Salt-tolerant enterobacter quasi DY1 and application thereof in improving salt stress resistance of corn

Abstract

The invention belongs to the technical field of agricultural microorganisms, and particularly discloses a salt-tolerant enterobacter quasi and application of the salt-tolerant enterobacter quasi, the strain is salt-tolerant enterobacter quasi DY1 and is preserved in the China Center for Type Culture Collection on November 7, 2024, and the preservation number is CCTCC M 20242450. The salt-tolerant enterobacter quasi DY1 is a salt-tolerant enterobacter quasi DY1, and the salt-tolerant enterobacter quasi DY1 is a salt-tolerant enterobacter quasi DY1 and is preserved in the China Center for Type Culture Collection on November 7, 2024. The strain provided by the invention is resistant to salt, can produce auxin and siderophore, and has the capabilities of dissolving inorganic phosphorus, fixing nitrogen and dissolving potassium. The invention further explores the effect of the strain DY1 on the growth of the corn seedlings and the salt stress resistance of the corn seedlings, and the result shows that the strain DY1 can obviously promote the growth of the corn seedlings, enhance the salt stress resistance of the corn seedlings and improve the growth indexes such as plant height, stem diameter, fresh weight, dry weight and the like of the corn seedlings in low-salt and high-salt environments. Discovery and application of the strain are beneficial to improvement of production of crops such as corn, and especially in saline-alkali areas, the strain has the potential of being developed into microbial fertilizers and has high agricultural application prospects and economic value.

Description

Technical Field

[0001] The invention belongs to the technical field of agricultural microorganisms and relates to a salt-tolerant Enterobacter d'Esternii DY1 and its application in promoting the growth of corn seedlings and improving the salt stress resistance of corn seedlings. Background Art

[0002] Soil salinization is a major issue affecting crop yield and quality. In salinized areas, soils have high salt content and poor physical structure. Excessive salt in the soil disrupts the ion balance, exposing plants to osmotic and ionic stress. This hinders their ability to absorb nutrients and water, impacting their growth and development, and in severe cases, leading to plant death.

[0003] Plant growth-promoting rhizobacteria (PGPR) play a key role in improving plant tolerance. PGPR maintain water balance, provide nutrients to maintain hormone levels, produce growth hormones, and have functions such as nitrogen fixation, phosphate solubilization, and potassium solubilization. Indirectly, PGPR can inhibit the adverse effects of soil pathogens or adverse environmental conditions on plant growth by producing metabolites such as siderophores and antibiotics. Furthermore, PGPR can regulate the abundance and community composition of soil bacteria, improve soil enzyme activity, and enhance soil microbial diversity, maintaining soil health and promoting plant growth. Numerous studies in recent years have demonstrated that PGPR can colonize the rhizosphere of plants, inducing resistance or tolerance mechanisms in plants, altering plant physiology and biochemistry, and alleviating the damage caused by salt stress. PGPR also produce osmotic regulators, exopolysaccharides, and volatile compounds to ensure normal plant growth under salt stress. Furthermore, some PGPR enhance plant salt tolerance by regulating the expression of genes and proteins associated with salt tolerance. The rational and effective use of PGPR has become an effective approach to achieving green and efficient agriculture.

[0004] The PGPRs that have been isolated so far mainly include Pseudomonas, Bacillus, Paenibacillus, etc., which can promote the growth of a variety of crops. For example, in crops such as rice, wheat, corn and tomatoes, these plant rhizosphere growth-promoting bacteria have shown good efficacy. However, the bacterial resources currently used in actual saline environments are still underdeveloped, and the discovered colonies have certain limitations in the scope of application and methods of use; and there are few applications of Enterobacter juncea that has multiple growth-promoting functions such as solubilizing phosphate, solubilizing potassium, fixing nitrogen and producing iron carriers, and can survive in saline-alkali environments. Therefore, the salt-tolerant Enterobacter juncea and its application provided by the present invention are problems that urgently need to be solved in this field. Summary of the Invention

[0005] To address the shortcomings of the existing technology, the present invention aims to provide a salt-tolerant Enterobacter d'enzimidazole DY1 strain. This strain exhibits excellent nitrogen fixation, phosphate solubilization, and potassium solubilization capabilities, and can secrete auxins, promoting plant growth in saline environments, particularly corn, with excellent performance in increasing plant height, stem diameter, fresh weight, and dry weight. Another object of the present invention is to provide methods for using this salt-tolerant Enterobacter d'enzimidazole DY1.

