High-temperature azo dye degrading bacterium and application thereof

Abstract

The invention discloses a high-temperature azo dye degrading bacterium and application thereof, the strain of the high-temperature azo dye degrading bacterium is Planiflora M8, the classification name of the high-temperature azo dye degrading bacterium is Planiflora fulgidum, the preservation unit is China General Microbiological Culture Collection Center, and the preservation number is CGMCC (China General Microbiological Culture Collection Center). The preservation address is Institute of Microbiology, Chinese Academy of Sciences, No.3, No.1 Yard, Beichen West Road, Chaoyang District, Beijing, the preservation date is June 29, 2023, and the preservation number is CGMCC No.27746; the azo dye degrading bacteria can decolorize and degrade printing and dyeing wastewater containing azo dye at high temperature; the strain can be used for degrading acid bright red GR, acid orange 7, direct frozen yellow G and direct black G. Experiments prove that the azo dye degrading bacterium disclosed by the invention has a remarkable degrading effect on azo dyes.

Description

Technical Field

[0001] The invention belongs to the technical field of microorganisms, and in particular relates to a high-temperature azo dye-degrading bacterium and an application thereof. Background Art

[0002] Printing and dyeing wastewater has the characteristics of deep color, high content of organic pollutants, complex composition, high biological toxicity, difficult biodegradation, high salinity, etc. Printing and dyeing wastewater has become one of the main industrial wastewaters at present, accounting for about 35% of the total industrial wastewater. In the printing and dyeing process, about 10% to 15% of the dyes are discharged into the environment with the wastewater, causing huge pollution to the environment.

[0003] Azo dyes are the most widely used dyes in the world, accounting for about 80% of the total amount of synthetic dyes. Azo dyes have potential teratogenic, carcinogenic and mutagenic properties, which are very harmful to the environment and human health, and have become one of the important factors threatening the safety of the water environment.

[0004] Azo dye wastewater mainly comes from dye bath and rinsing processes, and the temperature when discharged is as high as 50-80℃. High temperature will make most bacteria lose their activity or even die. Therefore, the printing and dyeing wastewater needs to be cooled before entering the biological treatment process, which greatly increases the operating costs of the enterprise.

[0005] At present, the main methods for treating azo dye wastewater include chemical, physical and biological methods. Compared with the high cost and possible secondary pollution of physical and chemical methods, biological methods have attracted widespread attention due to their low cost and environmental friendliness, and have gradually become the mainstream method for treating printing and dyeing wastewater. However, due to the poor degradability of azo dyes, the high temperature of printing and dyeing wastewater, and the difficulty of ordinary microorganisms to adapt to high-salt environments, their application is subject to certain restrictions.

[0006] Therefore, isolating and screening thermophilic microorganisms that can efficiently degrade azo dyes at high temperatures from the environment and applying them to the biological treatment of dye wastewater has good application prospects and ecological value. Summary of the invention

[0007] Technical issues solved:

[0008] The present application aims at the deficiencies in the prior art, solves the technical problems such as the poor degradability of azo dyes, the high temperature of printing and dyeing wastewater, and the difficulty of ordinary microorganisms to adapt to high-salt environments, and provides a high-temperature azo dye-degrading bacterium and its application.

[0009] Technical solution:

[0010] To achieve the above objectives, this application is implemented through the following technical solutions:

[0011] A high-temperature azo dye-degrading bacterium, the high-temperature azo dye-degrading bacterium strain is M8, classified and named Planifilumfulgidum, the preservation unit: General Microbiology Center of China Microbiological Culture Collection Administration, the preservation address: Institute of Microbiology, Chinese Academy of Sciences, No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, the preservation date: June 29, 2023, the preservation number: CGMCCNo.27746.

[0012] Furthermore, the 16S rDNA sequence of the thermophilic azo dye degrading bacterial strain is shown as SEQ ID NO.1.

[0013] The present application also discloses an application of a high-temperature azo dye-degrading bacteria in the degradation of azo dyes. The high-temperature azo dye-degrading bacteria strain M8 reduces the concentration of azo dyes.

[0014] Furthermore, the azo dye is degraded into a decolorized azo dye.

[0015] Furthermore, the decolorization and degradation specifically refers to decolorization and degradation of printing and dyeing wastewater containing azo dyes.

[0016] Furthermore, the azo dye is one or more of Acid Red GR, Acid Orange 7, Direct Frozen Yellow G, and Direct Black G.

[0017] The application also discloses the use of a high-temperature azo dye-degrading bacterium in the bioremediation of dye-containing wastewater or dye-contaminated soil or water.

