Brevibacterium linum and application thereof in urea degradation

Abstract

The invention discloses brevibacterium linens and an application thereof in urea degradation, the brevibacterium linens is brevibacterium linens W2, the brevibacterium linens W2 is registered and preserved in the China Center for Type Culture Collection on July 18, 2024, and the preservation number is CCTCC NO: M 20241598. According to the brevibacterium linens W2 disclosed by the invention, under the condition that urea is used as a sole nitrogen source, urea metabolism in aerobic and anaerobic environments can be carried out, and after fermentation for 6 days, under the condition that only urea is used as a substrate, the urea degradation rates of the strain under the anaerobic and aerobic conditions are respectively 98.01% and 97.06%; when 8wt% absolute ethyl alcohol exists in a substrate, the degradation rates of urea of the strain under anaerobic and aerobic conditions are 47.87% and 31.22% respectively.

Description

Technical Field

[0001] The invention belongs to the technical field of wine brewing and food safety, and more specifically, relates to a Brevibacterium linensis strain and application thereof in urea degradation. Background Art

[0002] Ethyl carbamate (EC) is genotoxic and carcinogenic. It is a Class 2A carcinogen that occurs naturally in fermented foods, especially alcoholic beverages. EC in fermented foods is generally believed to originate from the reaction of carbamyl compounds with ethanol. There are four main pathways: (1) EC is generated from the urea pathway; (2) EC is generated from the cyanide pathway; (3) EC is generated from the alcoholysis of precursors such as citrulline; and (4) EC is generated from the additive pathway.

[0003] At present, the ways and methods of controlling EC are mainly divided into four categories, namely: optimizing fermentation raw materials, screening excellent strains, improving brewing technology and adding acid urease exogenously. For example, by breeding low-urea yeast and modifying its genes to reduce its arginase activity, the pathway of arginine metabolism to produce urea is blocked, thereby reducing the formation of EC; and a certain amount of EC is removed by pot distillation, and the appropriate cutting and tailing method can be used to obtain secondary distilled liquor with a lower EC concentration than the original liquor. However, it is precisely because of the unique production process that traditional solid-state fermentation liquor has given the product a typical style. Reducing the EC content without changing the brewing process, affecting the sensory organs of the wine body and reducing the output of liquor is a common problem faced by the liquor industry. In addition, EC has good stability and is difficult to remove once it is formed in liquor. Although it can be removed under strong acid and strong alkali conditions, it is difficult to reduce EC by this chemical method and it has a great impact on the flavor and quality of liquor. Based on this, the current research on the reduction strategy of EC in liquor mainly focuses on its precursors, among which urea is the main precursor of EC. It can be seen that the amount of urea has a significant effect on the formation of EC. Summary of the invention

[0004] An object of the present invention is to solve at least the above problems and / or disadvantages and to provide at least the advantages which will be described hereinafter.

[0005] In order to achieve these purposes and other advantages of the present invention, a strain of Brevibacterium linens is provided, wherein the Brevibacterium linens is Brevibacterium linens W2, which has been registered and preserved in the China Center for Type Culture Collection on July 18, 2024, with a preservation number of CCTCC NO: M20241598, and the address of the preservation unit is Wuhan University, Wuhan, China.

[0006] Preferably, the 16s rDNA sequence of Brevibacterium linens is as shown in SEQ ID NO:1.

[0007] A use of Brevibacterium linens as described above in urea degradation.

[0008] Preferably, the use of Brevibacterium linensis in urea degradation comprises the following steps:

[0009] Step 1: Take a loop of Brevibacterium linensis W2 and inoculate it into 50 mL LB fermentation medium. Incubate it in a shaker at 30 ° C and 120-150 r / min for 24 h. When the fermentation liquid becomes turbid, an activated bacterial solution is obtained. Then, the activated bacterial solution is diluted with sterile water until the OD 600 is 1.0, and the diluted bacterial suspension is obtained;

[0010] Step 2: Take 2 mL of the diluted bacterial suspension and inoculate it into 100 mL of urea liquid fermentation medium, and culture it in a shaking incubator at 30°C and 120-150 r / min to form a bacterial fermentation liquid. During the culture process, fixed-point sampling is used to determine the change of urea in the bacterial fermentation liquid using the diacetyl monoxime method.