[0006] The present invention is achieved through the following technical solutions:

[0007] A salt-tolerant Enterobacter quasiroggenkampii, the strain is salt-tolerant Enterobacter quasiroggenkampii (Enterobacter quasiroggenkampii) DY1, which was deposited in the China Center for Type Culture Collection on November 7, 2024, with the preservation number CCTCC M 20242450.

[0008] A further improvement of the present invention is:

[0009] A bacterial suspension or culture solution or fermentation product containing the salt-tolerant Enterobacter juncea.

[0010] Furthermore, the use of the bacterial suspension, culture solution or fermentation product in any one of the following (01)-(05):

[0011] (01) Promote the growth of plants damaged by salt;

[0012] (02) Preparation of products that promote plant growth;

[0013] (03) Preparation of products for nitrogen fixation, phosphorus dissolution, potassium dissolution, and siderophore production;

[0014] (04) preparing a product producing IAA;

[0015] (05) As plant rhizosphere growth-promoting bacteria.

[0016] Furthermore, the above-mentioned salt-tolerant Enterobacter davidianus is used to promote the growth of corn seedlings.

[0017] Furthermore, the above-mentioned salt-tolerant Enterobacter daubensis is used to improve the salt stress resistance of corn seedlings.

[0018] The beneficial effects of the present invention are:

[0019] The strain of the present invention is salt-tolerant, can produce auxin and siderophores, and has the ability to fix nitrogen and dissolve inorganic phosphorus and potassium. Strain DY1 can significantly promote the growth of corn seedlings, enhance their resistance to salt stress, and improve growth indicators such as plant height, stem diameter, fresh weight, and dry weight in both low-salt and high-salt environments. The discovery and application of this strain will help improve the production of crops such as corn, especially in saline-alkali areas. The strain has the potential to be developed into a microbial fertilizer, with high agricultural application prospects and economic value. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 This is the colony morphology of strain DY1.

[0021] Figure 2 is the phylogenetic tree of 16S rRNA of strain DY1.

[0022] Figure 3 is the growth diameter of strain DY1 in different salt concentrations.

[0023] Figure 4 is the growth diameter of strain DY1 at different pH values.

[0024] Figure 5 It is the plate dissolution zone of strain DY1 for potassium solubilization, siderophore solubilization, nitrogen fixation, and inorganic phosphorus solubilization.

[0025] Figure 6 This is a qualitative graph of the production of elongin by strain DY1.

[0026] Figure 7 This is the effect of strain DY1 on the physiological traits of corn under different salt concentrations.

[0027] Figure 8 This is the growth status of corn after applying strain DY1 under different salt concentrations. DETAILED DESCRIPTION

[0028] The present invention will be described in detail below with reference to specific embodiments.

[0029] Unless otherwise specified, the experimental methods in the examples were all performed in a conventional manner, and the materials, reagents, etc. used in the examples were all obtained from commercial sources unless otherwise specified.

[0030] The formula of the relevant culture medium in the embodiment is:

[0031] Beef extract liquid culture medium: 5 g beef extract, 10 g peptone, 5 g sodium chloride, 1 L distilled water, pH 7.2-7.4.

[0032] LB liquid medium: 10 g of peptone, 10 g of sodium chloride, 5 g of yeast extract powder, 1 L of distilled water, pH 7.0-7.2.

[0033] Nitrogen-fixing liquid culture medium: mannitol 10 g, sodium chloride 0.2 g, magnesium sulfate heptahydrate 0.2 g, calcium carbonate 5 g, calcium sulfate 0.1 g, potassium dihydrogen phosphate 0.2 g, distilled water 1 L, pH 7.0-7.2.

[0034] Inorganic phosphorus liquid culture medium: 10 g glucose, 0.5 g ammonium sulfate, 0.5 g yeast extract powder, 0.3 g sodium chloride, 0.3 g potassium chloride, 0.3 g magnesium sulfate, 0.03 g ferrous sulfate, 0.03 g manganese sulfate, 5 g tricalcium phosphate, 1 L distilled water, pH 7.0-7.5.

[0035] Silicate liquid culture medium: sucrose 5 g, magnesium sulfate heptahydrate 0.5 g, calcium carbonate 0.1 g, disodium hydrogen phosphate 2 g, ferric chloride 0.005 g, potassium feldspar powder 1 g, distilled water 1 L, pH 7.0-7.5.

