distillers dried grains (cDDG)), distillers dried grains with solubles (DDGS) (especially corn-based distillers dried grains with solubles (cDDGS)), wheat bran, semolina, wheat short meal, rice bran, rice hulls, oat hulls, palm kernels and citrus pulp;

[0040] c) Proteins obtained from sources such as soy, sunflower, peanut, lupin, pea, bean, cotton, canola, fish meal, dried plasma protein, meat and bone meal, potato protein, whey, copra, sesame;

[0041] d) oils and fats of vegetable and animal origin;

[0042] e) Minerals and vitamins.

[0043] Another object of the present invention is to provide a preservative composition.

[0044] In order to solve the above technical problems, the present invention provides the following technical solution: the preservative composition comprises the antimicrobial peptide CL18 or its homologue.

[0045] Beneficial effects of the present invention:

[0046] The antimicrobial peptide of the present invention has a strong antibacterial ability and can play an antibacterial role at a relatively low concentration. In addition, the antimicrobial peptide of the present invention is not affected by the drug resistance of Salmonella, has a significant inhibitory effect on Salmonella, and can effectively prevent and control salmonellosis. The preparation of the antimicrobial peptide of the present invention into an antimicrobial drug, feed additive or feed is of great significance to the healthy development of livestock and poultry breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0047] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the following briefly introduces the drawings required for describing the embodiments. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without creative labor. Among them:

[0048] Figure 1 This is the high performance liquid chromatography analysis diagram of the antimicrobial peptide CL18.

[0049] Figure 2 This is the liquid chromatography-mass spectrometry analysis diagram of the antimicrobial peptide CL18. DETAILED DESCRIPTION

[0050] In order to make the above-mentioned objects, features and advantages of the present invention more obvious and easy to understand, the specific implementation methods of the present invention are described in detail below in conjunction with the embodiments of the specification.

[0051] In the following description, many specific details are set forth to facilitate a full understanding of the present invention, but the present invention may also be implemented in other ways different from those described herein, and those skilled in the art may make similar generalizations without violating the connotation of the present invention. Therefore, the present invention is not limited to the specific embodiments disclosed below.

[0052] Secondly, the term "one embodiment" or "embodiment" as used herein refers to a specific feature, structure, or characteristic that may be included in at least one implementation of the present invention. The term "in one embodiment" that appears in different places in this specification does not necessarily refer to the same embodiment, nor does it refer to a separate or selective embodiment that is mutually exclusive with other embodiments.

[0053] The amino acid sequence of the antimicrobial peptide CL18 in the present invention is shown in SEQ ID NO.1:

[0054] SEQ ID NO.1: Phe Val Phe Leu Lys Lys Pro Ala Phe MetLys Lys ArgPro PheLys His Leu

[0055] The nucleotide sequence of the antimicrobial peptide CL18 in the present invention is shown in SEQ ID NO.2:

[0056] SEQ ID NO.2:TTTGTGTTTCTAAAAAAACCTGCTTTTATGAAAAAGCGGCCATTCAAACATTTGTGA

[0057] Among them, G is guanine, A is adenine, T is thymine, and C is cytosine. SEQ ID NO.2 contains a total of 57 nucleotides, and every 3 nucleotides can be translated into 1 amino acid. The TGA position at the end of the sequence is the stop codon. SEQ ID NO.1 is obtained by translating SEQ ID NO.2.

[0058] Example 1 Synthesis and characterization of antimicrobial peptides

[0059] The feces of healthy green-shell laying hens were collected, and the antimicrobial peptide CL18 of the present invention was obtained by metagenomic sequencing screening. According to the sequence SEQ ID NO.1, it was chemically synthesized (linear peptide solid phase synthesis) by Shanghai Shenggong Biology, and analyzed by high performance liquid chromatography and liquid chromatography-mass spectrometry. The results are as follows Figure 1 , Figure 2 And as shown in Table 1.

[0060] Table 1

[0061] Peak# Ret.Time Area Height Area % Height % 1 10.839 602163 20131 1.413 1.149 2 11.503 88205 8164 0.207 0.466 3 11.824 40830987 1644318 95.794 93.832 4 12.754 505120 38557 1.185 2.200 5 13.114 355653 20067 0.834 1.145 6 13.858 138538 11616 0.325 0.663 7 14.174 72965 6190 0.171 0.353 8 14.568 30061 3363 0.071 0.192 Total 42623692 1752406 100.000 100.000

[0062] Figure 1 Table 1 is a peak information table obtained from the chromatographic analysis chart of the sequence synthesis. The results show that five peaks were detected, with the main peak retention time of 11.824 minutes, accounting for 95.794% of the peak area, indicating that the purity of the target polypeptide is relatively high.