[0011] Preferably, in step 2, the culture is carried out in an aerobic environment at 30° C. and 120-150 r / min in a shaking incubator.

[0012] Preferably, in step 2, the culture is carried out in an anaerobic environment at 30° C. and 120-150 r / min in a shaking incubator.

[0013] Preferably, in step 2, the urea liquid fermentation medium comprises components in the following proportions: 9 g urea, 10 g glucose, 0.2 g magnesium sulfate heptahydrate, 0.2 g sodium chloride, 0.2 g dipotassium hydrogen phosphate, 1 L distilled water, pH 6.8, and sterilization at 121° C. for 15 min.

[0014] Preferably, in the step 2, anhydrous ethanol is added to the urea liquid fermentation medium, and the amount of anhydrous ethanol added is 8 wt % of the mass of the urea liquid fermentation medium.

[0015] Preferably, in step 2, the culture is carried out in an aerobic environment at 30° C. and 120-150 r / min in a shaking incubator.

[0016] Preferably, in step 2, the culture is carried out in an anaerobic environment at 30° C. and 120-150 r / min in a shaking incubator.

[0017] The present invention at least includes the following beneficial effects: the colonies of Brevibacterium linens W2 of the present invention on LB solid culture medium are round, milky white or light yellow, viscous and opaque, convex, and have a glossy and smooth surface; and a biofilm is generated when the colony is left to stand after liquid culture. The Brevibacterium linens W2 of the present invention can metabolize urea in aerobic and anaerobic environments when urea is used as the only nitrogen source. After 6 days of fermentation, when only urea is used as a substrate, the degradation rates of urea of ​​the strain under anaerobic and aerobic conditions are 98.01% and 97.06%, respectively; and when there is 8wt% anhydrous ethanol in the substrate, the degradation rates of urea of ​​the strain under anaerobic and aerobic conditions are 47.87% and 31.22%, respectively.

[0018] Other advantages, objectives and features of the present invention will be embodied in part through the following description, and in part will be understood by those skilled in the art through study and practice of the present invention. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 is the urease activity of the three urea-degrading bacteria W2, W5, and W17 in Example 1;

[0020] Figure 2 The morphology and Gram staining of strain W2 in Example 1;

[0021] Figure 3 The electrophoresis diagram of strain W2 in Example 1;

[0022] Figure 4 is the phylogenetic tree of the W2 strain in Example 1;

[0023] Figure 5 The ammonium chloride solution standard curve in Example 1;

[0024] Figure 6 is the urea solution standard curve in Example 1;

[0025] Figure 7 The degradation of urea by the W2 strain of Example 2 and Example 3 under a single nitrogen source;

[0026] Figure 8 This is the degradation of urea by the W2 strain of Example 4 and Example 5 at an ethanol concentration of 8 wt%. DETAILED DESCRIPTION

[0027] The present invention is further described in detail below in conjunction with the accompanying drawings so that those skilled in the art can implement the invention with reference to the description.

[0028] It should be understood that the terms such as “having”, “including” and “comprising” used herein do not exclude the existence or addition of one or more other elements or combinations thereof.

[0029] In the following examples, the urea liquid fermentation medium includes the following components: 9 g urea, 10 g glucose, 0.2 g magnesium sulfate heptahydrate, 0.2 g sodium chloride, 0.2 g dipotassium hydrogen phosphate, 1 L distilled water, pH 6.8, and sterilization at 121° C. for 15 min.

[0030] The LB fermentation medium includes the following components: 5 g yeast extract powder, 10 g peptone, 10 g sodium chloride, and 1 L distilled water. After being fully mixed, the medium is sterilized at 121° C. for 20 min.

