An anti-dsDNA antibody or its antigen-binding fragment and its application

Abstract

This invention discloses an anti-dsDNA antibody or its antigen-binding fragment and its applications, relating to the field of biodetection technology. The anti-dsDNA antibody or its antigen-binding fragment provided by this invention includes a heavy chain variable region and a light chain variable region; the amino acid sequence of the heavy chain variable region is shown in SEQ ID NO.1; the amino acid sequence of the light chain variable region is shown in SEQ ID NO.2. The detection reagent provided by this invention contains the above-mentioned anti-dsDNA antibody or its antigen-binding fragment. The anti-dsDNA antibody or its antigen-binding fragment provided by this invention solves the problems of tracing positive blood samples and large-scale supply. Using the scheme of this invention, high-titer, high-accuracy, and stable anti-dsDNA or its antigen-binding fragment can be prepared, providing a high-performance raw material source for the preparation of calibrators / positive controls / quality control products for anti-dsDNA detection kits.

Description

Technical Field

[0001] This invention relates to the field of biological detection technology, and in particular to an anti-dsDNA antibody or its antigen-binding fragment and its applications. Background Technology

[0002] Autoimmunity refers to the immune system's reaction against its own tissues, leading to autoimmune diseases. Normally, the immune system can recognize and attack foreign pathogens, but when it malfunctions, it may mistakenly attack its own tissues, causing disease.

[0003] Autoimmune diseases include many types, such as rheumatoid arthritis, systemic lupus erythematosus, and scleroderma. These diseases vary in symptoms and severity, but all are related to abnormal responses of the immune system.

[0004] The exact causes of autoimmune diseases are currently unclear, but they are likely related to a variety of factors, including genetics, environment, and infection. Treatment methods for autoimmune diseases include drug therapy and immunomodulatory therapy. Early diagnosis and treatment can effectively control disease progression and alleviate symptoms.

[0005] Anti-double-stranded DNA antibody is a serological marker for systemic lupus erythematosus (SLE) and one of the most frequently tested laboratory indicators in clinical practice. This antibody is mainly found in the serum of SLE patients and plays a pathogenic role in tissue and organ damage. SLE is a common chronic autoimmune disease whose pathogenesis and mechanism are not yet fully understood. It is generally believed to be caused by dysregulation of cellular and humoral immunity, impaired normal immune tolerance, leading to an immune response against the body's own tissues and resulting in tissue damage.

[0006] Anti-DNA antibodies are classified into three types: anti-ds-DNA, anti-ss-DNA, and anti-z-DNA. Anti-ds-DNA, which reacts only with ds-DNA, has high specificity for systemic lupus erythematosus (SLE), but its clinical occurrence is extremely rare. Anti-ds-DNA antibodies that are usually detected refer to antibodies that react with both ds-DNA and ss-DNA. Currently, it is believed that complement-binding anti-ds-DNA antibodies play an important role in the pathogenesis of SLE, especially in the development of lupus nephritis. Dynamic observation has revealed that anti-DNA antibodies are already present in the bloodstream before clinical relapse. Nephritis associated with SLE is an immune complex disease mediated by anti-DNA. Therefore, anti-ds-DNA antibodies have been included in the diagnostic criteria for SLE in both the United States and China. Patients with other connective tissue diseases may also test positive for anti-ds-DNA, but these patients are generally considered to have SLE overlap syndrome. Antiss-DNA antibodies have poor specificity and can be detected in other connective tissue diseases, drug-induced lupus, and chronic active hepatitis, in addition to systemic lupus erythematosus.

[0007] Stable internal quality control products can effectively monitor the precision and accuracy of test results. However, most commercially available anti-dsDNA antibody quality control products on the market are human positive serology, which is difficult to source, exhibits significant batch-to-batch variability, is produced in small batches, is imported, and is expensive, thus limiting the clinical application of the test products. Therefore, there is an urgent need to independently develop anti-dsDNA antibodies that can be mass-produced and possess high affinity and specificity for routine quality control in clinical laboratories. Summary of the Invention

[0008] The technical problem to be solved by the present invention is to provide an anti-dsDNA antibody or its antigen-binding fragment and its application, so as to solve the problems of unstable source of raw materials, large batch-to-batch differences and low specificity of existing quality control antibodies.