[0018] The present application also discloses an application of a high-temperature azo dye degrading bacteria in an azo dye decolorizing preparation, wherein the azo dye decolorizing preparation contains the Planifilum M8 strain.

[0019] Furthermore, the azo dye decolorizing preparation is an aqueous solution, a powder or a paste.

[0020] Beneficial effects:

[0021] The present application provides a high-temperature azo dye-degrading bacteria and its application, which has the following beneficial effects compared with the prior art:

[0022] 1. The azo dye-degrading bacteria of the present invention can adapt to the high temperature environment of printing and dyeing wastewater;

[0023] 2. The azo dye-degrading bacteria of the present invention are added to printing and dyeing wastewater. The enzymes secreted by the microorganisms during the growth process can break the azo bonds. After the azo bonds are broken, the azo dyes are converted into aromatic compounds with lower chromaticity. The aromatic compounds can be utilized by the microorganisms and eventually metabolized into simple compounds, thereby completing the decolorization of the azo dyes.

[0024] 3. Through the decolorization and degradation experiment analysis of the above-mentioned azo dye degrading and decolorizing bacteria, it was found that it has a good azo dye decolorization effect and a significant degradation effect. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1 is the phylogenetic tree of the thermophilic azo dye-degrading bacterial strain Planifilumfulgidum M8 in Example 1 of the present application;

[0026] Figure 2 This is a decolorization rate curve of Acid Scarlet GR by the high temperature azo dye degrading bacteria strain Planifilumfulgidum M8 in Example 2 of the present application;

[0027] Figure 3 It is a decolorization rate curve of acid red GR by strain Planifilumfulgidum M8 at different salinities in Example 3 of the present application;

[0028] Figure 4 It is a curve diagram of the decolorization rate of acid red GR by strain Planifilumfulgidum M8 at different pH in Example 4 of the present application;

[0029] Figure 5 It is a graph showing the decolorization rate of the strain Planifilumfulgidum M8 in Example 5 of the present application to different concentrations of Acid Scarlet GR;

[0030] Figure 6 This is a graph showing the decolorization rate of different azo dyes by strain Planifilumfulgidum M8 in Example 6 of the present application. DETAILED DESCRIPTION

[0031] The technical scheme of the present invention is clearly and completely described below through embodiments. Obviously, the described embodiments are only part of the embodiments of the present invention, rather than all the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0032] Example 1

[0033] A high-temperature azo dye-degrading bacterium for plant roots in saline-alkali land, the strain being of the genus Planctomyces

[0034] (Planifilum) M8, classified and named as Planifilum fulgidum, deposited at: General Microbiology Center, China Culture Collection Administration, deposited at: Institute of Microbiology, Chinese Academy of Sciences, No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, deposited on June 29, 2023,

[0035] Deposit number: CGMCCNo.27746.

[0036] The strain Planifilumfulgidum M8 was isolated by the following route:

[0037] Take 10mL of the sampled activated sludge and add it to the enrichment medium containing 100mg / L of acid red GR, and culture it at 50℃. When the decolorization rate reaches 80%, inoculate it into the enrichment medium at a ratio of 10%, and raise the temperature to 55℃. After the decolorization is stable, raise the enrichment temperature again, and the temperature increases with the increase of generations (5℃ for each generation). Repeat this process until the decolorization is stable at 70℃, and obtain an extreme thermophilic bacteria group, which is used as a strain source for gradient dilution, and separates and selects single bacteria by plate streaking method, and then cultured at 70℃ to finally obtain pure bacteria.

[0038] The enrichment medium consisted of yeast extract (4.0 g / L), hydrolyzed casein (6.0 g / L), soluble starch (3.0 g / L), NaCl (10.0 g / L), MgCl2·6H2O (0.27 g / L), CaCl2 (0.025 g / L), FeSO4·7H2O (0.01 g / L), plant gel (0.8 g / 100 mL), trace elements (1 mL / L), pH = 7.5, 1×10 5 Pa was sterilized for 20 minutes.

[0039] The strain Planifilum_fulgidum M8 is a Gram-negative, facultative aerobic bacterium with a milky white color.