[0031] LB fermentation agar medium includes the following components: 20 g agar, 5 g yeast extract powder, 10 g peptone, 10 g sodium chloride, 1 L distilled water, and after fully mixing, sterilize at 121° C. for 20 min.

[0032] The screening medium includes the following components: 5 g yeast extract powder, 10 g peptone, 10 g sodium chloride, 3 g urea, 6 mg bromocresol purple, and 1 L ultrapure water. After being fully mixed, the medium is sterilized at 121° C. for 20 min.

[0033] Example 1

[0034] A strain of Brevibacterium linens, wherein the Brevibacterium linens is Brevibacterium linens W2, which has been registered and deposited in the China Center for Type Culture Collection on July 18, 2024, with a deposit number of CCTCC NO: M20241598, and the depository address is Wuhan University, Wuhan, China;

[0035] Isolation and identification of Brevibacterium linensis W2 of the present invention

[0036] 1. Identification method:

[0037] The strain of the present invention was isolated from the fermented grains of the Luzhou-flavor liquor fermentation tank:

[0038] Initial screening:

[0039] Take 30g of the fermented grains in the cellar, put them into a 250mL conical flask filled with 50mL of sterile physiological saline under sterile conditions, and activate and enrich them in a constant temperature shaking incubator at 30°C and 150r / min for 24h; take 100μL of the activated mixed solution, spread it on the LB fermentation agar medium plate, evenly spread it, wait for the bacterial solution to dry and fix, put the plate upside down in a constant temperature incubator, and culture it at 30°C for 72h; pick a number of single colonies with different morphologies, repeatedly streak them on the plate for separation and purification, take the separated and purified single colonies and inoculate them on the LB slant medium and store them at -4°C, select a total of 18 strains and number them as W1~W18; inoculate the 18 strains into the screening medium, culture them in a constant temperature shaking incubator at 150r / min, screen out the strains that can make the medium obviously turn purple, and screen out a total of 15 acid urease-producing strains.

[0040] Rescreening:

[0041] The strains obtained from the initial screening were inoculated into LB fermentation medium, and the urease activity was measured after culturing in a constant temperature shaking incubator at 30°C and 150r / min for 24h, and the strains with higher enzyme activity were selected as target strains. Figure 1 As shown, three urea-degrading bacteria with high enzyme activity, W2, W5, and W17, were finally selected, among which W2 had the highest enzyme activity.

[0042] Physiological and biochemical characteristics: The selected strain W2 was subjected to sugar fermentation test, hydrogen peroxide test, methyl red test, VP test and indole test. The physiological and biochemical characteristics of the strain were carried out in accordance with the description in the Manual of Identification of Common Bacterial Systems. The results are shown in Table 1. The methyl red and VP tests of the strain were negative, which indicated that the strain could not ferment glucose to produce pyruvic acid; bubbles were produced in the catalase reaction, and the result was positive; in the starch hydrolysis test, a transparent circle appeared around the colony, indicating that the starch could be hydrolyzed; in the gelatin liquefaction test, the gelatin was not liquefied, and the result was negative; in the indole test, the strain did not form red rose indole, which could be determined to be negative.

[0043] Table 1

[0044] Measurement items Measurement results Methyl Red (MR) - VP test - Catalase reaction + Starch hydrolysis + Gelatin liquefaction - Indole reaction -

[0045] Morphological characteristics: The strain was inoculated on LB solid medium, cultured at 30°C and its growth, colony color, size, shape, edge, surface, protrusions and transparency were recorded. In a sterile operating table, a single colony was picked onto a glass slide to prepare a slide for Gram staining. The colonies of the W2 strain on LB solid medium are round, milky white or light yellow, viscous and opaque, convex, shiny and smooth; a biofilm was formed when left to stand after liquid culture. Figure 2 As shown, the strain of the present invention meets the characteristics of Brevibacterium linens.