[0009] To address the above problems, the present invention proposes the following technical solution:

[0010] In a first aspect, the present invention provides an anti-dsDNA antibody or an antigen-binding fragment thereof, comprising a heavy chain variable region and a light chain variable region;

[0011] The amino acid sequence of the heavy chain variable region is shown in SEQ ID NO.1; and the amino acid sequence of the light chain variable region is shown in SEQ ID NO.2.

[0012] The antibody or its antigen-binding fragment is a monoclonal antibody or a polyclonal antibody. The monoclonal antibody can be developed using various methods and techniques, including hybridoma technology, phage display technology, and single lymphocyte gene cloning technology.

[0013] Furthermore, the anti-dsDNA antibody or its antigen-binding fragment further includes a heavy chain constant region, which comprises:

[0014] The amino acid sequence is CH1 as shown in SEQ ID NO.3;

[0015] Hinge with the amino acid sequence shown in SEQ ID NO.4; and

[0016] The amino acid sequence is Fc as shown in SEQ ID NO.5.

[0017] Furthermore, the heavy chain constant region is selected from the conserved amino acid sequence of the human IgG1 heavy chain constant region.

[0018] Furthermore, the anti-dsDNA antibody or its antigen-binding fragment further includes a light chain constant region CL, the amino acid sequence of which is shown in SEQ ID NO.6.

[0019] Furthermore, the light chain constant region CL is selected from the conserved amino acid sequence of the human IgG1 light chain constant region.

[0020] Furthermore, the heavy chain amino acid sequence of the anti-dsDNA antibody or its antigen-binding fragment is shown in SEQ ID NO.7, and the light chain amino acid sequence is shown in SEQ ID NO.8.

[0021] The preparation method of the antibody or its antigen-binding fragment is a conventional method in the art. Preferably, the preparation method involves isolating the antibody or its antigen-binding fragment from a host cell expressing the antibody or its antigen-binding fragment, or obtaining it through artificial synthesis of a protein sequence. The method of isolating the antibody or its antigen-binding fragment from a host cell expressing the antibody or its antigen-binding fragment is preferably as follows: cloning a nucleic acid molecule encoding the antibody or its antigen-binding fragment and carrying a point mutation into a vector, transforming the resulting vector into host cells, and culturing the resulting host cells to isolate and purify the antibody or its antigen-binding fragment.

[0022] In a second aspect, the present invention provides a nucleic acid molecule encoding the anti-dsDNA antibody or its antigen-binding fragment described in the first aspect.

[0023] Furthermore, the heavy chain variable region nucleotide sequence of the anti-dsDNA antibody or its antigen-binding fragment is shown in SEQ ID NO.9, and the light chain variable region nucleotide sequence is shown in SEQ ID NO.10.

[0024] Furthermore, the anti-dsDNA antibody or its antigen-binding fragment has the following nucleotide sequences: CH1 region of the heavy chain constant region as shown in SEQ ID NO.11; Hinge region as shown in SEQ ID NO.12; and Fc region as shown in SEQ ID NO.13.

[0025] Furthermore, the nucleotide sequence of the light chain constant region CL of the anti-dsDNA antibody or its antigen-binding fragment is shown in SEQ ID NO.14.

[0026] Furthermore, the heavy chain nucleotide sequence of the anti-dsDNA antibody or its antigen-binding fragment is shown in SEQ ID NO. 15, and the light chain nucleotide sequence is shown in SEQ ID NO. 16.

[0027] The method for preparing the nucleic acid molecule is a conventional method in the art. Preferably, it includes the following steps: obtaining a nucleic acid molecule encoding the antibody or its antigen-binding fragment by gene cloning technology, or obtaining a nucleic acid molecule encoding the antibody or its antigen-binding fragment by artificial full-sequence synthesis.

[0028] Those skilled in the art will understand that the base sequence encoding the amino acid sequence of the antibody or its antigen-binding fragment can be appropriately substituted, deleted, altered, inserted, or added to provide a polynucleotide homologue. The polynucleotide homologues of this invention can also be prepared by substituting, deleting, or adding one or more bases of the gene encoding the antibody or its antigen-binding fragment sequence while maintaining antibody activity, and are also included in this invention.