[0040] The bacterial genomic DNA was extracted with universal amplification primers, and PCR amplification was performed using the 16SrRNA universal primers 27F such as SEQ ID No. 1: 5'-AGAGTTTGATCCTGGCTCAG-3', and 1492R such as SEQ ID No. 2: 5'-GGTTACCTTGTTACGACTT-3'. The conditions for PCR amplification were as follows: pre-denaturation at 98°C for 5 min, denaturation at 95°C for 35S, annealing at 55°C for 35S, and extension at 72°C for 1.5 min, for a total of 39 cycles. The 16S rRNA sequence was obtained, recovered and purified, and sent to the company for sequencing. The sequencing sequence is shown in SEQ ID No.3: ggcggctgcc tcccttgcgg gttagctcac cgacttcggg tgttgcagac tctcgtggtgtgacgggcgg tgtgtacaag gcccgggaac gtattcaccg cggcatgctg atccgcgatt actagcgattccggcttcacgcaggcgagt tgcagcctgc gatccgaact gagaccggct ttttgggatt ggctccccctcgcgggttcgcagcccattg taccggccat tgtagcacgt gtgtagccca gggcataagg ggcatgatgatttgacgtcatccccacctt cctccggctt tcaccggctg tccccctaga gtgcccggcc taacccgctggcaactaagggcaagggttg cgctcgttgc gggactgaac ccaacatctc acgacacgag ctgacgacaaccatgcaccacctgtcaccg ctgtccccga agggaaaggc acatctctgc accggtcagc gggatgtcaagccctggtaaggttcttcgc gttgcttcga attaaaccac atgctccacc gcttgtgcgg gcccccgtcaattcctttga gtttcagccttgcggccgta ctccccaggc ggagtgctta ttgggttacc ttcggcacagagggcctgac gcccccaacacctagcactc atcgtttacg gcgtggacta ccagggtatc taatcctgttcgctccccac gctttcgcgcctcagcgtcagttacaggcc agggagccgc cttcgccact ggtgttcctcccgatctcta cgcattccaccgctacaccg ggaattccgc tcccctctcc tgcactcaag ccggccagtttcccgtgcac ccccacggttgagccgtggt ctttcacaca ggacttaacc agccgcctac gcgcgctttacgcccaataa ttccggacaacgctcgcccc ctacgtatta ccgcggctgc tggcacgtag ttagccggggctttctcctt cggtaccgtcaagcggaaga gttgttcgcc ctcccgccct tcttcccgaa gaacagagctttacaacccg aaggccgtcctcgctcacgc ggcgttgctc cgtcaggctt gcgcccattg cggaagattccctactgctg cctcccgtaggagtctgggc cgtgtctcag tcccagtgtg gccgatcacc ctctcaggtcggctacgcat cgtcgccttggtgagccgtt acctcaccaa ccagctaatg cgccgcgggc ccatccgcaagtggcagctt gacgccgcctttccaccccg gatcatgcga tccggagtct tatccggtat tagccccggtttcccggagt tatcccggtcttgcgggcag gttacccacg tgttatactcac ccgttcgccg ctgggtcttaaagggcaagc ccttcaagaccccgcacgac ttgcatgtat ag. The sequencing results were compared with the 16S rRNA sequence homology in NCBI. The strain sequence had a homology of 99.72% with Planifilumfulgidum sp.500275 and was deposited in the General Microbiology Center of China Microbiological Culture Collection on June 29, 2023, with the deposit number CGMCCNo.27746. The test on June 29, 2023 proved that the bacteria were alive.

[0041] Example 2

[0042] Study on decolorization of acid scarlet GR by Planifilum_fulgidum sp.M8: The strain Planifilum_fulgidum sp.M8 obtained by screening in Example 1 was inoculated into the culture medium and cultured at 70°C for 12 hours.

[0043] Planifilum_fulgidum sp.M8 was inoculated into a culture medium containing 100 mg / L acid red GR at 10% (V / V), cultured at 70°C, and the absorbance of the culture solution was measured to calculate the decolorization rate. This was repeated 3 times.

[0044] With time as the horizontal axis and decolorization rate as the vertical axis, a curve graph is drawn. The results are shown in Figure 2 .

[0045] Example 3

[0046] Effect of temperature on the degradation of acid red GR by Planifilum_fulgidum sp.M8: To study the effect of temperature on the degradation of acid red GR by Planifilum_fulgidum sp.M8, 10% inoculum was inoculated in a series of culture media with salinity of 60℃, 65℃, 70℃, 75℃, and 80℃, respectively. The pH of the culture medium was 7.0, and the concentration of acid red GR was 100 mg / L. The culture media were kept in a constant temperature incubator and kept away from light. Samples were taken at regular intervals, and the concentration of the remaining acid red GR was determined by a spectrophotometer. The time was taken as the horizontal axis and the degradation rate was taken as the vertical axis. The results are shown in the figure. Figure 3 As shown, at 55-75℃, the degradation rate of acid red GR by the bacterial flora can reach more than 80%.