[0046] Molecular biological identification: The pre-cultured strain was placed in a 2mL PE tube, and the DNA of the target strain was extracted using the TSINGKE Plant DNA Extraction Kit (Universal). Then the universal primer 27F / 1492R for bacteria was used for PCR amplification. The amplification system was: 45μL 1×TSE101 Gold Mix, 2μL upstream primer (GAGAGTTTGATCCTGGCTCAG), 2μL downstream primer (TACGGCTACCTTGTTACGAC), 1μL DNA template, a total of 50μL. The amplification program was: 98℃ pre-denaturation for 3min; 98℃ denaturation for 10s, 55℃ annealing for 15s, 72℃ extension for 15s / kb, 39 cycles; then 72℃ extension for 5min; finally stored at 4℃. The amplified PCR product was subjected to agarose gel electrophoresis to observe whether the band meets the sequencing requirements. If it meets the requirements, the prepared PCR product was sent to Qingke Biotechnology Co., Ltd. for sequencing. After completion, the sequencing results were spliced ​​using ContigExpress, and after removing the inaccurate parts at both ends, the spliced ​​sequences were compared in the NCBI database (blast.ncbi.nlm.nih.gov), and the 16S rDNA sequences with higher similarity were analyzed, and the phylogenetic tree was constructed using the software MEGA 11.0.

[0047] 16S rDNA sequence amplification: Take 2 μL of the amplified PCR product and 6 μL of bromophenol blue and perform agarose gel electrophoresis at 300 V. After 12 minutes, the electrophoresis gel map is obtained. The results are as follows: Figure 3 As shown, the order of the bands from top to bottom is: 5000bp, 3000bp, 2000bp, 1000bp, 750bp, 500bp, 250bp, 100bp, and the target band is near 1500bp and is clear and can be used for the next sequencing.

[0048] 16S rDNA sequencing: The 16S rDNA product was submitted to Chengdu Qingke Biotechnology Co., Ltd. for sequencing to obtain the full-length 16S rDNA sequence of the isolated strain. The obtained 16S rDNA sequence was compared with the gene sequences of known bacterial species in the GeneBank database using the Blast program on the NCBI website. The results showed that the strain was most closely related to the genus Brevibacterium. The gene sequence of the 16S rDNA of the isolated strain W2 obtained after sequencing is shown in SEQ ID NO: 1.

[0049] Phylogenetic tree analysis of strains: Through systematic comparison, gene sequences with close genetic relationships in the genus Brevibacterium were obtained from the database, and a phylogenetic tree was constructed using the neighbor-joining method, such as Figure 4As shown, strain W2 is in the same branch as Brevibacterium linens P159 in the phylogenetic tree, indicating that it is most closely related to Brevibacterium linens. Combined with morphological and physiological and biochemical characteristics, strain W2 was preliminarily identified as Brevibacterium linens.

[0050] The detection of urease activity in the present invention adopts the Berthelot reaction colorimetric method. Add 200 μL of enzyme solution and inactivated enzyme solution (inactivated enzyme solution is used as blank control) to the colorimetric tube respectively, then add 800 μL of urea with a concentration of 40 g / L, react in a 37°C water bath for 20 minutes, then add 1.0 mL of terminator, shake and mix for 1 minute, add 1.0 mL of color developer I and 1.0 mL of color developer II, mix thoroughly, and place in a 37°C water bath for 20 minutes, then take out, and dilute to 10 mL with distilled water, and detect the absorbance at 625 nm. Enzyme activity definition: At 35°C, normal pressure, and pH 5.5, the amount of enzyme that decomposes urea to produce 1 μmol of ammonium ions per minute is 1 enzyme activity unit U. The standard curve of ammonium chloride solution is as shown in Figure 5 shown.

[0051] Enzyme activity (U / mL) = ΔOD 625 ×n×k / 20. Where 20 is the reaction time (min), ΔOD 625 is the difference between the absorbance of the sample and the blank control, k is the reciprocal of the slope of the standard curve, and n is the dilution multiple of the enzyme solution.