[0029] Thirdly, the present invention provides a carrier comprising the nucleic acid molecules described in the second aspect.

[0030] The vector can be obtained by conventional methods in the art, namely, by linking the nucleic acid molecule described in this invention to various expression vectors. The expression vector can be any conventional vector in the art, as long as it can accommodate the aforementioned nucleic acid molecule. Preferably, the vector includes various plasmids, granules, bacteriophages, or viral vectors, etc.

[0031] Fourthly, the present invention provides a host cell comprising the aforementioned nucleic acid molecule or the aforementioned vector.

[0032] The method for preparing the host cells is a conventional method in the art, preferably involving the transformation of the aforementioned vector into host cells. The host cells can be any type of conventional host cell in the art, as long as they enable the vector to replicate stably and the carried nucleic acid to be effectively expressed. Preferably, the host cells are E. coli TG1 or BL21 cells (expressing single-chain antibodies or Fab antibodies), or CHO-K1 cells (expressing full-length IgG antibodies). Transforming the aforementioned recombinant expression plasmid into host cells yields the preferred host cells of this invention. The transformation method is a conventional method in the art, preferably a chemical transformation, heat shock, or electroporation.

[0033] The present invention also provides the use of the aforementioned anti-dsDNA antibody or its antigen-binding fragment for detecting the presence or level of anti-dsDNA antibody in a sample, or in preparing a kit for detecting the presence or level of anti-dsDNA antibody in a sample.

[0034] Fifthly, the present invention provides a detection reagent comprising the anti-dsDNA antibody or its antigen-binding fragment as described in the first aspect.

[0035] In a sixth aspect, the present invention provides a kit comprising the aforementioned anti-dsDNA antibody or its antigen-binding fragment, or the aforementioned detection reagent.

[0036] The present invention also provides the use of the aforementioned anti-dsDNA antibody or its antigen-binding fragment in detecting the presence or level of anti-dsDNA antibody in a sample, or in preparing a kit for detecting the presence or level of anti-dsDNA antibody in a sample; or the use of the aforementioned detection reagent or kit in detecting the presence or level of anti-dsDNA antibody in a sample.

[0037] It should be noted that kits typically include one or more assay reagents containing the specific antibody to be measured, which can serve as a quality control, positive control, or standard. Standards are used to establish a standard curve assigned values ​​by antibody concentration, or a single positive control can be used near positive / negative cutoff values. Preferably, standards or positive controls are prepared using the specific antibody to be measured or a chemically similar material. Ideally, standards or controls are manufactured to interact with other assay components in a manner similar to that of the test analyte (specific antibody). Multiple standards are typically included, containing different concentrations of specific antibody spanning the concentration range of the analyte. When the assay reagent is used as a standard, positive control, or quality control for anti-dsDNA antibody detection, the concentration of the anti-dsDNA antibody in the assay reagent is specified, i.e., defined, and its concentration can be adjusted as needed for the assay.

[0038] Of course, the kit also includes other necessary detection reagent components for detecting anti-dsDNA antibodies, such as chemiluminescent immunoassay reagent components, specifically such as solid-phase carrier components coated with dsDNA antigens and labeled antibody reagent components.

[0039] In other aspects, the present invention also provides a method for screening anti-dsDNA antibodies or antigen-binding fragments thereof, the specific steps of which are as follows:

[0040] S1. Collect positive whole blood from patients with autoimmune dsDNA;

[0041] S2. Separate lymphocytes from the positive whole blood and extract RNA;

[0042] S3. Using the RNA obtained in step S2 as a template, reverse transcription was used to synthesize cDNA. Then, the obtained cDNA was used as a template for PCR amplification. The amplification product was ligated to a vector and electroporated into TG1 competent cells to construct a gene library of anti-dsDNA antibody or its antigen-binding fragment.

[0043] S4. Amplify the phage gene library, add helper phage, add IPTG to induce expression, and obtain a protein display library of anti-dsDNA antibody or its antigen-binding fragment;

[0044] S5. Perform at least three rounds of panning with biotinylated dsDNA antigen to obtain phages containing specific anti-dsDNA antibodies or their antigen-binding fragments;

[0045] S6. Perform phage sequencing to obtain the gene sequence of the anti-dsDNA antibody or its antigen-binding fragment, then perform molecular cloning and recombinant expression to obtain the anti-dsDNA antibody or its antigen-binding fragment.

