Development, preparation and application of carbapenemase immunochromatography kit

Abstract

The invention discloses development, preparation and application of a carbapenemase immunochromatography kit, and belongs to the technical field of biological medicines. According to comparison of amino acid sequences of five common carbapenemase variants of KPC, IMP, NDM, VIM and OXA48 types, the immunogen is prepared from conserved epitope sequences obtained respectively. A mouse is immunized, and a specific antibody pair which is strong in affinity and can be combined with multiple variants is obtained through multi-platform screening. On the basis, the carbapenemase quintuplet detection kit is developed by utilizing an immunochromatography method, has the advantages of high sensitivity, good specificity, capability of covering various drug-resistant variants, capability of detecting multiple targets at one time and rapidness and convenience in detection, and provides important help for clinical auxiliary diagnosis and medication guidance.

Description

Technical Field

[0001] The invention relates to the development, preparation and application of a carbapenemase immunochromatography kit, belonging to the technical field of biomedicine. Background Art

[0002] Common Enterobacteriaceae in clinical practice include Escherichia coli, Klebsiella pneumoniae, Enterobacter, Proteus and Salmonella. The production of β-lactamase is the main resistance mechanism of Enterobacteriaceae, and the epidemiology of Enterobacteriaceae producing extended-spectrum β-lactamase (ESBL), cephalosporinas (AmpC enzyme) and carbapenemase has attracted much clinical attention. Bacterial resistance will be further enhanced during infectious disease outbreaks and surgical infections. Drug-resistant bacterial infections pose a great challenge and threat to surgical clinics, which will not only lead to the failure of infection treatment, prolong the course of treatment for patients, increase the cost of treatment for patients, but also increase the risk of transmission of drug-resistant bacterial infections, and increase the incidence and mortality of hospital infections. Therefore, antimicrobial resistance has become an urgent global health and socioeconomic crisis. Carbapenem-resistant Enterobacteriaceae (CRE), which are listed as key priority pathogens by the World Health Organization (WHO), have become the focus of attention of all parties.

[0003] The Centers for Disease Control and Prevention (CDC) in the United States defines CRE as Enterobacteriaceae that are not sensitive to any carbapenem antibiotics (i.e., the minimum inhibitory concentration for doripenem, meropenem, or imipenem is ≥4μg / ml or the minimum inhibitory concentration for ertapenem is ≥2μg / ml) or Enterobacteriaceae that have been shown to produce carbapenemases. Carbapenem antibiotics are a class of β-lactam drugs with broad-spectrum antibacterial effects. They inhibit bacterial cell wall synthesis by inhibiting penicillin-binding proteins (PBPs) and were once considered by many hospitals to be the "last resort" in antimicrobial treatment. Currently, CRE isolates are resistant to most clinically used antibiotics, which limits the choice of antibiotics in clinical practice.

[0004] Carbapenemases are a diverse family of β-lactamases that have the ability to hydrolyze and inactivate a wide range of antimicrobial drugs, including penicillins, cephalosporins, monobactams, and carbapenems. These enzymes bind to the drug by breaking the amide bond of the four-membered azadione ring, thereby preventing the drug from binding to penicillin-binding proteins in the bacterial cell wall. Using the Ambler classification system, carbapenemases can be divided into class A, class B, and class D β-lactamases.

[0005] Class A carbapenemases utilize serine residues to hydrolyze β-lactam structures, including three types containing blaKPC, blaNMC / blaIMI, and blaSME genes. Among them, the most common is the blaKPC gene, which is mainly found in Klebsiella pneumoniae, but also in many other Enterobacteriaceae, including Citrobacter freundii, Enterobacter cloacae, Escherichia coli, Serratia marcescens, and Pseudomonas aeruginosa.

[0006] Class B metallo-β-lactamases (MBLs) are zinc-dependent and include three types containing blaVIM, blaIMP, and blaNDM genes, all of which are present on mobile genetic loci and can be horizontally transmitted. Metallo-β-lactamases can hydrolyze a variety of β-lactam antibiotics, but cannot hydrolyze mono-β-lactam antibiotics, such as aztreonam.

[0007] Class D carbapenemases include members of the OXA encoding gene, which are mainly found in Acinetobacter, among which blaOXA-48 is also found in Enterobacteriaceae and is associated with CRE nosocomial infections. blaOXA-48 includes OXA-48 and its related variants OXA-181, OXA-162, and OXA-232.

[0008] At present, the detection methods of carbapenemase-resistant bacteria are mainly divided into two categories: phenotypic detection and molecular detection. The phenotypic detection method is easy to operate, does not require high technical level and large equipment, and has relatively low cost. However, the phenotypic detection cycle is longer, and it is not as good as molecular detection in terms of specificity and sensitivity. Compared with phenotypic detection, molecular detection has extremely high specificity and sensitivity, can provide accurate results in a short time, and helps to take timely treatment measures. However, the cost of molecular detection is high, various large equipment are required, and the technical requirements of the operator are high. In clinical testing, medical staff need to choose appropriate methods for testing based on actual conditions.

[0009] Immunochromatography is a fast and convenient in vitro diagnostic technology that does not require any instrumentation and is not affected by false positives from gene silencing. However, if the expression of the target protein is weak or the key amino acids of the antigen epitope recognized by the antibody used change, false negatives may also occur in immunochromatography. Therefore, it is still urgent for the market to provide a carbapenemase detection product with high sensitivity, good specificity, and coverage of multiple genotypes. Summary of the invention

[0010] In view of the above-mentioned deficiencies in the prior art, the present invention provides the development, preparation and application of a carbapenemase immunochromatography kit, aiming to solve the technical problem that the prior art lacks a detection product with high sensitivity, good specificity and covering multiple genotypes of carbapenemase.

[0011] The first technical solution provided by the present invention is an anti-KPC type carbapenemase antibody, which includes a light chain variable region and a heavy chain variable region, wherein the light chain variable region has a light chain CDR consisting of CDR-L1, CDR-L2, and CDR-L3, and the heavy chain variable region has a heavy chain CDR consisting of CDR-H1, CDR-H2, and CDR-H3, and the amino acid sequences of CDR-L1, CDR-L2, CDR-L3, CDR-H1, CDR-H2, and CDR-H3 are as shown in any one group of (a) to (b):

[0012] (a) SEQ ID NO: 1~3, SEQ ID NO: 5~7;

[0013] (b) SEQ ID NO:9~11, SEQ ID NO:13~15.

[0014] In certain embodiments, the amino acid sequences of the light chain variable region and the heavy chain variable region are as shown in any one of the groups (c) to (d):

[0015] (c) SEQ ID NO:4, SEQ ID NO:8;

[0016] (d) SEQ ID NO: 12, SEQ ID NO: 16.

