Method for enriching and screening Blauria intestinal bacteria

Abstract

The invention provides a method for enriching and separating Blauria bacteria in human intestinal tracts under common laboratory conditions. An anaerobic culture medium and a special enrichment culture are prepared, and a unique culture device and an operation process are combined, so that the problems of sample complexity, harsh growth conditions, lack of a selective culture medium and the like are solved. The method comprises the steps of culture medium preparation, enrichment culture, nucleic acid extraction, high-throughput sequencing, strain separation, molecular identification and the like, has the advantages of low cost, simplicity and convenience in operation, high-efficiency screening and the like, and provides technical support for research and application of the Blauria bacteria.

Description

Technical Field

[0001] The present invention relates to the enrichment and separation of a specific type of microorganisms, and in particular to the separation of bacteria with research and application value from human intestinal bacteria. The invention is combined with a specially designed in vitro culture device and operation method, and is suitable for ordinary laboratories to carry out work under conventional experimental conditions. Background Art

[0002] There is a complex microecological system in the human intestine that affects digestion, nutrient absorption, energy supply, fat metabolism, immunity and disease resistance. Wetland It is an important genus of intestinal bacteria belonging to the family Lachnospiraceae, and plays a key role in the mammalian intestine. In recent years, with the deepening of intestinal microbial research, Wetland Blautia has attracted much attention for its contribution to the alleviation of inflammatory and metabolic diseases and its antimicrobial activity against specific microorganisms. Blautia was originally derived from several abundant gastrointestinal bacteria that were previously classified as Ruminococcus As research progresses, some species in the genera Clostridium and Ruminococcus have also been reclassified as Wetland The composition of the genus is constantly updated by the addition of new species and strains, but overall, Wetland The species in the species still form a relatively stable and coherent monophyletic branch. Wetland The genus already contains several species, e.g. B. Hydrogenotrophica、B. coccoides、B. wexlerae、B. hansenii and B. producta wait. Wetland Bacteria play an important role in the intestinal microbiome. They are strictly anaerobic, non-motile, and widely distributed in the feces and intestines of mammals. These bacteria can use hydrogen and carbon dioxide to produce acetate, which is a secondary energy source for intestinal epithelial cells and also an energy source for muscle and brain tissue. Acetic acid also has anti-pathogen and anti-inflammatory effects, which is essential for maintaining intestinal health. In recent years, studies have shown that the intestinal Wetland The composition and variation of the bacterial population is related to factors such as host age, geography, diet, genotype, health status, disease state, and other physiological states. For example, in elderly patients, Wetland Levels of the bacteria are often reduced in humans; they are also reduced in mucosal samples from patients with colorectal cancer; and they are elevated in patients with irritable bowel syndrome (IBS). Wetland It is inversely correlated with visceral fat area, which is considered an obesity biomarker for cardiovascular and metabolic disease risk. Blautia luti and Blautia wexlerae The reduction in insulin resistance is associated with obesity. WetlandThe importance of bacteria in intestinal health makes it important to develop enrichment and separation technologies. Enrichment culture technology is an effective microbial screening method that can be used to screen microorganisms with special functions or medicinal value. By optimizing the culture medium composition and culture conditions, the Wetland The key to this technology is to fully understand the number of bacteria in the sample and then separate and identify them. Wetland The growth characteristics and metabolic pathways of bacteria are studied to ensure that a suitable growth environment is provided for them during the enrichment process. Wetland Enterobacteriaceae play an important role in the intestinal microbiota and are closely related to a variety of physiological and pathological conditions. The development of their enrichment and separation technology will provide a basis for in-depth research. Wetland The functions and applications of bacteria provide strong support, however, the existing enrichment and separation Wetland Microorganisms of the genus Bacteria face the following dilemmas: (1) Sample complexity: The intestinal microbial community is extremely complex, containing a variety of bacteria, fungi, viruses and other microorganisms. Wetland Bacteria are only a part of them, and their number may be relatively small. Therefore, in the enrichment and separation of intestinal samples Wetland When screening bacteria, it is necessary to overcome the challenge of sample complexity to ensure that the target bacteria can be screened accurately and efficiently; (2) Harsh growth conditions: Wetland Bacteria are strictly anaerobic and have high requirements for the growth environment. During the enrichment and separation process, oxygen concentration, temperature, pH value and other conditions need to be strictly controlled to ensure their normal growth and reproduction. This increases the complexity and cost of the operation; (3) Lack of selective culture medium: Currently, there is no selective culture medium for Wetland The selective culture medium for bacteria is not perfect yet. Traditional culture medium may not be able to fully meet the Wetland The growth requirements of bacteria lead to poor enrichment effect. Wetland Highly efficient selective culture medium for bacteria is one of the keys to enrichment and separation technology. Summary of the invention