[0046] Compared with the prior art, the technical effects achieved by the present invention include:

[0047] The anti-dsDNA antibody or its antigen-binding fragment provided by this invention solves the problems of tracing positive blood samples and large-scale supply. Applying the method of this invention, high-titer, high-accuracy, and stable anti-dsDNA or its antigen-binding fragment can be prepared, providing a high-performance raw material source for the preparation of calibrators / positive controls / quality control products for anti-dsDNA detection kits. Attached Figure Description

[0048] Figure 1 The above are the agarose gel electrophoresis results of RNA extracted from positive whole blood in this invention;

[0049] Figure 2 The results of agarose gel electrophoresis of the heavy chain variable region amplified in this invention;

[0050] Figure 3 The results of agarose gel electrophoresis of the light chain variable region amplified in this invention;

[0051] Figure 4 The results of ScFv fragment amplification according to the present invention;

[0052] Figure 5 The results of SDS-PAGE analysis show the high affinity and specificity of the anti-dsDNA antibody obtained by screening in this invention.

[0053] Figure 6 The results are obtained by immunoblotting membrane strip detection of the dsDNA antibody of the present invention. Detailed Implementation

[0054] The technical solutions in the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the embodiments described below are only some embodiments of the present invention, and not all embodiments. All other embodiments obtained by those skilled in the art based on the embodiments of the present invention without creative effort are within the scope of protection of the present invention.

[0055] Example 1: Construction of ScFv phage display library and screening of anti-dsDNA antibodies

[0056] 1.1 Positive blood collection

[0057] Collect 2 mL of positive whole blood from 30 dsDNA autoimmune patients aged 20-50 years.

[0058] 1.2 Lymphocyte isolation and total RNA extraction

[0059] Lymphocytes were isolated from the collected positive whole blood using the QIAamp RNABlood Mini kit (50) instructions. Total RNA was extracted according to the Trizol kit instructions, dissolved in RNase-free water as needed, and stored. The results were detected by agarose gel electrophoresis. Figure 1 As shown. Note that all materials used in the entire process must be RNase-free, and you must wear a mask during the operation to prevent yourself from introducing RNases that could lead to RNA degradation.

[0060] 1.3 Amplification of antibody heavy chain variable regions and light chain variable regions

[0061] Following the instructions of the Takara PrimeScript™ II 1st strand cDNA synthesis kit, cDNA was synthesized by reverse transcription using the RNA obtained in step 1.2 as a template. The resulting cDNA was then used as a template for PCR to amplify the heavy chain variable region and light chain variable region sequences. The PCR reaction conditions and program were: 95℃ for 5 minutes; 95℃ for 30 seconds, 55℃ for 60 seconds, 68℃ for 60 seconds, 30 cycles; 68℃ for 5 minutes. The PCR products were identified by 1.2% agarose gel electrophoresis. The heavy chain variable region gene length was approximately 375 bp; the light chain variable region gene length was approximately 330 bp. Primer sequences are shown in Table 1, and the agarose gel electrophoresis results for the heavy chain and light chain variable regions are shown in Table 1. Figure 2 and Figure 3 As shown.

[0062] Table 1. Primers for amplification of heavy chain variable regions and light chain variable regions.

[0063]

[0064]

[0065] 1.4 Amplification of the ScFv fragment

[0066] Using the amplified heavy chain and light chain variable regions as templates, PCR was performed with specific primers. The PCR reaction conditions and program were: 95℃ for 5 minutes; 95℃ for 30 seconds, 55℃ for 60 seconds, 68℃ for 60 seconds, 30 cycles; 68℃ for 5 minutes. The PCR products were identified by 1.2% agarose gel electrophoresis, and the ScFv fragment gene length was approximately 750 bp. Primer sequences are shown in Table 2; ScFv gel electrophoresis results are shown below. Figure 4 As shown.