[0017] The second technical solution provided by the present invention is an anti-IMP type carbapenemase antibody, wherein the anti-IMP type carbapenemase antibody comprises a light chain variable region and a heavy chain variable region, wherein the light chain variable region has a light chain CDR consisting of CDR-L1, CDR-L2, and CDR-L3, and the heavy chain variable region has a heavy chain CDR consisting of CDR-H1, CDR-H2, and CDR-H3, and the amino acid sequences of CDR-L1, CDR-L2, CDR-L3, CDR-H1, CDR-H2, and CDR-H3 are as shown in any one group (e) to (f):

[0018] (e) SEQ ID NO: 17~19, SEQ ID NO: 21~23;

[0019] (f) SEQ ID NO: 25~27, SEQ ID NO: 29~31.

[0020] In certain embodiments, the amino acid sequences of the light chain variable region and the heavy chain variable region are as shown in any one of the groups (g) to (h):

[0021] (g) SEQ ID NO:20, SEQ ID NO:24;

[0022] (h) SEQ ID NO:28, SEQ ID NO:32.

[0023] The third technical solution provided by the present invention is an anti-NDM carbapenemase antibody, wherein the anti-NDM carbapenemase antibody comprises a light chain variable region and a heavy chain variable region, wherein the light chain variable region has a light chain CDR consisting of CDR-L1, CDR-L2, and CDR-L3, and the heavy chain variable region has a heavy chain CDR consisting of CDR-H1, CDR-H2, and CDR-H3, and the amino acid sequences of CDR-L1, CDR-L2, CDR-L3, CDR-H1, CDR-H2, and CDR-H3 are as shown in any one group (i) to (j):

[0024] (i) SEQ ID NO: 33~35, SEQ ID NO: 37~39;

[0025] (j) SEQ ID NO:41~43, SEQ ID NO:45~47.

[0026] In certain embodiments, the amino acid sequences of the light chain variable region and the heavy chain variable region are as shown in any one of the groups (k) to (l):

[0027] (k) SEQ ID NO:36, SEQ ID NO:40;

[0028] (1) SEQ ID NO:44, SEQ ID NO:48.

[0029] The fourth technical solution provided by the present invention is an anti-VIM type carbapenemase antibody, wherein the anti-VIM type carbapenemase antibody comprises a light chain variable region and a heavy chain variable region, wherein the light chain variable region has a light chain CDR consisting of CDR-L1, CDR-L2, and CDR-L3, and the heavy chain variable region has a heavy chain CDR consisting of CDR-H1, CDR-H2, and CDR-H3, and the amino acid sequences of CDR-L1, CDR-L2, CDR-L3, CDR-H1, CDR-H2, and CDR-H3 are as shown in any one group (m) to (n):

[0030] (m) SEQ ID NO: 49~51, SEQ ID NO: 53~55;

[0031] (n) SEQ ID NO: 57~59, SEQ ID NO: 61~63.

[0032] In certain embodiments, the amino acid sequences of the light chain variable region and the heavy chain variable region are as shown in any one of the groups (o) to (p):

[0033] (o) SEQ ID NO:52, SEQ ID NO:56;

[0034] (p) SEQ ID NO:60, SEQ ID NO:64.

[0035] The fifth technical solution provided by the present invention is an anti-OXA48 carbapenemase antibody, wherein the anti-OXA48 carbapenemase antibody comprises a light chain variable region and a heavy chain variable region, wherein the light chain variable region has a light chain CDR consisting of CDR-L1, CDR-L2, and CDR-L3, and the heavy chain variable region has a heavy chain CDR consisting of CDR-H1, CDR-H2, and CDR-H3, and the amino acid sequences of CDR-L1, CDR-L2, CDR-L3, CDR-H1, CDR-H2, and CDR-H3 are as shown in any one group (r) to (s):

[0036] (r) SEQ ID NO: 65~67, SEQ ID NO: 69~71;

[0037] (s) SEQ ID NO: 73~75, SEQ ID NO: 77~79.

[0038] In certain embodiments, the amino acid sequences of the light chain variable region and the heavy chain variable region are as shown in any one of the groups (t) to (u):

[0039] (t) SEQ ID NO: 68, SEQ ID NO: 72;

[0040] (u) SEQ ID NO:76, SEQ ID NO:80.

[0041] The sixth technical solution provided by the present invention is a gene encoding the antibody described in the first technical solution, the antibody described in the second technical solution, the antibody described in the third technical solution, the antibody described in the fourth technical solution, or the antibody described in the fifth technical solution.

[0042] The seventh technical solution provided by the present invention is a recombinant vector carrying the gene described in the sixth technical solution.

[0043] In certain embodiments, the recombinant vector uses plasmid pCMV-C-Flag as an expression vector.

[0044] The eighth technical solution provided by the present invention is a recombinant cell expressing the antibody described in the first technical solution, the antibody described in the second technical solution, the antibody described in the third technical solution, the antibody described in the fourth technical solution or the antibody described in the fifth technical solution, or containing the gene described in the sixth technical solution, or transformed with the recombinant vector described in the seventh technical solution.

[0045] In certain embodiments, the recombinant cell is hosted by a fungus, a bacterium, an animal cell or a plant cell.

[0046] In certain embodiments, the fungus comprises yeast or mold, and the bacteria comprises Escherichia coli.

[0047] In certain embodiments, the animal cells include but are not limited to 293 cells and sf9 cells.

[0048] The ninth technical solution provided by the present invention is a method for preparing an anti-carbapenemase antibody, wherein the method comprises culturing the recombinant cell described in the eighth technical solution to obtain a culture containing the antibody described in the first technical solution, the antibody described in the second technical solution, the antibody described in the third technical solution, the antibody described in the fourth technical solution, or the antibody described in the fifth technical solution.

[0049] The tenth technical solution provided by the present invention is a biologically or chemically labeled product, wherein the product is an antibody labeled with a marker, and the antibody is derived from any one of the following:

[0050] (1) The antibody described in the first technical solution;

[0051] (2) The antibody described in the second technical solution;

[0052] (3) The antibody described in the third technical solution;

[0053] (4) The antibody described in the fourth technical solution;

[0054] (5) The antibody described in the fifth technical solution;

[0055] (6) The culture of the recombinant cells described in the eighth technical solution.

[0056] The eleventh technical solution provided by the present invention is a detection reagent product, which contains the antibody described in the first technical solution, the antibody described in the second technical solution, the antibody described in the third technical solution, the antibody described in the fourth technical solution, the antibody described in the fifth technical solution, or a product containing the biological marker or chemical marker described in the tenth technical solution.

[0057] In certain embodiments, the product comprises a test strip or a test kit.

[0058] The twelfth technical solution provided by the present invention is a carbapenemase multiple detection reagent product, wherein the reagent product comprises at least two antibodies as follows:

[0059] (1) The antibody described in the first technical solution;

[0060] (2) The antibody described in the second technical solution;

[0061] (3) The antibody described in the third technical solution;

[0062] (4) The antibody described in the fourth technical solution;

[0063] (5) The antibody described in the fifth technical solution.

[0064] In certain embodiments, the product comprises a test strip or a test kit.