[0052] The diacetyl monoxime method was used to measure the urea content in the fermentation broth:

[0053] Weigh 0.100g of urea, dissolve it in distilled water, and dilute to 100mL, which is a urea standard stock solution with a concentration of 1000mg / L. Pipette 1.0mL, 3.0mL, 5.0mL, 7.0mL, 9.0mL, and 11.0mL of the urea standard stock solution respectively, and dilute to 100mL respectively. The solution concentrations are 0mg / L, 10mg / L, 30mg / L, 50mg / L, 70mg / L, 90mg / L, and 110mg / L, respectively, which are urea standard use solutions. Weigh 100mL of concentrated phosphoric acid and 300mL of concentrated sulfuric acid, and add 600mL of distilled water containing 0.1g of ferric chloride as an acid iron solution. Weigh 0.900g of diacetyl monoxime and dilute to a 50mL brown bottle as a diacetyl monoxime solution. Weigh 0.030g of thiosemicarbazide and dilute to a 50mL brown bottle as a thiosemicarbazide solution. Before use, mix 1 part of diacetyl monoxime solution and 1 part of thiosemicarbazide solution as a colorimetric agent, which is valid for 2 hours. Take 0.5mL of urea standard solution in a test tube, add 3mL of ferric acid solution and 1mL of colorimetric agent respectively, cover the stopper and shake well. Place in a boiling water bath for 15 minutes, take out and quickly cool in ice water for 3 minutes, and dilute to 10mL with distilled water. After shaking well, perform colorimetric quantification at a wavelength of 525nm. Draw a standard curve of urea solution as shown in the figure. Figure 6 shown.

[0054] Example 2

[0055] The application of a strain of Brevibacterium linensis in urea degradation comprises the following steps:

[0056] Step 1: Take a loop of bacteria, i.e. Brevibacterium linens W2, and inoculate it into 50 mL LB fermentation medium. Incubate it in a shaker at 30 ° C and 150 r / min for 24 h. After the fermentation liquid becomes turbid, an activated bacterial solution is obtained. Then, the activated bacterial solution is diluted with sterile water until the OD 600 is 1.0, and the diluted bacterial suspension is obtained;

[0057] Step 2: Take 2 mL of the diluted bacterial suspension and inoculate it into 100 mL of urea liquid fermentation medium, and culture it in an aerobic environment at 30°C and 150 r / min in a shaking incubator to form a bacterial fermentation liquid. During the culture process, fixed-point sampling is used to determine the changes in urea in the bacterial fermentation liquid using the diacetyl monoxime method.

[0058] Example 3

[0059] The application of a strain of Brevibacterium linensis in urea degradation comprises the following steps:

[0060] Step 1: Take a loop of bacteria, i.e. Brevibacterium linens W2, and inoculate it into 50 mL LB fermentation medium. Incubate it in a shaker at 30 ° C and 150 r / min for 24 h. After the fermentation liquid becomes turbid, an activated bacterial solution is obtained. Then, the activated bacterial solution is diluted with sterile water until the OD 600 is 1.0, and the diluted bacterial suspension is obtained;

[0061] Step 2: Take 2 mL of the diluted bacterial suspension and inoculate it into 100 mL of urea liquid fermentation medium, and culture it in an anaerobic environment at 30°C and 150 r / min in a shaking incubator to form a bacterial fermentation liquid. During the culture process, fixed-point sampling is used to determine the changes in urea in the bacterial fermentation liquid using the diacetyl monoxime method.