[0067] Table 2 Primer sequences for amplification of ScFv fragments

[0068] Primer name Primer sequence MH-VH-scFv-F gtcctcgcaccatggcc MHkappaCLscFv-NotI raccgcctccgcggccgcgaagacagatggtgcagccacagt MH-VH-scFv-F gtcctcgcaccatggcc MHLambdaCLscFv-NotI raccgcctccgcggccgcagaggasggygggaacagagtgac

[0069] 1.5 Construction of antibody gene libraries

[0070] The pCANTAB-5E vector and the second-round amplification products were double-digested with Not I and Nco I, respectively. The digested products were recovered using a gel extraction kit, and ligation was performed using T4 DNA ligase. The ligation products were purified using a PCR product purification kit. All purified ligation products were added to 50 μL of TG1 electroporation competent cells and electroporated under the following conditions: 1 mm electroporation cuvette, 1800 V. After resuscitation culture, 10 μL of serially diluted products were plated, and the colony count was calculated to obtain an antibody library capacity of 2.4 × 10⁻⁶. 8 .

[0071] 1.6 Phage Library Amplification

[0072] Take 50 μL of the above bacterial library and inoculate it into 50 mL of 2*YT medium containing 2% glucose and ampicillin. Incubate at 37°C and 220 rpm until OD600 = 0.5. Add 500 μL of helper phage M13KO7 and incubate at 37°C for 1 h. Centrifuge and replace with 50 μg / mL kanamycin and 100 μg / mL ampicillin. Incubate overnight at 26°C and 220 rpm. Centrifuge and collect 40 mL of the supernatant. Add 10 mL of PEG / NaCl (20% / 2.5M) solution and mix thoroughly. Centrifuge again and discard the supernatant. Wash the precipitate with 1 mL of ice-cold PBS and centrifuge at high speed to remove insoluble matter.

[0073] 1.7 Antibody Screening

[0074] Streptomycin-avidin magnetic beads were blocked with 3% milk-PBS for 2 hours, and a phage library was blocked simultaneously for 1 hour. An appropriate amount of biotinylated dsDNA antigen was added to the blocked phage library, and the mixture was stirred at 36°C for 1 hour. The blocked magnetic beads were then added, and the mixture was washed 10 times with PBST. The antigen-bound phages were eluted with 0.2M glycine solution. The eluted phages were transfected with TG1 and then entered the next round of selection. The selection process was repeated, and after three rounds of selection, positive clones were verified by ELISA, yielding an antibody with high affinity, named dsDNA-18G4. Sequencing analysis of dsDNA-18G4 revealed the heavy chain variable region amino acid sequence as shown in SEQ ID NO.1, encoding the nucleotide sequence as shown in SEQ ID NO.9, and the light chain variable region amino acid sequence as shown in SEQ ID NO.2, encoding the nucleotide sequence as shown in SEQ ID NO.10.

[0075] Example 2: Preparation and Performance Verification of dsDNA Antibody Recombination

[0076] 2.1 Gene Synthesis

[0077] 2.1.1 This embodiment provides an anti-dsDNA antibody comprising a light chain and a heavy chain. The light chain amino acid composition, from the N-terminus to the C-terminus, is VL-CL, with sequences SEQ ID NO.2–SEQ ID NO.6; the heavy chain amino acid composition, from the N-terminus to the C-terminus, is VH-CH1-Hinge-Fc, with sequences SEQ ID NO.1-SEQ ID NO.3-SEQ ID NO.4-SEQ ID NO.5.

[0078] 2.1.2 Based on the anti-dsDNA antibody sequence, the Kozak sequence (gccacc), signal peptide sequence (SEQ ID NO. 17), and stop codon sequence (taa) were introduced and sent to a gene synthesis company (Qingke) for codon optimization and gene synthesis.

[0079] SEQ ID N017: Signal peptide sequence

[0080] atggactggacgtggcggattctctctttcttgttgcagcagcaaccggagcacatagc.

[0081] 2.2 Construction of antibody expression vector

[0082] 2.2.1 Amplification of antibody heavy and light chain fragments

[0083] Using the synthesized light and heavy chain genes as templates, the PCR reaction solution was prepared according to the following composition: 50 ng DNA template, 1 μL forward primer, 1 μL reverse primer, 5 μL 10xExTaq buffer, 0.25 μL HS ExTaq, and then ddH2O was added to a final volume of 50 μL. Reaction conditions: 98℃ for 3 minutes; 94℃ for 50 seconds, 55℃ for 30 seconds, 68℃ for 40 seconds, for 40 cycles; extension at 72℃ for 10 minutes. The DNA was recovered and its concentration determined, and stored at -20℃ for a short period.