[0065] The thirteenth technical scheme provided by the present invention is a carbapenemase five-in-one detection kit, the kit includes a detection card, the detection card includes: a PVC base plate, a sample pad, a conjugation pad, a nitrocellulose membrane and a blotting paper; the sample pad, the conjugation pad, the nitrocellulose membrane and the blotting paper are overlapped and pasted on the base plate in sequence; the conjugation pad is sprayed with a marker for the binding of a labeled antibody, a C line and a T line, wherein the C line is fixed with a mouse anti-human IgG antibody, and the T line is fixed with a detection antibody; wherein the labeled antibody and the detection antibody include an anti-KPC type carbapenemase antibody pair, an anti-IMP type carbapenemase antibody pair, an anti-NDM type carbapenemase antibody pair, an anti-VIM type carbapenemase antibody pair and an anti-OXA48 type carbapenemase antibody pair;

[0066] The anti-KPC type carbapenemase antibody pair includes KPC-1 and KPC-2;

[0067] The amino acid sequences of CDR-H1, CDR-H2 and CDR-H3 of KPC-1 are shown in SEQ ID NOs: 1 to 3, respectively; the amino acid sequences of CDRL1, CDR-L2 and CDR-L3 are shown in SEQ ID NOs: 5 to 7, respectively;

[0068] The amino acid sequences of CDR-H1, CDR-H2 and CDR-H3 of KPC-2 are shown in SEQ ID NOs: 9 to 11, respectively; the amino acid sequences of CDRL1, CDR-L2 and CDR-L3 are shown in SEQ ID NOs: 13 to 15, respectively;

[0069] The anti-IMP type carbapenemase antibody pair includes IMP-1 and IMP-2;

[0070] The amino acid sequences of CDR-H1, CDR-H2 and CDR-H3 of IMP-1 are shown in SEQ ID NOs: 17 to 19, respectively; the amino acid sequences of CDRL1, CDR-L2 and CDR-L3 are shown in SEQ ID NOs: 21 to 23, respectively;

[0071] The amino acid sequences of CDR-H1, CDR-H2 and CDR-H3 of IMP-2 are shown in SEQ ID NOs: 25 to 27, respectively; the amino acid sequences of CDRL1, CDR-L2 and CDR-L3 are shown in SEQ ID NOs: 29 to 31, respectively;

[0072] The anti-NDM type carbapenemase antibody pair includes NDM-1 and NDM-2;

[0073] The amino acid sequences of CDR-H1, CDR-H2 and CDR-H3 of NDM-1 are shown in SEQ ID NOs: 33 to 35, respectively; the amino acid sequences of CDRL1, CDR-L2 and CDR-L3 are shown in SEQ ID NOs: 37 to 39, respectively;

[0074] The amino acid sequences of CDR-H1, CDR-H2 and CDR-H3 of NDM-2 are shown in SEQ ID NOs: 41 to 43, respectively; the amino acid sequences of CDRL1, CDR-L2 and CDR-L3 are shown in SEQ ID NOs: 45 to 47, respectively;

[0075] The anti-VIM type carbapenemase antibody pair includes VIM-1 and VIM-2;

[0076] The amino acid sequences of CDR-H1, CDR-H2 and CDR-H3 of VIM-1 are shown in SEQ ID NOs: 49 to 51, respectively; the amino acid sequences of CDRL1, CDR-L2 and CDR-L3 are shown in SEQ ID NOs: 53 to 55, respectively;

[0077] The amino acid sequences of CDR-H1, CDR-H2 and CDR-H3 of VIM-2 are shown in SEQ ID NOs: 57 to 59, respectively; the amino acid sequences of CDRL1, CDR-L2 and CDR-L3 are shown in SEQ ID NOs: 61 to 63, respectively;

[0078] The anti-OXA48 type carbapenemase antibody pair includes OXA48-1 and OXA48-2;

[0079] The amino acid sequences of CDR-H1, CDR-H2 and CDR-H3 of OXA48-1 are shown in SEQ ID NOs: 65 to 67, respectively; the amino acid sequences of CDRL1, CDR-L2 and CDR-L3 are shown in SEQ ID NOs: 69 to 71, respectively;

[0080] The amino acid sequences of CDR-H1, CDR-H2 and CDR-H3 of OXA48-2 are shown in SEQ ID NOs: 73 to 75, respectively; the amino acid sequences of CDRL1, CDR-L2 and CDR-L3 are shown in SEQ ID NOs: 77 to 79, respectively.

[0081] The fourteenth technical solution provided by the present invention is the use of the antibody described in the first technical solution, the antibody described in the second technical solution, the antibody described in the third technical solution, the antibody described in the fourth technical solution or the antibody described in the fifth technical solution, or the gene described in the sixth technical solution, or the expression recombinant vector described in the seventh technical solution, or the recombinant cell described in the eighth technical solution, or the method described in the ninth technical solution, or the biomarker or chemically labeled product described in the tenth technical solution in the preparation of a product for detecting carbapenemase.

[0082] In certain embodiments, the product comprises a reagent, a kit, a detection chip or a biosensor.

[0083] The technical effects of the present invention are as follows:

[0084] The present invention prepares immunogens based on the amino acid sequence comparison of five common variants of carbapenemase, namely KPC, IMP, NDM, VIM and OXA48, and obtains the conservative antigen epitope sequences respectively. Mice are immunized and screened on multiple platforms to obtain specific antibody pairs with strong affinity and binding to multiple variants. Based on this, the present invention uses an immunochromatographic method to develop a carbapenemase five-in-one detection kit, which has the advantages of high sensitivity, good specificity, can cover a variety of drug-resistant variants, detect multiple targets at one time, and detect quickly and conveniently. The detection limit of the kit of the present invention is KPC type carbapenemase is not higher than 600pg / mL; IMP type carbapenemase is not higher than 200pg / mL; NDM type carbapenemase is not higher than 150pg / mL; VIM type carbapenemase is not higher than 300pg / mL; OXA-48 type carbapenemase is not higher than 300pg / mL. The present invention provides important help for clinical auxiliary diagnosis and guiding medication. BRIEF DESCRIPTION OF THE DRAWINGS

[0085] Figure 1 The purification result of the immunogen in the specific embodiment 1 of the present invention;

[0086] Figure 2 The purification results of the KPC, IMP, NDM, VIM, and OXA48 antibody pairs in specific example 2 of the present invention;

[0087] Figure 3 The detection result of the minimum detection limit of the kit in specific embodiment 3 of the present invention. DETAILED DESCRIPTION

[0088] The preferred embodiments of the present invention are described below. It should be understood that the embodiments are for better explaining the present invention and are not used to limit the present invention.

[0089] The raw materials used in the embodiment:

[0090] 1. pET28a vector was purchased from Takara.

[0091] 2. Escherichia coli DH5α and Escherichia coli BL21 (DE3) were purchased from Takara.

[0092] 3. LB liquid medium: prepared with 10 g / L peptone, 5 g / L yeast extract, and 5 g / L sodium chloride. The pH value needs to be adjusted to 7.3±0.1.

[0093] LB solid medium: prepared with 10 g / L peptone, 5 g / L yeast extract, 5 g / L sodium chloride, and 15 g / L agar powder. The pH value needs to be adjusted to 7.3±0.1.

[0094] Serum-free DMEM medium was purchased from Gibco;

[0095] 4. The implementation of the BALB / c mouse immunization process was entrusted to Jiangsu Dongkang Biological Co., Ltd.