[0036] CAS detection medium (purchased from Qingdao Haibo Biotechnology Co., Ltd.): chrome azurol 0.0605 g, cetyltrimethylammonium bromide 0.0729 g, ferric chloride hexahydrate 0.002645 g, disodium hydrogen phosphate dihydrate 1.2135 g, ammonium chloride 0.125 g, potassium dihydrogen phosphate 0.375 g, sodium chloride 0.625 g, agar 9 g, and distilled water 1 L.

[0037] The culture media containing different concentrations of sodium chloride increased or decreased the sodium chloride content according to the concentration; except for CAS medium, the above culture media are liquid culture media, and solid culture media are supplemented with 15 g of agar per liter.

[0038] Example 1

[0039] This example is used to illustrate the screening and isolation of strain DY1.

[0040] (1) Screening and isolation of strains:

[0041] Root soil samples of golden grass were collected from saline-alkali land in Lijin County, Dongying City, Shandong Province, placed in 50 mL sterile centrifuge tubes, marked, placed in an ice box, brought back to the laboratory, and stored at -20°C for later use.

[0042] The centrifuge tube containing the plant root sample was vortexed at 2000 r / min for 10 minutes, the soil from the root was shaken off and collected and stored. 0.5 g of soil sample was weighed and added to 50 mL of sterile water, mixed and vortexed at 2000 r / min for 5 minutes, and then rested for 30 seconds. In the clean bench, 1 mL of soil suspension was taken and mixed in 9 mL of sterile water for gradient dilution to make 10 －2 , 10 －3 , 10 －4 , 10 －5Draw 200 μL of each soil suspension and evenly spread it on beef extract peptone solid culture medium containing 4% NaCl. Incubate it upside down in a 35°C incubator for 12 hours. The colonies that grow are salt-tolerant strains. Pick different single colonies for separation and purification. Repeat the separation and purification until a pure culture strain is obtained.

[0043] (2) Storage of strains:

[0044] The obtained single colonies were marked and stored using the glycerol freezing method and the slant culture method for later use.

[0045] Glycerol storage: The purified strain was inoculated into beef extract peptone liquid culture medium and cultured at 28°C and 180 rpm for 24 h. After culture, the bacterial liquid was mixed with 50% glycerol at a ratio of 1:1 and stored in a -80°C refrigerator for later use.

[0046] Slant culture preservation: The purified strain was inoculated into a beef extract peptone slant solid culture medium test tube and cultured at 35°C for 24 hours, then stored in a 4°C refrigerator for later use.

[0047] Among the screened strains, one strain was white, had neat round edges, a moist and smooth surface, and a suitable growth temperature of 28-35°C. It was preliminarily determined to be the strain of the present invention, hereinafter referred to as strain DY1.

[0048] Example 2

[0049] This example is used to illustrate the 16S rRNA identification of strain DY1.

[0050] Molecular biological identification involved extracting genomic DNA from strain DY1 from Wuhan Qingke Biotechnology Co., Ltd. PCR amplification was performed using 16S rRNA-specific primers, followed by purification of the amplified product and DNA sequencing. A BLAST search of homologous sequences in NCBI was performed based on the sequenced 16S rRNA gene sequence. Based on this comparison, the strain was analyzed and identified. Homologous gene sequences were selected from the homology database and analyzed using MEGA-X software to construct a phylogenetic tree to determine the taxonomic status of strain DY1.

[0051] The results of PCR product sequencing of the 16S rRNA gene sequence showed that the 16S rRNA gene sequence of strain DY1 was 1394 bp in length. The results were compared with the nucleic acid sequence data in the NCBI database ( Figure 2), strain DY1 belongs to the same branch as Enterobacter and is most closely related to Enterobacter quasiroggenkampii strain WCHECL1060 (NR_179166.1) with a similarity of 99.71%, confirming that strain DY1 is Enterobacter quasiroggenkampii.