[0003] In view of the above technical problems, the present invention aims to enrich and separate the anaerobic cells by using unique devices, processes and culture medium formulas in the absence of professional instruments and equipment such as anaerobic workstations in ordinary laboratories. Wetland The specific steps include: (1) Preparation of basic anaerobic culture medium; (2) Preparation of enrichment culture; (3) Enrichment culture; (4) Extraction of intestinal bacterial nucleic acid; (5) High-throughput sequencing and analysis; (6) Strain isolation and cultivation; (7) Molecular identification of intestinal bacteria; Preferably, the step (1) of preparing the basic anaerobic culture medium comprises the following steps: ① Prepare basic culture medium components according to the growth rules of most intestinal bacteria and adjust the pH value; these culture media generally contain necessary sugars, proteins, vitamins, and some short-chain fatty acids; ② Add 1 / 1000 concentration of resazurin as an oxygen indicator, fill with nitrogen, and sterilize by high pressure or filtration. Although oxygen indicators are not necessary for all intestinal bacteria cultures, they provide an important basis for the operation of various intestinal bacteria cultures. When the oxygen indicator turns red, the culture medium conditions cannot meet the growth of strict anaerobic bacteria, but can still meet the growth of facultative anaerobes and microaerophiles; ③ Separately prepare a cysteine ​​solution with a concentration of more than 1%, fill it with nitrogen, sterilize it by high pressure or filtration, and use it before inoculation. Cysteine ​​is a commonly used water-soluble deoxidizer. Cysteine ​​can be added directly or cysteine ​​hydrochloride can be added, and the effect is equivalent; Preferably, the step (2) of preparing the special enrichment culture is carried out according to the following steps: ① Mix 1-5g of fresh walnuts with 100ml of sterile distilled water and grind them at normal speed for 5min in a grinding mortar; dissolve about 50mg of α-amylase (activity 380 U / mg) in 20ml of filtered and sterilized CaCl2 solution (1m mol / L, pH=7.0); place 5ml of amylase-CaCl2 solution and the ground mixture in a 500ml beaker and incubate the mixture without stirring for 30min in a 37℃ water bath; ② Acidify the mixture in ① above to pH = 2.8 (± 0.1) with 6 mol / L HCL solution, add about 80 mg of pepsin (activity > 3000 U / mg) to the mixture, and further incubate at 37°C with shaking at 110 rpm for 2-4 h; ③ Add 6 mol / L NaOH solution to the above solution to adjust the pH of the above ② mixture to 5.5, dissolve 0.1g pancreatic enzyme (mainly trypsin and pancreatic lipase with activity >227U / mg) and 0.25g bile extract in 10mL 0.5 mol / L NaHCO3 solution, inject into the above 100ml mixture, adjust the mixture to pH = 6.5 (±0.1), and incubate at 37℃ with shaking at 110rpm for 3-5h; Preferably, the step (3) of enrichment culture comprises the following steps: ① In a 5 ml vial, add 1 / 2 pore volume of the basic liquid culture medium from step (1) and then 1 / 20 pore volume of the mixed solution from step (2); ②Add 1 / 10 volume of silicone oil, oily antioxidant and liquid paraffin respectively, and let them naturally separate and block oxygen. Oily antioxidants can be vitamin E and unsaturated fatty acids; ③ Add 1 / 10 volume of 1% cysteine ​​solution, seal and cover, place in the refrigerator or at room temperature for more than 12 hours, and wait for the red color of the oxygen indicator to fade; ④ Take 1g of fresh feces from multiple people, add it to 10ml of basic culture medium solution containing 1% cysteine ​​scavenger, shake and mix, and let it stand for 