[0062] Examples 2 and 3 are experimental schemes for strain metabolism when urea is used as a single nitrogen source; since the Luzhou-flavor liquor is in an anaerobic environment during the fermentation process, simulation experiments under aerobic and anaerobic conditions were conducted to study the strain's utilization of urea under different oxygen conditions. The fermentation broth was sampled regularly and the urea content was tested. Three parallel experiments were set for each example, and the results were averaged. The experimental results are shown in Table 1. Figure 7 As shown. The results showed that aerobic conditions had little effect on the metabolism of the strain. Under anaerobic conditions, the strain's utilization rate of urea was slightly higher than that under aerobic conditions. After 6 days of cultivation, the urea content under anaerobic conditions dropped from 8.174g / L to 0.256g / L, the degradation amount was 7.918g / L, and the degradation rate was 96.87%. Under aerobic conditions, the urea content dropped from 8.184g / L to 0.263g / L, the degradation amount was 7.921g / L, and the degradation rate was 96.79%. In the experiment, the highest values ​​of degradation rate and degradation amount were reached: under anaerobic conditions, the urea content dropped from 8.172g / L to 0.163g / L, the degradation rate reached 98.01%, and the strain successfully degraded 8.009g / L urea; under aerobic conditions, the urea content dropped from 8.181g / L to 0.240g / L, the degradation rate was 97.06%, and the strain successfully degraded 7.941g / L urea.

[0063] Example 4

[0064] The application of a strain of Brevibacterium linensis in urea degradation comprises the following steps:

[0065] Step 1: Take a loop of bacteria, i.e. Brevibacterium linens W2, and inoculate it into 50 mL LB fermentation medium. Incubate it in a shaker at 30 ° C and 150 r / min for 24 h. After the fermentation liquid becomes turbid, an activated bacterial solution is obtained. Then, the activated bacterial solution is diluted with sterile water until the OD 600 is 1.0, and the diluted bacterial suspension is obtained;

[0066] Step 2: Take 2 mL of the diluted bacterial suspension and inoculate it into 100 mL of urea liquid fermentation medium (anhydrous ethanol is added to the urea liquid fermentation medium, and the amount of anhydrous ethanol added is 8wt% of the mass of the urea liquid fermentation medium), and culture it in an aerobic environment at 30°C and 150 r / min in a shaking table to form a bacterial fermentation liquid; during the culture process, fixed-point sampling is used to determine the change of urea in the bacterial fermentation liquid using the diacetyl monoxime method.

[0067] Example 5

[0068] The application of a strain of Brevibacterium linensis in urea degradation comprises the following steps:

[0069] Step 1: Take a loop of bacteria, i.e. Brevibacterium linens W2, and inoculate it into 50 mL LB fermentation medium. Incubate it in a shaker at 30 ° C and 150 r / min for 24 h. After the fermentation liquid becomes turbid, an activated bacterial solution is obtained. Then, the activated bacterial solution is diluted with sterile water until the OD 600 is 1.0, and the diluted bacterial suspension is obtained;

[0070] Step 2: Take 2 mL of the diluted bacterial suspension and inoculate it into 100 mL of urea liquid fermentation medium (anhydrous ethanol is added to the urea liquid fermentation medium, and the amount of anhydrous ethanol added is 8 wt% of the mass of the urea liquid fermentation medium), and culture it in an anaerobic environment at 30°C and 150 r / min in a shaking table to form a bacterial fermentation liquid; during the culture process, fixed-point sampling is used to determine the change of urea in the bacterial fermentation liquid using the diacetyl monoxime method.

[0071] Examples 4 and 5 are experimental schemes for the metabolic characteristics of strains with anhydrous ethanol added when urea is used as a single carbon source; since alcohol is produced by yeast metabolism during the fermentation of Luzhou-flavor liquor, and the fermented grains contain low-concentration ethanol, the utilization of urea by the strain in the presence of low-concentration ethanol was studied. Examples 4 and 5 simulated aerobic and anaerobic conditions, and regularly sampled the fermentation broth to monitor the urea content therein. Three parallel experiments were set for each example, and the results were averaged. The experimental results are shown in Figure 1. Figure 8As shown. Under the anaerobic system, the degradation amount of urea was significantly higher than that under aerobic conditions. After 6 days of cultivation, the urea content under anaerobic conditions dropped from 7.944g / L to 4.685g / L, the degradation amount was 3.259g / L, and the degradation rate was 41.02%. Under aerobic conditions, the urea content dropped from 8.112g / L to 5.702g / L, the degradation amount was 2.410g / L, and the degradation rate was 29.71%. In the experiment, the highest values ​​of degradation rate and degradation amount were reached: under anaerobic conditions, the urea content dropped from 8.125g / L to 4.236g / L, the degradation rate reached 47.87%, and the strain successfully degraded 3.889g / L urea; under aerobic conditions, the urea content dropped from 8.123g / L to 5.587g / L, the degradation rate was 31.22%, and the strain degraded 2.536g / L urea. These results indicate that the strain utilizes urea differently under aerobic and anaerobic conditions in the presence of low-concentration ethanol, but the degradation effect is better under anaerobic conditions, providing important clues for further studying the metabolic pathways of the strain and its growth characteristics under different environmental conditions.