[0052] The 16S rRNA gene sequence of strain DY1 is as follows:

[0053] >DY1

[0054] ACGAGCGGCGGACGGGTGAGTAATGTCTGGGAAACTGCCTGATGGAGGGGGATAACTA

[0055] CTGGAAACGGTAGCTAATACCGCATAACGTCGCAAGACCAAAGAGGGGGACCTTCGGG

[0056] CCTCTTGCCATCAGATGTGCCCAGATGGGATTAGCTAGTAGGTGGGGTAATGGCTCACCT

[0057] AGGCGACGATCCCTAGCTGGTCTGAGAGGATGACCAGCCACACTGGAACTGAGACACG

[0058] GTCCAGACTCCTACGGGAGGCAGCAGTGGGGAATATTGCACAATGGGCGCAAGCCTGAT

[0059] GCAGCCATGCCGCGTGTATGAAGAAGGCCTTCGGGTTGTAAAGTACTTTCAGCGGGGAG

[0060] GAAGGTGTTGAGGTTAATAACCTCAGCAATTGACGTTACCCGCAGAAGAAGCACCGGCT

[0061] AACTCCGTGCCAGCAGCCGCGGTAATACGGAGGGTGCAAGCGTTAATCGGAATTACTGG

[0062] GCGTAAAGCGCACGCAGGCGGTCTGTCAAGTCGGATGTGAAATCCCCGGGCTCAACCT

[0063] GGGAACTGCATTCGAAACTGGCAGGCTAGAGTCTTGTAGAGGGGGTAGAATTCCAGG

[0064] TGTAGCGGTGAAATGCGTAGAGATCTGGAGGAATACCGGTGGCGAAGGCGGCCCCCTG

[0065] GACAAAGACTGACGCTCAGGTGCGAAAGCGTGGGGAGCAAACAGGATTAGATACCCTG

[0066] GTAGTCCACGCCGTAAACGATGTCGACTTGGAGGTTGTGCCCTTGAGGCGTGGCTTCCG

[0067] GAGCTAACGCGTTAAGTCGACCGCCTGGGAGTACGGCCGCAAGGTTAAAACTCAAAT

[0068] GAATTGACGGGGGCCCGCACAAGCGGTGGAGCATGTGGTTTAATTCGATGCAACGCGA

[0069] AGAACCTTACCTACTCTGACATCCAGAGAACTTACCAGAGATGCTTTGGTGCCTTCGG

[0070] GAACTCTGAGACAGGTGCTGCATGGCTGTCGTCAGCTCGTGTTGTGAAATGTTGGGTTA

[0071] AGTCCCGCAACGAGCGCAACCCTTATCCTTTGTTGCCAGCGGTTAGGCCGGGAACTCAA

[0072] AGGAGACTGCCAGTGATAAACTGGAGGAAGGTGGGATGACGTCAAGTCATCATGGCC

[0073] CTTACGAGTAGGGCTACACACGTGCTACAATGGCCATCAAAAGAGAAGCGACCTCGCG

[0074] AGAGCAAGCGGACCTCATAAAGTGCGTCGTAGTCCGGATTGGAGTCTGCAACTCGACTC

[0075] CATGAAGTCGGAATCGCTAGTAATCGTAGATCAGAATGCTACGGTGAATACGTTCCCGGG

[0076] CCTTGTACACACCGCCCGTCACACCATGGGAGTGGGTTGCAAAAGAAGTAGGTAGCTTA

[0077] ACCTTCGGGAGGGCGCTTACCACTTTGTGATTCATGACTGGGGTG

[0078] Example 3

[0079] This example is used to illustrate the salt-alkali tolerance of strain DY1.

[0080] (1) Salt tolerance test of strain DY1

[0081] After activation, the strain was spotted onto beef extract peptone solid culture medium containing different sodium chloride concentrations (0%, 2%, 4%, 6%, 8%, 10%, 12%, where 0% is the original beef extract peptone solid culture medium formula), repeated 3 times, and cultured inverted at 35°C for 3 days. The shape of the colony was observed at 24h, 48h and 72h, and the colony diameter was measured and recorded.

[0082] The colonies of strain DY1 grew to varying degrees over time on media containing different concentrations of sodium chloride ( Figure 3 ).

[0083] (2) Determination of pH tolerance of strain DY1

[0084] The pH value of beef extract peptone solid culture medium was adjusted with 1 mol / L HCl and 1 mol / L NaOH solution. Five gradient acid-base plates with pH values ​​of 6, 7, 8, 9, and 10 were set. After the strain was activated, it was spotted on the acid-base plates with different pH values ​​in sequence. Each plate was repeated 3 times. The culture was inverted at 35°C for 3 days. The growth status of the colony was observed and recorded every 24 hours, and the diameter of the colony was measured and recorded.