[0084] Table 3: Primer sequences for heavy and light chain amplification

[0085]

[0086] 2.2.2 pcDNA 3.1 Vector digestion, vector-antibody ligation

[0087] The vector digestion reaction system is as follows: Take 5 μg pcDNA3.1 empty vector, 2 μL Hind III, 2 μL EcoR I, 10 μL 10x buffer, and add ddH2O to a final volume of 100 μL. Incubate at 37℃ for 1 h. Perform 1% agarose gel electrophoresis, recover the DNA and determine its concentration, and store at -20℃ for a short period.

[0088] The vector-antibody ligation system is as follows: Take 50 ng of vector fragment, 10 ng of antibody fragment, 5 μg of 2x buffer, 1 μL of seamless cloning ligase, and add ddH2O to a final volume of 10 μL. Incubate at 37℃ for 30 min.

[0089] 2.2.3 Plate coating and sequencing

[0090] The transformation system was as follows: 100 μL of Top10 competent cells and 10 μL of ligation reaction solution were mixed and incubated on ice for 30 min. The cells were then heat-shocked at 42℃ for 90 s and incubated on ice for 5 min. The cells were then plated on LB agar plates containing 100 μg / mL ampicillin and incubated overnight at 37℃. Single colonies were picked and cultured in LB liquid medium containing 100 μg / mL ampicillin at 37℃ and 220 rpm for 6 h, and then sent for sequencing.

[0091] 2.2.4 Plasmid Extraction

[0092] Sequence alignment and sequencing results were used to inoculate bacterial culture with the correct sequence into 400 mL of LB broth containing 100 μg / mL ampicillin antibiotic, and incubate overnight at 37°C and 220 rpm in a shaker. Plasmids were extracted using a plasmid large-scale extraction kit (OMEGA, D6924-04), and plasmid concentration was measured using a UV spectrophotometer. The plasmids were then stored at -20°C for later use.

[0093] 2.3 Preparation of anti-dsDNA antibody

[0094] 2.3.1 Resuscitate 293F cells with serum-free medium (Expi 293 medium) until the density reaches 3-5 × 10⁻⁵. 6 When cells / mL, follow 0.5×10 6 Cell passages were performed every 3-4 days, with a passage ratio of 3 cells / mL. Cells were passaged for 3 generations, at a rate of 3 × 10⁶ cells / mL. 6 Cells / mL, passaged in 500mL / flask, take 250μg of extracted heavy chain plasmid and 300μg of light chain plasmid, and use 25mL of serum-depleted medium (Opti-MEM). TM Mix well; take 1.65 mL of PEI (1 mg / mL), mix with 25 mL of serum-free medium (Expi 293 medium), then add PEI to the plasmid, mix well, let stand for 15 min, then add to 500 mL of passaged cells, and place in a shaker for culture (culture conditions are 37℃, 8% CO2, 120 rpm).

[0095] 2.3.2 24 hours after plasmid addition, feed additives (0.5% enhancer 1 and 5% enhancer 2) were added, followed by culturing for 4-6 days until the cell density reached approximately 60%. The cells were centrifuged at 1000 rpm for 10 min at room temperature. The supernatant was collected, centrifuged at 12000 rpm for 30 min at room temperature, filtered through a 0.22 μm filter, and the quality control antibody was purified using Protein G (Cytiva) packing material. The antibody was dialyzed against PBS and then ultrafiltered. Protein concentration was detected using a spectrophotometer, and protein purity was determined by SDS-PAGE. The results are shown in Table 4. Figure 5 .