[0063] Figure 2 The HPLC-MS analysis chart synthesized for the sequence showed that the detected multiply charged ions matched the theoretical molecular weight well and the measured values ​​were close to the theoretical values, indicating that the target polypeptide of the sample was accurate.

[0064] The above results indicate that the antimicrobial peptide CL18 has been accurately synthesized and stored at -80°C after freeze-drying for future use.

[0065] Example 2 Minimum inhibitory concentration (MIC) detection of antimicrobial peptides

[0066] The minimum inhibitory concentrations of different antimicrobial peptides were compared. The sequences of the antimicrobial peptides are shown in Table 2.

[0067] Table 2

[0068] Antimicrobial peptides Amino acid sequence CL18 FVFLKKPAFMKKRPFKHL CL14 KPYKKILNHLGITG CL23 QRLLKTVAPRRYPILKSPHCQRK CL12 KSLISLKISLFI CL16 SINLHTAIRSFHLFWR

[0069] Salmonella enteritidis ATCC13076 was cultured in MH broth at 37°C until the logarithmic phase, and then the bacterial suspension was diluted to a final concentration of 1×10 7 CFU / mL;

[0070] 100 μL of the antimicrobial peptides of different concentrations shown in Table 2 was mixed with 100 μL of bacterial solution and added to a 96-well plate. After incubation at 37°C for 16 h, the turbidity was observed under a light source to obtain the MIC (Minimum Inhibitory Concentration) of different antimicrobial peptides. All experimental groups were set up for 3 repeated measurements to determine the final results (MIC). The results are shown in Table 3.

[0071] Table 3 Minimum inhibitory concentration (MIC) detection of antimicrobial peptides

[0072] Antimicrobial peptides MIC value CL18 32μg / ml CL14 >1024μg / ml CL23 256μg / ml CL12 1024μg / ml CL16 >1024μg / ml

[0073] It can be seen that among the five antimicrobial peptides, three have obvious antibacterial effects, among which the MIC value of CL18 is 32 μg / ml, which is significantly better than the other peptides, so CL18 was further analyzed and tested.

[0074] Example 3 In vitro antibacterial test of antimicrobial peptide CL18 against different Salmonella

[0075] Different species (subspecies) of Salmonella reference strains ATCC 13076, ATCC 14028, ATCC 43972, ATCC 13314, ATCC 12325, ATCC 43974, ATCC 43976 and ATCC 43975 were selected to test the in vitro antibacterial activity of the antimicrobial peptide CL18 against the above different species (subspecies) of Salmonella. The results are shown in Table 4.

[0076] Table 4 In vitro antibacterial test of antimicrobial peptide CL18

[0077]

[0078]

[0079] As can be seen from Table 4, the MIC values ​​of CL18 against different species (subspecies) of Salmonella ranged from 32 to 64 μg / ml, and the minimum bactericidal concentration MBC values ​​ranged from 64 to 256 μg / ml, indicating that CL18 has good antibacterial activity.

[0080] Example 4 Cytolytic Hemolysis Safety Experiment of Antimicrobial Peptide CL18

[0081] Blood from healthy adult chickens was collected and centrifuged at 1500g for 5 minutes at 4°C. The obtained red blood cells were washed with PBS solution until colorless and transparent, and diluted with PBS solution to a red blood cell concentration of 2%. Then, an equal volume of antimicrobial peptide CL18 was added (the final concentration range in PBS was 0.5-200 μg / mL). After incubation at 37°C for 60 minutes, the light absorption value was measured at 570nm using an ELISA reader. Red blood cells treated with 0.1% Triton X-100 and red blood cells treated with an equal volume of PBS were used as positive and negative controls, respectively. Three replicates were set for each treatment group, and the degree of hemolysis was calculated according to the following formula:

[0082] Hemolysis rate (%) = (absorbance of test tube - absorbance of negative control tube) / (absorbance of positive control tube - absorbance of negative control tube) × 100%.

[0083] The results showed that when the concentration of antimicrobial peptide CL18 was in the range of 0.5 to 200 μg / mL, the cell hemolysis rate was less than 10%. Even when the concentration was 200 μg / mL, the cell hemolysis rate was only about 8.5%, which indicates that the antimicrobial peptide CL18 has good safety.