[0085] The colonies of strain DY1 grew to varying degrees over time on different pH media ( Figure 4 ).

[0086] Example 4

[0087] This example is used to illustrate that strain DY1 has the functions of nitrogen fixation, siderophore production, inorganic phosphorus and potassium solubilization, and growth hormone production.

[0088] (1) Determination of potassium solubilization ability of strain DY1

[0089] Qualitative analysis: After the strain DY1 was activated, it was inoculated on silicate solid culture medium and cultured inverted at 28℃ for one week, repeated 3 times. Transparent and oil droplet-like colonies appeared around the strain DY1, indicating that the strain DY1 could dissolve potassium feldspar and had potassium-dissolving properties ( Figure 5 -A).

[0090] (2) Qualitative determination of siderophore production by strain DY1

[0091] After the isolated strain DY1 was activated, the strain was inoculated into CAS medium for 3 times and cultured inverted at 28°C for 1 week. An orange halo was observed around the colony DY1, indicating that the strain DY1 was able to produce siderophores ( Figure 5 -B).

[0092] The diameter of the orange halo (D) and the diameter of the colony (d) were measured, and the D / d ratio was calculated.

[0093] (3) Qualitative determination of nitrogen fixation by strain DY1

[0094] The isolated strain DY1 was activated and then inoculated onto nitrogen-fixing solid medium, repeated three times, and cultured inverted at 28°C for one week. The strain DY1 was observed to grow sticky, translucent, white colonies, indicating that the strain DY1 has nitrogen-fixing function ( Figure 5 -C).

[0095] The diameter of the clear zone (D) and the colony diameter (d) produced by colony DY1 were measured, and the D / d ratio was calculated.

[0096] (4) Qualitative and quantitative determination of inorganic phosphorus degradation by strain DY1

[0097] Qualitative analysis: The isolated strain DY1 was activated and then inoculated into an inorganic phosphorus solid culture medium, repeated 3 times, and cultured in an inverted manner at 28°C for 1 week. A clear transparent circle was observed around the colony DY1, indicating that the strain DY1 had the property of solubilizing phosphorus ( Figure 5 The diameter of the transparent zone (D) and the diameter of the colony (d) were measured, and the D / d ratio was calculated.

[0098] Quantification: Molybdenum antimony colorimetric method is used.

[0099] Molybdenum antimony reagent: Slowly add 63mL of concentrated sulfuric acid to 200mL of deionized water and stir until cooled. Weigh 5g of ammonium molybdate and dissolve it in 150mL of 60℃ deionized water until cooled. Mix the prepared dilute sulfuric acid solution and ammonium molybdate solution evenly. Then weigh 0.25g of potassium antimony tartrate and dissolve it in 50mL of deionized water. After fully dissolving, mix it with the dilute sulfuric acid and ammonium molybdate solution, dilute to 500mL, and store in a brown reagent bottle (molybdenum antimony stock solution).

[0100] 0.75 g of ascorbic acid (super pure) is dissolved in the molybdenum antimony antimony stock solution to prepare the molybdenum antimony antimony reagent, which is prepared before use.

[0101] Prepare 0.5 mol / L sodium bicarbonate extractant, adjust the pH to 8.5, and store it in a glass bottle for later use.

[0102] P standard curve drawing: 0.1098g potassium dihydrogen phosphate dried at 105℃ was dissolved in 200mL deionized water, and 2.5mL sulfuric acid was added to make the volume to 500mL. The concentration of this solution was 50μg / L.

[0103] Dilute the above solution to 5 μg / L, pipette 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 mL respectively into a 50 mL volumetric flask, add 10 mL of sodium bicarbonate extractant, then add 5 mL of molybdenum antimony reagent, shake well and develop color for 1 hour.

[0104] Spectrophotometer OD 700 After measuring the absorbance, the concentration of P standard solution is used as the horizontal axis, and OD 700 The value is used to draw the curve on the vertical axis.

[0105] After the strain DY1 was activated, it was inoculated into an inorganic phosphorus liquid medium and cultured on a shaking table at 180 r / min for 10 days. A blank control was used as a medium without bacteria, and repeated 3 times. The bacterial liquid was centrifuged at 10000 r / min for 10 minutes. 5 mL of the supernatant was added to 45 mL of the prepared sodium bicarbonate extractant, and then 0.5 g of phosphorus-free activated carbon powder was added and shaken at 180 r / min for 30 minutes, and then filtered with filter paper. 5 mL of the filtrate was added to 5 mL of molybdenum antimony reagent and mixed. The volume was made up to 50 mL with distilled water, and the color was developed for 1 hour. The OD value was measured by spectrophotometer. 700 The absorbance was measured and the P content was calculated based on the standard curve.