[0096] Example 1: Analysis and preparation of immunogens

[0097] (I) Sequence comparison and confirmation

[0098] According to investigation and inquiry, a total of 96 KPC-type carbapenemase gene subtypes have been found, with KPC-2 and KPC-3 being the most common. The proportion of KPC-2 in carbapenem-resistant Klebsiella pneumoniae exceeds 70%; for IMP-type enzymes, the most common is the variant of IMP-1, and blaIMP-4 mainly exists in China; for the 12 reported NDM subtypes, NDM-1 and NDM-5 are still the main prevalent genotypes worldwide; for VIM, 27 subtypes have been found, among which VIM-1 and VIM-2 are the main prevalent genotypes; for OXA-type enzymes, since their discovery, they have been widely spread in Enterobacteriales in Europe, Asia, North Africa and the Middle East, and the most common one in Enterobacteriaceae is OXA-48.

[0099] In summary, the above common epidemic subtypes were selected for sequence comparison to determine the method of preparing immunogens. Sequence comparisons were performed separately: blaKPC-2 (Uniprot: Q93LQ9) and blaKPC-3 (Uniprot: G0ZRI3), which determined the truncations of blaKPC-2 (45-165AA, 175-240AA); blaIMP-1 (Uniprot: A0A6F8V4V7) and blaIMP-4 (Uniprot: A0A2Z2CFN0), which determined the truncations of blaIMP-4 46-235AA; blaNDM-1 (Uniprot: C7C422) and blaNDM-5 (Uniprot: A0A024B4D5), which determined the truncations of blaNDM-1 29-270AA; blaVIM-1 (Uniprot: A0A0F7KYQ8) and blaVIM-2 (Uniprot: Q5U7L7), which determined the truncations of blaVIM-1 21-266AA; blaOXA48 (Uniprot: Q6XEC0), determined to be intercepted at 20-265AA.

[0100] (II) Construction of expression plasmid

[0101] According to the E.coil coding principle, the amino acid sequence was converted into a nucleotide sequence (SEQ ID NO: 81-86), and the conventional double enzyme digestion and ligation techniques in the field of molecular biology were used to construct the expression plasmid on the pET28a vector, which was then transferred into competent cells to obtain positive clones. The positive clones were transformed into E.coli BL21 (DE3) competent cells, cultured and induced for expression, and sent to Universal Biotechnology for sequencing confirmation.

[0102] SEQ ID NO:81

[0103] atgggcgtgtatgcgatggataccggcagcggcgcgaccgtgagctatcgcgcggaagaacgctttccgctgtgcagcagctttaaaggctttctggcggcggcggtgctggcgcgcagccagcagcaggcgggcctgctggataccccgattcgctatggcaaaaacgcgctggtgccgtggagcccgattagcgaaaaatatctgaccaccggcatgaccgtggcggaactgagcgcggcggcggtgcagtatagcgataacgcggcggcgaacctgctgctgaaagaactgggcggcccggcgggcctgaccgcgtttatgcgcagcattggcgataccacctttcgcctggatcgctgggaa

[0104] SEQ ID NO:82

[0105] atgggsggsgatgcgcgcgataccagcagcccgcgcgcggtgaccgaaagcctgcagaaactgaccctgggcagcgcgctggcggcgccgcagcgccagcagtttgtggattggctgaaaggcaacaccaccggcaaccatcgcattcgcgcggcggtgccggcggattgggcggtgggcgataaaaccggcacctgcggcgtgtat

[0106] SEQ ID NO:83

[0107] atgtggggcgtggtgccgaaacatggcctggtggtgctggtggatgcggaagcgtatctgattgataccccgtttaccgcgaaagataccgaaaaactggtgacctggtttgtggaacgcggctataaaattaaaggcagcattagcagccattttcatagcgatagcaccggcggcattgaatggctgaacagccagagcattccgacctatgcgagcgaactgaccaacgaactgctgaaaaaagatggcaaagtgcaggcgaaaaacagctttggcggcgtgaactattggctggtgaaaaacaaaattgaagtgttttatccgggcccgggccataccccggataacctggtggtgtggctgccggaacgcaaaattctgtttggcggctgctttattaaaccgtatggcctgggcaacctgggcgatgcgaacctggaagcgtggccgaaaagcgcgaaactgctgattagcaaatatggcaaagcgaaactggtggtgccgagccatagcgaagcgggcgatgcgagcctgctgaaactgaccctggaacaggcggtgaaaggcctg

[0108] SEQ ID NO:84

[0109] atgggcgaaattcgcccgaccattggccagcagatggaaaccggcgatcagcgctttggcgatctggtgtttcgccagctggcgccgaacgtgtggcagcataccagctatctggatatgccgggctttggcgcggtggcgagcaacggcctgattgtgcgcgatggcggccgcgtgctggtggtggataccgcgtggaccgatgatcagaccgcgcagattctgaactggattaaacaggaaattaacctgccggtggcgctggcggtggtgacccatgcgcatcaggataaaatgggcggcatggatgcgctgcatgcggcgggcattgcgacctatgcgaacgcgctgagcaaccagctggcgccgcaggaaggcatggtggcggcgcagcatagcctgacctttgcggcgaacggctgggtggaaccggcgaccgcgccgaactttggcccgctgaaagtgttttatccgggcccgggccataccagcgataacattaccgtgggcattgatggcaccgatattgcgtttggcggctgcctgattaaagatagcaaagcgaaaagcctgggcaacctgggcgatgcggataccgaacattatgcggcgagcgcgcgcgcgtttggcgcggcgtttccgaaagcgagcatgattgtgatgagccatagcgcgccggatagccgcgcggcgattacccataccgcgcgcatggcggataaactgcgc

[0110] SEQ ID NO:85

[0111] atgagcccgctggcgcatagcggcgaaccgagcggcgaatatccgaccgtgaacgaaattccggtgggcgaagtgcgcctgtatcagattgcggatggcgtgtggagccatattgcgacccagagctttgatggcgcggtgtatccgagcaacggcctgattgtgcgcgatggcgatgaactgctgctgattgataccgcgtggggcgcgaaaaacaccgcggcgctgctggcggaaattgaaaaacagattggcctgccggtgacccgcgcggtgagcacccattttcatgatgatcgcgtgggcggcgtggatgtgctgcgcgcggcgggcgtggcgacctatgcgagcccgagcacccgccgcctggcggaagcggaaggcaacgaaattccgacccatagcctggaaggcctgagcagcagcggcgatgcggtgcgctttggcccggtggaactgttttatccgggcgcggcgcatagcaccgataacctggtggtgtatgtgccgagcgcgaacgtgctgtatggcggctgcgcggtgcatgaactgagcagcaccagcgcgggcaacgtggcggatgcggatctggcggaatggccgaccagcgtggaacgcattcagaaacattatccggaagcggaagtggtgattccgggccatggcctgccgggcggcctggatctgctgcagcataccgcgaacgtggtgaaagcgcataaaaaccgcagcgtggcggaa