[0047] Example 4

[0048] Effect of pH on the degradation of acid red GR by Planifilum_fulgidum sp.M8: To study the effect of pH on the degradation of acid red GR by Planifilum_fulgidum sp.M8, 10% of the inoculum was inoculated in fresh culture medium with a pH of 5, 6, 7, 8, and 9. The concentration of acid red GR was 100 mg / L. The medium was kept static and dark in a 70°C constant temperature incubator. After 48 hours, the concentration of the remaining acid red GR was determined by a spectrophotometer. The time was taken as the horizontal axis and the degradation rate was taken as the vertical axis. The results are shown in the figure. Figure 4 As shown, pH 5~

[0049] 9, the degradation rate of Acid Scarlet GR by Planifilum_fulgidum sp.M8 was over 60%.

[0050] Example 5

[0051] Effect of acid red GR concentration on the degradation of Planifilum_fulgidum sp.M8: In order to study the effect of acid red GR concentration on the degradation of Planifilum_fulgidum sp.M8, 10% of the inoculum was inoculated into fresh culture medium, the pH of the culture medium was 7.5, the concentration of acid red GR was 100-400 mg / L, and the culture was kept static and dark in a 70°C constant temperature incubator. Samples were taken at regular intervals and the concentration of the remaining acid red GR was determined by a spectrophotometer. The time was taken as the horizontal axis and the degradation rate was taken as the vertical axis. The results are shown in the figure. Figure 5 As shown, Planifilum_fulgidum sp.M8 can degrade 100-400 mg / L acid scarlet GR.

[0052] Example 6

[0053] Degradation of azo dyes of different colors by Planifilum_fulgidum sp.M81: To study the degradation of azo dyes of different colors by Planifilum_fulgidum sp.M8, 10% of the inoculum was inoculated into 5 culture media with a pH of 7. The concentration of azo dyes added to each culture medium was 100-400 mg / L. The culture media were kept in a 70°C constant temperature incubator and kept away from light. After 48 hours, the concentration of the remaining azo dyes was determined by a spectrophotometer. The azo dyes were used as the horizontal axis and the degradation rate was the vertical axis. The results are shown in the figure. Figure 6 As shown in the accompanying drawings, it can be seen that Planifilum_fulgidumsp.M8 has a significant degradation effect on acid red GR, acid orange 7, direct frozen yellow G and direct black G.

[0054] The above description has fully disclosed the specific embodiments of the present invention. It should be pointed out that any changes made by those skilled in the art to the specific embodiments of the present invention do not deviate from the scope of the claims of the present invention. Accordingly, the scope of the claims of the present invention is not limited to the above specific embodiments.

Claims

1. A high temperature azo dye degrading bacterium, characterized in that: The high-temperature azo dye-degrading bacterial strain is Planifilum M8, classified and named Planifilum fulgidum, deposited at the General Microbiology Center of China Culture Collection Administration, deposited at the Institute of Microbiology, Chinese Academy of Sciences, No. 3, Yard No. 1, Beichen West Road, Chaoyang District, Beijing, deposited on June 29, 2023, and deposited with the number CGMCC No. 27746.

2. A high temperature azo dye degrading bacteria according to claim 1, characterized in that: The 16S rDNA sequence of the thermophilic azo dye degrading bacterial strain is shown in SEQ ID NO.

3.

3. Use of the high-temperature azo dye-degrading bacteria according to claim 1 in the degradation of azo dyes, characterized in that: The high temperature azo dye degrading bacterial strain M8 reduces the concentration of azo dyes.

4. The use of the high temperature azo dye degrading bacteria according to claim 3 in the degradation of azo dyes, characterized in that: The azo dye degradation is decolorization and degradation of the azo dye.

5. The use of the high temperature azo dye degrading bacteria according to claim 4 in the degradation of azo dyes, characterized in that: The decolorization and degradation specifically refers to decolorization and degradation of printing and dyeing wastewater containing azo dyes.

6. Use of the high temperature azo dye degrading bacteria according to claim 3 in azo dye degradation, characterized in that: The azo dye is one or more of acid red GR, acid orange 7, direct frozen yellow G and direct black G.

7. Use of the high-temperature azo dye-degrading bacteria according to claim 1 in bioremediation of dye-containing wastewater or dye-contaminated soil or water.

8. Use of the high-temperature azo dye-degrading bacteria according to claim 1 in azo dye decolorizing preparations, characterized in that: The azo dye decolorizing preparation contains the Planifilum M8 strain.

9. The use of the high temperature azo dye degrading bacteria according to claim 8 in azo dye decolorizing preparations, characterized in that: The azo dye decolorizing preparation is an aqueous solution, a powder or a paste.

Images