[0106] P content of culture medium = ρ*V*Ts / V0

[0107] Where, ρ is the mass concentration of the standard curve;

[0108] V-fixed volume when color is developed;

[0109] Ts-multiples;

[0110] V0-measurement of fermentation broth volume;

[0111] (5) Qualitative and quantitative determination of the ability of strain DY1 to produce IAA

[0112] Qualitative analysis: Salkowski colorimetric solution: Mix 50 mL of 35% perchloric acid with 1 mL of 0.5 mol / L ferric chloride. Store in a dark place and prepare immediately before use.

[0113] After activation, the DY1 strain was inoculated into 20 mL of LB liquid medium (100 mg / L L-tryptophan) and cultured at 28°C and 180 rpm for 36 h. A blank control was used with a non-inoculated medium. Each reaction was repeated 3 times. OD was measured using a spectrophotometer. 600 When the bacterial solution concentration is 1, centrifuge the bacterial solution at 10,000 r / min for 15 minutes, take the supernatant and mix it with an equal amount of Salkowski colorimetric solution, and keep it in the dark for 30 minutes. At the same time, add 50 μL of 50 mg / L colorimetric solution as a positive control.

[0114] After 30 minutes, the color of the mixed solution of strain DY1 turned pink, and it was preliminarily determined that strain DY1 could secrete IAA ( Figure 6 ).

[0115] Quantification: Draw an IAA standard curve: Weigh IAA (analytical grade), prepare IAA standard solutions with concentrations of 0, 10, 20, 30, 40, and 50 μg / mL, and mix them with Salkowski colorimetric solution in equal amounts. After protecting from light and dark for 30 minutes, measure the OD of each solution. 530 The concentration of IAA is the horizontal axis, and the OD value is 0, which is the blank control. 530 The IAA standard curve was drawn with the value as the vertical axis. 530 IAA was determined and the IAA content was calculated using a standard curve.

[0116] The growth-promoting properties of strain DY1 are shown in Tables 1 to 3 below:

[0117] Table 1 Determination of growth-promoting performance of strain DY1

[0118]

[0119] Note: “+” indicates that strain DY1 has this function, and “—” indicates that it does not have this function.

[0120] Table 2 Growth promotion performance index of strain DY1

[0121]

[0122]

[0123] Table 3 Phosphate solubilization and IAA production of strain DY1

[0124]

[0125] Example 5

[0126] This example is used to illustrate the ability of strain DY1 to promote salt resistance and growth of corn seedlings.

[0127] (1) Fermentation broth preparation:

[0128] The activated strain DY1 was inoculated into LB liquid medium and cultured with shaking at 180 r / min and 28°C for 24 h. The bacterial solution was centrifuged at 6000 r / min for 10 min, resuspended in sterile water, and centrifuged again 2-3 times. The OD value of the bacterial solution was measured using a UV spectrophotometer. 630 , adjust the bacterial solution OD 630 The value should be 1.8~2, and it should be placed in a 4℃ refrigerator for later use.

[0129] (2) Potted plant experiment

[0130] The corn variety is Zhengdan 958, which is planted in potted substrate using Runhe brand organic substrate (Huai'an Runhe Organic Substrate Factory).

[0131] Set up 6 treatment groups, including Control, DY1, 60mM NaCl, 60mM+DY1, 120mM NaCl, and 120mM+DY1. Each treatment was repeated 3 times. The treatment groups are as follows:

[0132] Control: non-salt stress treatment, no NaCl was added, and 4 mL of sterile water was applied;

[0133] DY1: non-salt stress, 4 mL of DY1 bacterial solution was applied;

[0134] 60 mM NaCl: salt stress treatment, add 60 mmol / L NaCl and apply 4 mL of sterile water;

[0135] 60mM+DY1: salt stress treatment, adding 60mmol / L NaCl and applying 4mL of DY1 bacterial solution;

[0136] 120 mM NaCl: salt stress treatment, add 120 mmol / L NaCl and apply 4 mL of sterile water;

[0137] 120mM+DY1: Salt stress treatment, add 120mmol / L NaCl and apply 4mL of DY1 bacterial solution.