[0112] SEQ ID NO:86

[0113] atggcggtggcgaaagaatggcaggaaaacaaaagctggaacgcgcattttaccgaacataaaagccagggcgtggtggtgctgtggaacgaaaacaaacagcagggctttaccaacaacctgaaacgcgcgaaccaggcgtttctgccggcgagcacctttaaaattccgaacagcctgattgc gctggatctgggcgtggtgaaagatgaacatcaggtgtttaaatgggatggccagacccgcgatattgcgacctggaaccgcgatcataacctgattaccgcgatgaaatatagcgtggtgccggtgtatcaggaatttgcgcgccagatggcgaagcgcgcatgagcaaaatgctgcatgcgt ttgattatggcaacgaagatattagcggcaacgtggatagcttttggctggatggcggcattcgcattagcgcgaccgaacagattagctttctgcgcaaactgtatcataacaaactgcatgtgagcgaacgcagccagcgcattgtgaaacaggcgatgctgaccgaagcgaacggcgattat attattcgcgcgaaaaccggctatagcacccgcattgaaccgaaaattggctggtgggtgggctgggtggaactggatgataacgtgtggttt tttgcgatgaacatggatatgccgaccagcgatggcctgggcctgcgccaggcgattaccaaagaagtgctgaaacaggaaaaaattattccg

[0114] (III) Preparation of immunogen

[0115] The above recombinant plasmids were transformed into BL21 (DE3) strains, cultured overnight on LB plates, and single clones were picked and expanded to OD600 of 0.6-0.8. IPTG with a final concentration of 0.8mM was added to induce expression. After 4 hours of expression, the bacteria were collected by centrifugation. The bacteria were resuspended in Tris buffer system and ultrasonically disrupted for 40 minutes. The supernatant after high-speed centrifugation was passed through the balanced Ni-NTA column for binding. The target protein was purified by imidazole buffer gradient elution method, collected separately, and SDS-PAGE electrophoresis was used to verify the protein size and purity. The results are as follows Figure 1 As shown, the purity of the purified recombinant protein is ≥ 95%.

[0116] Among them, KPC expresses protein segments 45-165AA and 175-240AA. Due to its small molecular weight, BSA is selected as the carrier protein of the immunogen. The synthesized polypeptide is coupled with BSA using the SPDP connection method. BSA is dissolved in PBS-EDTA solution, left to stand at room temperature for 1 hour, and excess SPDP is washed off through a HiTrap desalting column. Finally, the target peptide is added to the coupled BSA-SPDP system at room temperature overnight. KPC immunogens can be obtained by mixing BSA-KPC (45-165) and BSA-KPC (175-240) in equal proportions. The remaining purified antigens can be used as immunogens (including IMP immunogens, NDM immunogens, VIM immunogens, and OXA48 immunogens).

[0117] Example 2: Preparation and identification of monoclonal antibodies

[0118] (I) Animal Immunization and Cell Fusion

[0119] The above-mentioned target protein antigen was emulsified with Freund's complete adjuvant, and 5 SPF-grade 8-10-week-old BALB / c female mice were selected and injected subcutaneously. The first immunization used Freund's complete adjuvant, 50 μg / 0.5 ml / mouse, and was intraperitoneally injected; the second immunization was performed at an interval of 3 weeks, using Freund's incomplete adjuvant, with the same dose; the third injection was performed at an interval of 10 days, and before the fourth immunization, the change in the antibody level in the tail vein serum was detected (ELISA method). If the titer did not reach 1:104 and the OD was above 1.0, the immunization was continued. If the titer had been reached, the final immunization was performed, and the immunogen was intraperitoneally injected at 80 μg / mouse for booster immunization, and serum was collected for detection after immunization.

[0120] The conventional cell fusion technology in the field of mouse immunity was used to prepare myeloma cells and immune mouse spleen cells in advance, and the prepared myeloma cells were mixed with mouse spleen cells at a ratio of 1:5, 20 mL of RPMI 1640 culture medium was added, and the supernatant was removed by centrifugation at 1000 rpm, and preheated 50% PEG4000 was immediately added to fuse the cells. After standing for 1 minute, serum-free DMEM culture medium was added to terminate the fusion, and the cells were allowed to stand for 10 minutes at 37°C, then centrifuged and the supernatant was removed. The cells were resuspended in HAT culture medium, distributed into 96-well plates, and cultured in a cell culture incubator for about 10 days until the fused cells covered 20%-50% of the bottom of the well.

[0121] (II) Screening and cloning of hybridoma positive clones

[0122] The ELISA indirect method was used to screen the positive clones of hybridomas. The above immunogens were coated on 96-well plates, and HRP-labeled rabbit anti-mouse IgG was used as the secondary antibody. The serum collected after the eyeballs of immunized mice were removed was used as the positive control, and the supernatant of myeloma SP2 / 0 cells was used as the negative control. The hybrid clones that were positive for the antibody were cloned and cultured, and the hybridoma cells were cultured by the limiting dilution method. Repeat until the positive well rate reached 100%, ensuring that the antibody was produced by a single clone, and then the cells were expanded and cultured.

[0123] When the cell survival rate is less than 50%, the culture medium is collected into a centrifuge bottle, centrifuged at 12000rpm for 10min, and the supernatant is collected and filtered through a 0.45μm filter to remove impurities. The Protein G affinity chromatography column is balanced with binding buffer, and the antibody is purified in this way. After confirmation by SDS-PAGE electrophoresis, it is dialyzed into binding buffer and sampled and sent to Universal Biotech for sequencing.

[0124] A total of 18 secretory antibodies against KPC enzyme were obtained: MKN02, MKN26, MKN35, MKN38, MKN50, MKN52, MKN67, MKN68, MKN99, MKN102, MKN105, MKN134, MKN135, MKN156, MKN160, MKN169, MKN181, and MKN186.

[0125] A total of 6 secretory antibodies of IMP enzymes were obtained: MK22A1, MK28D5, MK35G9, MK46C4, MK56G2, and MK77H6.

[0126] A total of 7 secretory antibodies of NDM enzymes were obtained: MKD029, MKD035, MKD077, MKD089, MKD101, MKD124, and MKD233.

[0127] A total of 8 secretory antibodies against VIM enzyme were obtained: MKV037, MKV066, MKV098, MKV099, MKV111, MKV145, MKV147, and MKV187.

[0128] A total of 10 secretory antibodies against OXA48 enzyme were obtained: MKA009, MKA033, MKA052, MKA061, MKA077, MKA094, MKA118, MKA129, MKA144, and MKA193.

[0129] (III) Antibody pairing and titer testing

[0130] The antibodies were paired using the ELISA double antibody sandwich method, and the pairing results are shown in Tables 1-5.