[0072] Although the embodiments of the present invention have been disclosed as above, they are not limited to the applications listed in the specification and the implementation modes, and they can be fully applied to various fields suitable for the present invention. For those familiar with the art, additional modifications can be easily implemented. Therefore, without departing from the general concept defined by the claims and the scope of equivalents, the present invention is not limited to the specific details and the illustrations shown and described herein.

Claims

1. A strain of Brevibacterium linensis, characterized in that: The Brevibacterium linens is Brevibacterium linens W2, which was registered and preserved in the China Center for Type Culture Collection on July 18, 2024, with the preservation number CCTCCNO: M 20241598.

2. The Brevibacterium linens according to claim 1, characterized in that The 16s rDNA sequence of Brevibacterium linensis is shown in SEQ ID NO:

1.

3. Use of Brevibacterium linens according to any one of claims 1 to 2 in urea degradation.

4. The use of Brevibacterium linens in urea degradation according to claim 3, characterized in that: The following steps are involved: Step 1: Take a loop of Brevibacterium linensis W2 and inoculate it into 50 mL LB fermentation medium. Incubate it in a shaker at 30 ° C and 120-150 r / min for 24 h. When the fermentation liquid becomes turbid, an activated bacterial solution is obtained. Then, the activated bacterial solution is diluted with sterile water until the OD 600 is 1.0, and the diluted bacterial suspension is obtained; Step 2: Take 2 mL of the diluted bacterial suspension and inoculate it into 100 mL of urea liquid fermentation medium, and culture it in a shaking incubator at 30°C and 120-150 r / min to form a bacterial fermentation liquid. During the culture process, fixed-point sampling is used to determine the change of urea in the bacterial fermentation liquid using the diacetyl monoxime method.

5. The use of Brevibacterium linens in urea degradation according to claim 4, characterized in that: In the step 2, aerobic culture is carried out in a shaking incubator at 30° C. and 120-150 r / min.

6. The use of Brevibacterium linens in urea degradation according to claim 4, characterized in that: In the step 2, the culture is carried out in an anaerobic environment at 30° C. and 120-150 r / min in a shaking incubator.

7. The use of Brevibacterium linens in urea degradation according to claim 4, characterized in that: In the step 2, the urea liquid fermentation medium includes the following components: 9 g urea, 10 g glucose, 0.2 g magnesium sulfate heptahydrate, 0.2 g sodium chloride, 0.2 g dipotassium hydrogen phosphate, 1 L distilled water, pH 6.8, and sterilization at 121° C. for 15 min.

8. The use of Brevibacterium linens in urea degradation according to claim 7, characterized in that: In the step 2, anhydrous ethanol is added to the urea liquid fermentation medium, and the amount of anhydrous ethanol added is 8 wt % of the mass of the urea liquid fermentation medium.

9. The use of Brevibacterium linens in urea degradation according to claim 8, characterized in that: In the step 2, aerobic culture is carried out in a shaking incubator at 30° C. and 120-150 r / min.

10. The use of Brevibacterium linens in urea degradation according to claim 8, characterized in that: In the step 2, the culture is carried out in an anaerobic environment at 30° C. and 120-150 r / min in a shaking incubator.

Images