[0138] Select corn seeds of uniform size, soak them in 95% alcohol for 1 minute, rinse them with sterile water 3 to 5 times, stir them in 5% sodium hypochlorite solution for 3 minutes, rinse them with sterile water 3 to 5 times, soak them in sterile water for 3 hours, maintain moisture at 25°C in the dark and germinate for 3 days.

[0139] After germination, uniformly germinated seeds were selected for sowing, with two plants per pot. In the treatment group treated with the bacterial solution, 4 mL of bacterial solution was added to the roots of each plant at sowing. In the treatment group not treated with the bacterial solution, the same amount of sterile water was added. Each treatment was replicated three times. On the day of sowing, 100 mL of NaCl solution of varying concentrations was poured into each pot. In the non-salt stress treatment, 100 mL of deionized water was poured into each pot. NaCl solution and deionized water were supplemented with appropriate concentrations every 2–3 days, and the seedlings were incubated under natural conditions for 20 days. After 20 days of growth, the plant height, stem diameter, fresh weight, and dry weight of the corn seedlings in each treatment group were measured and analyzed.

[0140] (3) Experimental results

[0141] Corn pot experiment Figure 7 As shown, the growth of corn seedlings in the non-salt stress treatment group outperformed all other salt stress treatment groups in all aspects. Furthermore, as the NaCl concentration increased, the growth of corn seedlings slowed, indicating that 60mmol / L and 120mmol / L NaCl stress inhibited the growth of corn seedlings. Furthermore, the plant height, stem diameter, fresh weight, and dry weight of the seedlings in the bacterial solution treatment group were all higher than those in the untreated corn seedlings at the same NaCl concentration. Under non-salt stress, in the Control and DY1 treatments, DY1 showed more significant increases in plant height and underground fresh weight than the Control, increasing by 10.81% and 35.81%, respectively. Under salt stress, in the 60mM NaCl and 60mM+DY1 treatments, the 60mM+DY1 with bacterial solution showed significant increases in multiple indicators compared to the 60mM NaCl treatment, such as a 54.6% increase in plant height, a 102.08% increase in aboveground fresh weight, a 33.56% increase in underground fresh weight, and a 66.12% increase in total dry weight. Under higher salt concentrations, both 120mM+DY1 and 120mM NaCl showed significant increases in plant height, stem diameter, leaf width, aboveground fresh weight, and dry weight. Among them, the leaf width of the 120mM+DY1 treatment group increased the most among the three NaCl concentrations, increasing by 19.44%. In the experiment, although the growth of corn seedlings in three different NaCl concentrations was improved after adding bacterial solution, the most obvious improvement was found in the corn seedlings in the 60mM+DY1 treatment group. Figure 8 In terms of growth status, the growth status of corn seedlings in the 60mM+DY1 treatment group was similar to that of the control treatment group that was not subjected to salt stress.

[0142] The above embodiments are intended only to illustrate the technical concepts and features of the present invention. Their purpose is to enable those skilled in the art to understand the contents of the present invention and implement them accordingly. They are not intended to limit the scope of protection of the present invention. Any equivalent changes or modifications made in accordance with the spirit of the present invention are intended to be covered by the scope of protection of the present invention.

Claims

1. A salt-tolerant Enterobacter quasinii strain, characterized in that: The strain is salt-tolerant Enterobacter quasiroggenkampii DY1, which was deposited in the China Center for Type Culture Collection on November 7, 2024, with the deposit number CCTCC M 20242450.

2. A bacterial suspension or culture solution or fermentation product containing the salt-tolerant Enterobacter daunorubii according to claim 1.

3. Use of the bacterial suspension or culture solution or fermentation product as claimed in claim 2 in any one of the following (01)-(05): (01) Promote the growth of plants damaged by salt; (02) Preparing products that promote plant growth; (03) Prepare products for dissolving phosphate, potassium, fixing nitrogen and producing iron carriers; (04) preparing products producing longin; (05) As plant rhizosphere growth-promoting bacteria.

4. Use of the salt-tolerant Enterobacterium davidiani as claimed in claim 1 in promoting the growth of corn seedlings.

5. Use of the salt-tolerant Enterobacterium davidiani as claimed in claim 1 in improving the salt stress resistance of corn seedlings.

Images