[0131] Table 1 KPC type antibody pairing results

[0132] Serial number Detection antibodies Labeled Antibodies 1 MKN26 MKN50 2 MKN50 MKN99 3 MKN67 MKN68 4 MKN102 MKN38 5 MKN134 MKN156 6 MKN169 MKN99 7 MKN181 MKN134

[0133] Table 2 IMP type antibody pairing results

[0134] Serial number Detection antibodies Labeled Antibodies 1 MK22A1 MK35G9 2 MK35G9 MK56G2 3 MK35G9 MK77H6 4 MK46C4 MK28D5

[0135] Table 3 NDM type antibody pairing results

[0136]

[0137]

[0138] Table 4 VIM type antibody pairing results

[0139] Serial number Detection antibodies Labeled Antibodies 1 MKV037 MKV111 2 MKV037 MKV099 3 MKV098 MKV066 4 MKV145 MKV187 5 MKV145 MKV147

[0140] Table 5 OXA48 antibody pairing results

[0141] Serial number Detection antibodies Labeled Antibodies 1 MKA009 MKA052 2 MKA061 MKA033 3 MKA094 MKA144 4 MKA118 MKA077 5 MKA118 MKA193 6 MKA129 MKA077

[0142] The immunochromatography platform was used for further screening, and the paired antibodies were finally determined as shown in Table 6.

[0143] Table 6 Determined Antibodies

[0144] Serial number Capture Antibody Labeled Antibodies 1 MKN67(KPC-1) MKN68(KPC-2) 2 MK35G9(IMP-1) MK56G2(IMP-2) 3 MKD233(NDM-1) MKD089(NDM-2) 4 MKV037(VIM-1) MKV099(VIM-2) 5 MKA118(OXA48-1) MKA193(OXA48-2)

[0145] The antibodies in Table 6 were tested for potency, and the specific method was as follows: the IMP enzyme prepared above was diluted with 50 mM Na2CO3 pH9.6 buffer to a final concentration of 1 μg / ml, added to a 96-well plate, coated at 4°C overnight, washed 3 times with 1×PBST, and patted dry; blocked and incubated with PBST containing 2% BSA (purchased from Sigma) for 2 h, washed in the same manner, and then the above antibodies were diluted with 1×PBS buffer at a gradient of 1:10000, 1:20000, 1:40000, 1:80000, 1:160000, 1:320000, 1:640000, 1:1280000, and 1:2560000 to obtain antibody test products of different concentrations. The diluted antibody test product was added to the above ELISA plate and incubated at 37°C for 1 hour; then HRP-goat anti-mouse IgM (purchased from Sigma) diluted 1:4000 was added and incubated at 37°C for 1 hour; finally, TMB substrate was added to develop color at room temperature in the dark for 10 minutes, and sulfuric acid was used to terminate the reaction. The OD450nm value was measured by an ELISA instrument, and the titer of each antibody is shown in Table 7.

[0146] Table 7 Titer test results

[0147] name Potency KPC-1 1：1280000 KPC-2 1：1280000 IMP-1 1：1280000 IMP-2 1：1280000 NDM-1 1：640000 NDM-2 1：640000 VIM-1 1：640000 VIM-2 1：640000 OXA48-1 1：1280000 OXA48-2 1：1280000

[0148] (IV) Preparation and purification of recombinant antibodies

[0149] The antibodies in Table 6 were sent to Sangon Biotechnology for sequencing, and the antibody variable region sequences were obtained, as shown in Table 8.

[0150] Table 8 Antibody variable region sequences

[0151]

[0152]

[0153]

[0154]

[0155]

[0156] The amino acid sequence of the variable region in Table 8 was translated into a nucleotide sequence according to the coding principle of Homo sapiens. The heavy chain variable region of the above-mentioned antibody was grafted onto the nucleotide sequence of the human IgG heavy chain constant region skeleton, and the light chain variable region was grafted onto the nucleotide sequence of the human IgG light chain constant region skeleton through a molecular construction method. The antibody heavy chain variable region and light chain variable region obtained by sequencing were recombined with the constant region of mouse IgG, and constructed into a modified mammalian cell expression vector pCMV-C-Flag to prepare an expression plasmid (the vector was purchased from Biotech, and the human IgG constant region gene was synthesized by Biotech), and was transfected into Expi 293F cells with PEIMax for secretory expression. The process of grafting and constructing a eukaryotic expression plasmid and the reagents or parameters used in each process are not limited. As long as the technology in the prior art can achieve the above purpose, it will not be repeated here. Antibody purification is carried out according to the standard operating procedures for protein purification, and recombinant antibodies are obtained by expression, such as Figure 2 shown.

[0157] (V) Recombinant Antibody Affinity Verification

[0158] The present invention utilizes The detection instrument measures the affinity of the antibodies in Table 6. The above-mentioned IMP enzyme immunogen is fixed at the bottom of the biosensor, which is covered by a biofilm layer. When visible light with a certain bandwidth is incident vertically on the biofilm layer, the light is reflected at the two interfaces of the biofilm layer to form an interference wave of a certain wavelength detected by the spectrometer. The fixed recombinant antigen interacts with antibodies of different concentrations in the buffer, the thickness of the biolayer increases, and the interference spectrum curve moves in the direction of increasing wavelength. The phase shift is detected and analyzed by the workstation, and the kinetic data of the antibody on the sensor surface can be obtained. The saved data is imported into the data analysis module of the BLI instrument, and the affinity (KD=kd / ka) is calculated by fitting the kinetic model. The results are shown in Table 9.

[0159] Table 9 Affinity test

[0160]

[0161] Table 9 shows that the recombinant antibodies still exhibited strong affinity.

[0162] Example 3: Preparation of a carbapenemase five-in-one detection kit

[0163] The present invention uses the antibody pair with strong affinity in Table 6 of Example 2, based on the immunochromatography platform, to further develop a detection kit with high sensitivity and good specificity, the labeled antibody is labeled according to the following labeling method, the detection antibody is streaked according to the following streaking process, and the kit is prepared, and the specific operations are as follows:

[0164] Step 1: Add 200-800 μL of 0.05-0.2M K2CO3 solution dropwise to 100mL colloidal gold solution while stirring. After adding, seal and mix slowly for 2-5 minutes. After mixing, add each labeled antibody in Table 6 dropwise. After adding, seal and mix slowly for 1-10 minutes. Incubate for 30-60 minutes. After incubation, add 10-100mL blocking solution (1-3% BSA) dropwise, mix for 2-5 minutes, let stand and block for 30-60 minutes. After the standing time, continue to seal and mix for 1-10 minutes. After blocking, centrifuge, set parameters: centrifugal force 3000-6000rpm, 2-8℃, centrifugation time 20-60min. After centrifugation, remove the supernatant to obtain the gold-labeled precipitate, and preserve it with preservation solution to obtain the gold-labeled solution;

[0165] Step 2: Label the labeled antibodies of the five indicators according to the above labeling process to obtain a gold label solution, mix the five markers, add 1-20mL of preservation solution, mix evenly, spray the gold label solution on the glass cellulose membrane, and dry it to make a gold label pad;

[0166] Step 3: Add 1-20% sucrose solution to each detection antibody in Table 6, mix well to form a detection line coating solution, then add 1-20% sucrose solution to the goat anti-mouse IgG antibody, mix well to form a quality control line coating solution, and draw 0.5-2 μL / cm of the quality control line coating solution and the detection line coating solution on a nitrocellulose membrane, and obtain a coating plate after drying;

[0167] Step 4: Stick the gold label pad, absorbent paper and sample pad on the PVC base plate in sequence, cut them into 3cm wide test strips and put them into the corresponding card shell.