[0096] Table 4. Results of plasmid concentration enhancement

[0097] - Heavy chain Light chain Concentration (ng / μL) 1152 1241 Volume (mL) 2.2 2.2

[0098] Table 5. Antibody Concentration Detection Results

[0099] - dsDNA antibody Expression volume (mL) 500 Detected concentration (mg / mL) 3.38 Final yield (mg / L) 44.7

[0100] 2.4 ELISA activity verification of antibodies

[0101] The expressed antibodies were then detected using the ELISA method. The dsDNA antigen was coated onto the enzyme-labeled strip and incubated overnight at 4°C, followed by three washes. The strip was blocked with blocking buffer and incubated at 37°C for 2 hours, followed by three washes. The sample was added and incubated at 37°C for 30 minutes, followed by three washes. Human secondary antibody (HRP) was added and incubated at 37°C for 30 minutes, followed by three washes. Color development was performed for 10 minutes, at which point the assay was terminated, and the readings were taken. The results are shown in Table 6 below.

[0102] Table 6 Results of dsDNA antibody ELISA activity assay

[0103]

[0104] Example 3: Antibody Stability Verification

[0105] In this embodiment, the anti-dsDNA antibody was prepared into a quality control product using negative blood for stability assessment.

[0106] 3.1 Thermal stability: The prepared dsDNA quality control sample was divided into four equal portions, 1 mL each. One portion was placed at -20℃ as a control, and the other three portions were placed at 37℃. One portion was taken out at day 7, day 14, and one month, and then placed at -20℃. After one month, the four quality control samples were tested, and the ELISA results of the samples taken at each time point were compared with those of the samples stored at -20℃.

[0107] 3.2 Freeze-thaw stability: The prepared dsDNA quality control sample was divided into four equal portions, 1 mL each. One portion was placed at -20℃ as a control, while the other three portions were placed at -20℃ and then subjected to freeze-thaw cycles of 3, 5, and 10 times, respectively. After collecting the samples, their activity was analyzed by ELISA. The results are shown in Table 7.

[0108]

[0109] According to ELISA results, the anti-dsDNA antibody of this invention, after one month of accelerated stability testing at 37°C, exhibited performance comparable to the control group (stored at -20°C), indicating good antibody stability. After three freeze-thaw cycles, its activity remained similar to that before freezing and thawing; however, after five freeze-thaw cycles, its activity significantly decreased. The antibody of this invention demonstrates satisfactory thermal stability and should not be stored for more than five freeze-thaw cycles.

[0110] Example 4: Application of Western blotting of dsDNA antibodies

[0111] 4.1 Prepare the reagent kit (antinuclear antibody spectrum IgG detection kit, DL1590-6401-3G) and operate according to the kit's instruction manual.

[0112] 4.1.1 All reagents must be equilibrated at room temperature (18-25°C) for 30 minutes before use.

[0113] 4.1.2 Antigen-coated detection strips: Use directly. To prevent condensation, the packaging should only be opened after the strip has equilibrated to room temperature. After removing the strip, immediately reseal the original packaging and store it at 2–8°C.

[0114] 4.1.3 Washing Buffer: 10x concentrated. Use a clean pipette to draw the required amount from the bottle and dilute with distilled water 1:10. If incubating one test strip, dilute 1 mL of concentrated buffer with 9 mL of distilled water. The diluted buffer should be used within the same working day.

[0115] 4.1.4 Sample buffer: Use directly.

[0116] 4.1.5 Substrate solution: Use directly. It is light-sensitive and the cap should be tightened immediately after use.

[0117] 4.1.6 Enzyme Conjugate: 10-fold concentrated. When using, use a clean pipette to draw the required amount of enzyme conjugate from the vial and dilute it 1:10 with sample buffer. If incubating one detection strip is required, dilute 0.15 mL of enzyme conjugate with 1.35 mL of sample buffer. Diluted enzyme conjugate should be used within the same working day.

[0118] 4.1.7 dsDNA antibody dilution: Dilute the dsDNA antibody 1:101 with sample buffer. For example, dilute 15 μL of dsDNA antibody with 1.5 mL of sample buffer and mix thoroughly. The diluted dsDNA should be used within the same working day.

[0119] 4.2 Immunoblot detection

[0120] 4.2.1 Preprocessing:

[0121] Remove the required membrane strip and place it in the incubation bath with the numbered side facing up. Add 1.5 mL of sample buffer to each incubation bath and incubate at room temperature on a shaking incubator for 5 minutes. Then, aspirate the liquid from the incubation bath.