[0084] Example 5 Animal Experiment of Antimicrobial Peptide CL18

[0085] In order to verify the application prospect of antimicrobial peptide CL18 in the prevention and treatment of salmonellosis, an injection containing antimicrobial peptide CL18 was prepared in this example. The injection contained 200 μg / mL antimicrobial peptide CL18 in sodium chloride (0.9 g / mL) injection.

[0086] Healthy chickens aged 21 days were selected as the research subjects and randomly divided into a control group (injected with normal saline), a streptomycin group, and an antimicrobial peptide CL18 group; the injection volume of each group was 500 μL, the concentration of streptomycin was also 200 μg / mL, and the number of chickens in each group was 10. After the injection, the experimental group was infected with Salmonella, and the number of survival was counted afterwards, and the results are shown in Table 5.

[0087] Table 5 The preventive and therapeutic effects of antimicrobial peptide CL18 injection

[0088] Group 24h survival rate 48h survival rate 72h survival rate Antimicrobial peptide CL18 group 100％ 80％ 80％ Streptomycin group 100％ 90％ 80％ Control group 70％ 50％ 40％

[0089] As can be seen from Table 5, compared with streptomycin, the antimicrobial peptide CL18 can also achieve similar preventive and therapeutic effects and can be used for clinical prevention and treatment.

[0090] In summary, the present invention discloses an antimicrobial peptide CL18 and its application. The amino acid sequence of the antimicrobial peptide CL18 is shown in SEQ ID NO.1. The antimicrobial peptide of the present invention has strong antibacterial ability and can play an antibacterial role at a relatively low concentration. In addition, the antimicrobial peptide of the present invention is not affected by the drug resistance of Salmonella, has a significant inhibitory effect on Salmonella, and can effectively prevent and control salmonellosis. The preparation of the antimicrobial peptide of the present invention into an antimicrobial drug, a feed additive or a feed is of great significance to the healthy development of livestock and poultry farming.

[0091] It should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention rather than to limit it. Although the present invention has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that the technical solutions of the present invention may be modified or replaced by equivalents without departing from the spirit and scope of the technical solutions of the present invention, which should all be included in the scope of the claims of the present invention.

Claims

1. Antimicrobial peptide CL18, characterized in that: The amino acid sequence of the antimicrobial peptide CL18 is shown in SEQ ID NO.1, and the nucleotide sequence is shown in SEQ ID NO.

2.

2. Use of the antimicrobial peptide CL18 as claimed in claim 1 in inhibiting Salmonella.

3. The use according to claim 2, characterized in that: The Salmonella includes Salmonella enterica and Salmonella bongori. Among them, the enteric Salmonella includes enteric Salmonella enterica subsp. enterica, enteric Salmonella salamae, enteric Salmonella arizonae, enteric Salmonella diarizonae, enteric Salmonella houtenae, and enteric Salmonella indica subsp.

4. The use according to claim 2, characterized in that: The minimum inhibitory concentration of the antimicrobial peptide CL18 to enteric Salmonella enterica subspecies is 64 μg / ml; the minimum inhibitory concentration to enteric Salmonella salam subspecies is 32 μg / ml; the minimum inhibitory concentration to enteric Salmonella arizona subspecies is 32 μg / ml; the minimum inhibitory concentration to enteric Salmonella biphasic arizona subspecies is 64 μg / ml; the minimum inhibitory concentration to enteric Salmonella Houghton subspecies is 32 μg / ml; the minimum inhibitory concentration to enteric Salmonella indyka subspecies is 32 μg / ml; and the minimum inhibitory concentration to Salmonella bongori is 64 μg / ml.

5. An antibacterial drug composition, characterized in that: The invention comprises the antimicrobial peptide CL18 or its homologue as claimed in claim 1 and a pharmaceutically active agent or other pharmaceutically acceptable excipients.

6. The antibacterial pharmaceutical composition according to claim 5, characterized in that: The drug is an anti-Salmonella drug.

7. The antibacterial pharmaceutical composition according to any one of claims 5 or 6, characterized in that: The pharmaceutically active agents include antibiotics.

8. The antibacterial pharmaceutical composition according to any one of claims 5, 6 or 7, characterized in that: The dosage form of the antibacterial drug composition includes injection.

9. A feed composition, characterized in that: The method comprises the antimicrobial peptide CL18 or its homologue as claimed in claim 1 and feed components or other nutritionally acceptable auxiliary materials.

10. A preservative composition, characterized in that: It comprises the antimicrobial peptide CL18 or a homologue thereof as claimed in claim 1.

Images