[0168] Example 4: Performance verification of the carbapenemase five-in-one detection kit

[0169] 1. Detection limit

[0170] The negative samples that had been calibrated were taken to prepare negative matrices, and the above five carbapenemases were diluted in multiple concentration gradients (KPC was diluted to 1000, 800, 600, 500, 400, 300, and 200 pg / mL; IMP was diluted to 1000, 800, 600, 400, 200, 100, and 50 pg / mL; NDM was diluted to 1000, 500, 250, 200, 150, 100, and 50 pg / mL; VIM was diluted to 1000, 500, 250, 200, 150, 100, and 50 pg / mL). The dilutions were 1000, 800, 600, 400, 300, 200, and 100 pg / mL for OXA48; 1000, 800, 600, 400, 300, 200, and 100 pg / mL for OXA48. The kit of Example 3 was used for detection 20 times at each concentration gradient. The detection was continued for 3 days. The color development and positive situation of the detection results of each concentration were observed. The lowest concentration with a positive detection rate of 95% and consistent color development was taken as the detection limit.

[0171] According to the above result judgment method, the detection limit of the kit of the present invention is KPC type carbapenemase is not higher than 600pg / mL; IMP type carbapenemase is not higher than 200pg / mL; NDM type carbapenemase is not higher than 150pg / mL; VIM type carbapenemase is not higher than 300pg / mL; OXA-48 type carbapenemase is not higher than 300pg / mL ( Figure 3 ).

[0172] 2. Cross-reaction

[0173] The common strains that do not produce carbapenemase were tested using the kit of Example 3, and the test results were all negative. It can be seen that there is no cross reaction between the listed strains and the test strips.

[0174] Table 10 Cross-substance impact test results

[0175] name Strain number Cross-test results Escherichia coli ATCC 25922 KNIVO- Klebsiella pneumoniae ATCC 1706 KNIVO- Genitrobacter cloacae ATCC 13047 KNIVO- Pseudomonas aeruginosa ATCC 9027 KNIVO- Acinetobacter baumannii ATCC 19606 KNIVO-

[0176] The above strains were purchased from the American Type Culture Collection (ATCC).

[0177] 3. Interference experiment

[0178] Negative matrix and critical positive samples were selected as basic samples and a certain concentration of interfering substances were added to confirm whether a certain concentration of interfering substances would affect the test results.

[0179] Table 11 Interfering substances affect test results

[0180]

[0181]

[0182] The results in the above table show that the kit of the present invention can effectively resist the interference of endogenous and exogenous substances.

[0183] 4. Stability

[0184] Positive samples and negative samples with three different antibody concentrations were used as research materials, and three batches of the kit described in Example 2 were stored at 2-8°C, 20±2°C, and 30±2°C for 27 months. The test time was 0th month, 4th month, 8th month, 12th month, 16th month, 20th month, 24th month, 26th month, and 27th month to evaluate the stability of the kit. The results are shown in Tables 12 to 14.

[0185] Table 12 Test kit (storage 2~8℃)

[0186]

[0187]

[0188] Table 13 Test kit test (storage 20±2℃)

[0189]

[0190]

[0191] Table 14 Test kit test (storage at 30±2℃)

[0192]

[0193]

[0194] As can be seen from the above table, the test kit was stored at 2-8°C, 20±2°C and 30±2°C for 27 months, and was tested using strongly positive, moderately positive, weakly positive and negative samples at 0th month, 4th month, 8th month, 12th month, 16th month, 20th month, 24th month, 26th month and 27th month, respectively. The test results met the requirements and the test kit has excellent stability.

[0195] Although the present invention has been disclosed as above in the form of a preferred embodiment, it is not intended to limit the present invention. Anyone familiar with this technology can make various changes and modifications without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be based on the definition of the claims.

Claims

1. An anti-NDM carbapenemase antibody, characterized in that: The anti-NDM carbapenemase antibody comprises a light chain variable region and a heavy chain variable region, wherein the light chain variable region has a light chain CDR consisting of CDR-L1, CDR-L2, and CDR-L3, and the heavy chain variable region has a heavy chain CDR consisting of CDR-H1, CDR-H2, and CDR-H3, and the amino acid sequences of CDR-L1, CDR-L2, CDR-L3, CDR-H1, CDR-H2, and CDR-H3 are as shown in any one of the groups (i) to (j): (i) SEQ ID NO: 33~35, SEQ ID NO: 37~39; (j) SEQ ID NO:41~43, SEQ ID NO:45~47.

2. The antibody according to claim 1, characterized in that The amino acid sequences of the light chain variable region and the heavy chain variable region are shown in any one of groups (k) to (l): (k) SEQ ID NO:36, SEQ ID NO:40; (1) SEQ ID NO:44, SEQ ID NO:

48.

3. Anti-VIM type carbapenemase antibody, characterized in that: The anti-VIM type carbapenemase antibody comprises a light chain variable region and a heavy chain variable region, wherein the light chain variable region has a light chain CDR consisting of CDR-L1, CDR-L2, and CDR-L3, and the heavy chain variable region has a heavy chain CDR consisting of CDR-H1, CDR-H2, and CDR-H3, and the amino acid sequences of CDR-L1, CDR-L2, CDR-L3, CDR-H1, CDR-H2, and CDR-H3 are as shown in any one of the groups (m) to (n): (m) SEQ ID NO: 49~51, SEQ ID NO: 53~55; (n) SEQ ID NO: 57~59, SEQ ID NO: 61~63.

4. The antibody according to claim 3, characterized in that The amino acid sequences of the light chain variable region and the heavy chain variable region are shown in any one of groups (o) to (p): (o) SEQ ID NO:52, SEQ ID NO:56; (p) SEQ ID NO:60, SEQ ID NO:

64.

5. Anti-OXA48 type carbapenemase antibody, characterized in that The anti-OXA48 type carbapenemase antibody comprises a light chain variable region and a heavy chain variable region, wherein the light chain variable region has a light chain CDR consisting of CDR-L1, CDR-L2, and CDR-L3, and the heavy chain variable region has a heavy chain CDR consisting of CDR-H1, CDR-H2, and CDR-H3, and the amino acid sequences of CDR-L1, CDR-L2, CDR-L3, CDR-H1, CDR-H2, and CDR-H3 are as shown in any one group (r) to (s): (r) SEQ ID NO: 65~67, SEQ ID NO: 69~71; (s) SEQ ID NO: 73~75, SEQ ID NO: 77~79.

6. The antibody according to claim 5, characterized in that The amino acid sequences of the light chain variable region and the heavy chain variable region are shown in any one of the groups (t) to (u): (t) SEQ ID NO: 68, SEQ ID NO: 72; (u) SEQ ID NO:76, SEQ ID NO:

80.

7. A gene encoding the antibody according to any one of claims 1 to 6.

8. A recombinant vector carrying the gene according to claim 7.

9. A recombinant cell expressing the antibody according to any one of claims 1 to 6, or containing the gene according to claim 7, or transformed with the recombinant vector according to claim 8.