[0122] 4.2.2 dsDNA antibody incubation

[0123] Add 1.5 mL of diluted dsDNA antibody to each incubator and incubate on a rocking incubator at room temperature (18℃~25℃) for 30 minutes.

[0124] 4.2.3 Cleaning:

[0125] Remove the liquid from the tank, and wash the membrane strip three times with 1.5 mL of washing buffer on a shaker for 5 minutes each time.

[0126] 4.2.4 Incubation of enzyme conjugates:

[0127] Add 1.5 mL of diluted enzyme conjugate (alkaline phosphatase-labeled anti-human IgG) to the incubation bath and incubate at room temperature for 30 minutes on a rocking incubator.

[0128] 4.2.5 Cleaning:

[0129] Remove the liquid from the tank, and wash the membrane strip three times with 1.5 mL of washing buffer on a shaker for 5 minutes each time.

[0130] 4.2.6 Substrate incubation:

[0131] Add 1.5 mL of substrate solution to each incubator and incubate at room temperature (18℃~25℃) in the dark for 10 minutes on a shaking incubator.

[0132] 4.2.8 Result Interpretation:

[0133] Place the test strip in the result judgment template, air dry, and then judge the result.

[0134] See results Figure 6 Based on the membrane strip results, the anti-dsDNA antibody of the present invention can specifically bind to the dsDNA antigen and can be used for dsDNA autoimmune detection.

[0135] In the above embodiments, the descriptions of each embodiment have different focuses. For parts that are not described in detail in a certain embodiment, please refer to the relevant descriptions in other embodiments.

[0136] The above description describes specific embodiments of the present invention, but the scope of protection of the present invention is not limited thereto. Any person skilled in the art can easily conceive of various equivalent modifications or substitutions within the technical scope disclosed in the present invention, and these modifications or substitutions should all be covered within the scope of protection of the present invention. Therefore, the scope of protection of the present invention should be determined by the scope of the claims.

Claims

1. An anti-dsDNA antibody or its antigen-binding fragment, characterized in that, Includes variable regions of heavy chains and variable regions of light chains; The amino acid sequence of the heavy chain variable region is shown in SEQ ID NO. 1; The amino acid sequence of the variable region of the light chain is shown in SEQ ID NO.

2.

2. The anti-dsDNA antibody or its antigen-binding fragment as described in claim 1, characterized in that, It also includes a heavy chain constant region, which includes: The amino acid sequence is CH1 as shown in SEQ ID NO. 3; The amino acid sequence Hinge is shown in SEQ ID NO. 4; and The amino acid sequence is Fc as shown in SEQ ID NO.

5.

3. The anti-dsDNA antibody or its antigen-binding fragment as described in claim 1, characterized in that, It also includes the light chain constant region CL, the amino acid sequence of which is shown in SEQ ID NO.

6.

4. The anti-dsDNA antibody or its antigen-binding fragment as described in any one of claims 1-3, characterized in that, The heavy chain amino acid sequence of the anti-dsDNA antibody or its antigen-binding fragment is shown in SEQ ID NO. 7, and the light chain amino acid sequence is shown in SEQ ID NO.

8.

5. A nucleic acid molecule, characterized in that, Encodes the anti-dsDNA antibody or antigen-binding fragment thereof as described in any one of claims 1-4.

6. A carrier, characterized in that, It includes the nucleic acid molecule as described in claim 5.

7. A host cell, characterized in that, It comprises the nucleic acid molecule of claim 5 or the vector of claim 6.

8. A detection reagent, characterized in that, The detection reagent comprises the anti-dsDNA antibody or its antigen-binding fragment as described in any one of claims 1-4, wherein the anti-dsDNA antibody or its antigen-binding fragment serves as a positive control.

9. A reagent kit, characterized in that, It includes the anti-dsDNA antibody or its antigen-binding fragment as described in any one of claims 1-4, or the detection reagent as described in claim 8, wherein the anti-dsDNA antibody or its antigen-binding fragment is used as a positive control.

10. Use of the anti-dsDNA antibody or antigen-binding fragment thereof according to any one of claims 1-4 in the preparation of a kit for detecting the presence or level of anti-dsDNA antibody in a sample, wherein the anti-dsDNA antibody or antigen-binding fragment thereof is used as a positive control.

Images