10. The recombinant cell according to claim 9, characterized in that The recombinant cell uses bacteria, fungi, animal cells or plant cells as hosts; optionally, the fungi include yeast or mold, the bacteria include Escherichia coli, and the animal cells include 293 cells and sf9 cells.

11. A method for preparing an anti-carbapenemase antibody, characterized in that: The method comprises culturing the recombinant cell according to claim 9 or 10 to obtain a culture containing the antibody according to any one of claims 1 to 6.

12. A biologically or chemically labeled product, wherein the product is an antibody labeled with a marker, and the antibody is derived from any of the following: (1) The antibody according to any one of claims 1 to 6; (2) A culture of the recombinant cell according to claim 9 or 10.

13. A detection reagent product, characterized in that: The detection reagent product contains the antibody according to any one of claims 1 to 6, or contains the biomarker or chemical marker according to claim 12; optionally, the product includes a test paper or a test kit.

14. A carbapenemase multiple detection reagent product, characterized in that: The reagent product includes at least two antibodies as follows: (1) an anti-KPC type carbapenemase antibody, the anti-KPC type carbapenemase antibody comprising a light chain variable region and a heavy chain variable region, the light chain variable region having a light chain CDR consisting of CDR-L1, CDR-L2, and CDR-L3, the heavy chain variable region having a heavy chain CDR consisting of CDR-H1, CDR-H2, and CDR-H3, the amino acid sequences of CDR-L1, CDR-L2, CDR-L3, CDR-H1, CDR-H2, and CDR-H3 being as shown in any one of the groups (a) to (b): (a) SEQ ID NOs: 1 to 3, SEQ ID NOs: 5 to 7; (b) SEQ ID NOs: 9 to 11, SEQ ID NOs: 13 to 15; (2) an anti-IMP type carbapenemase antibody, the anti-IMP type carbapenemase antibody comprising a light chain variable region and a heavy chain variable region, the light chain variable region having a light chain CDR consisting of CDR-L1, CDR-L2, and CDR-L3, the heavy chain variable region having a heavy chain CDR consisting of CDR-H1, CDR-H2, and CDR-H3, the amino acid sequences of CDR-L1, CDR-L2, CDR-L3, CDR-H1, CDR-H2, and CDR-H3 being as shown in any one of the groups (e) to (f): (e) SEQ ID NOs: 17 to 19, SEQ ID NOs: 21 to 23; (f) SEQ ID NOs: 25 to 27, SEQ ID NOs: 29 to 31; (3) The antibody according to claim 1 or 2; (4) The antibody according to claim 3 or 4; (5) The antibody according to claim 5 or 6.

15. A carbapenemase five-in-one detection kit, characterized in that: The test kit comprises a test card, which comprises: a PVC base plate, a sample pad, a conjugation pad, a nitrocellulose membrane and absorbent paper; the sample pad, the conjugation pad, the nitrocellulose membrane and the absorbent paper are overlapped and pasted on the base plate in sequence; the conjugation pad is sprayed with a marker for the binding of a labeled antibody, a C line and a T line, wherein the C line is fixed with a mouse anti-human IgG antibody, and the T line is fixed with a detection antibody; wherein the labeled antibody and the detection antibody comprise an anti-KPC carbapenemase antibody pair, an anti-IMP carbapenemase antibody pair, an anti-NDM carbapenemase antibody pair, an anti-VIM carbapenemase antibody pair and an anti-OXA48 carbapenemase antibody pair; The anti-KPC type carbapenemase antibody pair includes KPC-1 and KPC-2; The amino acid sequences of CDR-H1, CDR-H2 and CDR-H3 of KPC-1 are shown in SEQ ID NOs: 1 to 3, respectively; the amino acid sequences of CDRL1, CDR-L2 and CDR-L3 are shown in SEQ ID NOs: 5 to 7, respectively; The amino acid sequences of CDR-H1, CDR-H2 and CDR-H3 of KPC-2 are shown in SEQ ID NOs: 9 to 11, respectively; the amino acid sequences of CDRL1, CDR-L2 and CDR-L3 are shown in SEQ ID NOs: 13 to 15, respectively; The anti-IMP type carbapenemase antibody pair includes IMP-1 and IMP-2; The amino acid sequences of CDR-H1, CDR-H2 and CDR-H3 of IMP-1 are shown in SEQ ID NOs: 17 to 19, respectively; the amino acid sequences of CDRL1, CDR-L2 and CDR-L3 are shown in SEQ ID NOs: 21 to 23, respectively; The amino acid sequences of CDR-H1, CDR-H2 and CDR-H3 of IMP-2 are shown in SEQ ID NOs: 25 to 27, respectively; the amino acid sequences of CDRL1, CDR-L2 and CDR-L3 are shown in SEQ ID NOs: 29 to 31, respectively; The anti-NDM type carbapenemase antibody pair includes NDM-1 and NDM-2; The amino acid sequences of CDR-H1, CDR-H2 and CDR-H3 of NDM-1 are shown in SEQ ID NOs: 33 to 35, respectively; the amino acid sequences of CDRL1, CDR-L2 and CDR-L3 are shown in SEQ ID NOs: 37 to 39, respectively; The amino acid sequences of CDR-H1, CDR-H2 and CDR-H3 of NDM-2 are shown in SEQ ID NOs: 41 to 43, respectively; the amino acid sequences of CDRL1, CDR-L2 and CDR-L3 are shown in SEQ ID NOs: 45 to 47, respectively; The anti-VIM type carbapenemase antibody pair includes VIM-1 and VIM-2; The amino acid sequences of CDR-H1, CDR-H2 and CDR-H3 of VIM-1 are shown in SEQ ID NOs: 49 to 51, respectively; the amino acid sequences of CDRL1, CDR-L2 and CDR-L3 are shown in SEQ ID NOs: 53 to 55, respectively; The amino acid sequences of CDR-H1, CDR-H2 and CDR-H3 of VIM-2 are shown in SEQ ID NOs: 57 to 59, respectively; the amino acid sequences of CDRL1, CDR-L2 and CDR-L3 are shown in SEQ ID NOs: 61 to 63, respectively; The anti-OXA48 type carbapenemase antibody pair includes OXA48-1 and OXA48-2; The amino acid sequences of CDR-H1, CDR-H2 and CDR-H3 of OXA48-1 are shown in SEQ ID NOs: 65 to 67, respectively; the amino acid sequences of CDRL1, CDR-L2 and CDR-L3 are shown in SEQ ID NOs: 69 to 71, respectively; The amino acid sequences of CDR-H1, CDR-H2 and CDR-H3 of OXA48-2 are shown in SEQ ID NOs: 73 to 75, respectively; the amino acid sequences of CDRL1, CDR-L2 and CDR-L3 are shown in SEQ ID NOs: 77 to 79, respectively.

16. Use of the antibody according to any one of claims 1 to 6, or the gene according to claim 7, or the expression recombinant vector according to claim 8, or the recombinant cell according to claim 9 or 10, or the method according to claim 11, or the biomarker or chemically labeled product according to claim 12 in the preparation of a product for detecting carbapenemase.

Images