3-5min; ⑤ Add 1 / 20 volume of the mixed bacterial supernatant to the above-mentioned vial, culture in a 37°C incubator, and after the bacteria grow, aliquot into 1 ml tubes, add glycerol at a final concentration of 15%, and freeze; Preferably, the step (4) of extracting intestinal bacteria nucleic acid comprises the following steps: ① Take 1 ml of the above intestinal bacterial liquid sample, centrifuge at 4000g for 5 minutes and retain the precipitate, add 95% zirconium oxide grinding beads, add 500ul CTAB DNA extraction solution to the centrifuge tube with grinding beads, and grind it in a grinder for 5 minutes; ② Incubate in a 65℃ water bath for 15min, centrifuge at 12000g for 1min; take 400ul of the supernatant into the adsorption column, add 200ul of anhydrous ethanol to the adsorption column, mix thoroughly; centrifuge at 12000g for 1min, and replace the collection tube; ③ Add 500ul of 70% ethanol, centrifuge at 12000g for 1min, replace the collection tube, and repeat this step once more; replace the collection tube again, put in the cleaned adsorption column AC, drop 50μl of elution buffer EB, centrifuge at 12000g for 1min, collect DNA after elution, and perform electrophoresis and imaging scanning on the extracted DNA sample; Preferably, the step (5) high-throughput sequencing and analysis comprises the following steps: ① Design high-throughput sequencing for the 16s rRNA v3-v4 region, and estimate the proportion of each bacterial genus through sequence alignment; ②Analysis samples include Wetland If the proportion of bacteria is less than 5%, the cryopreserved tube is removed and the enrichment culture and nucleic acid extraction of intestinal bacteria in step (3) and step (4) are repeated; ③If Wetland If the bacterial ratio is greater than 5%, continue with the strain separation in step (6); Preferably, the step (6) of strain isolation and cultivation comprises the following steps: ① Prepare in advance the solid culture medium plate containing the ingredients of step (1) and step (2) above, and a ready-to-use anaerobic bag for bacterial liquid coating ("A ready-to-use anaerobic bag for anaerobic plate separation and culture", patent number: ZL201920214535.7) Prepare in advance the ready-to-use anaerobic bag for bacterial liquid coating; ② Take 50ul of the frozen intestinal bacteria sample, dilute it 10 times, and spread it on the above solid culture medium plate, and then culture it at 37℃ for 1-2 days; ③ Pick the clones and carry out enrichment culture as in step (3) above. After the bacteria grow out, they are used for subsequent nucleic acid extraction; Preferably, the step (7) molecular identification of intestinal bacteria comprises the following steps: ① Extract nucleic acid from single colony cultures one by one according to the nucleic acid extraction method in step (4) above; ②Perform PCR experiment according to the following formula: The reaction volume is 20ul, 10X Taq Buffer 2ul, 2.5 mM dNTP mixture 1.6ul, Taq 1u, 10uM primers 0.8ul each, the upstream primer is BlaLP: GGCGAAAGACCAGACTCTCC, the downstream primer BlaRP is: GCAACTGTCAGTGCTCTCTG, the template volume is 1ul, and the rest is made up with pure water; the PCR reaction program is: 95°C 300s; 94°C 15s, 56°C 45s, 72°C 45s, a total of 35-40 cycles; 72°C 300s; ③ The product is detected by electrophoresis, and the presence of a 200bp characteristic band is a positive colony, and the bacteria to which the positive band belongs are Wetland Compared with the prior art, the present invention has the following beneficial effects: (1) Can be carried out under normal aerobic experimental conditions Wetland Cultivation of bacteria, breaking through harsh growth conditions at low cost; (2) Ability to find suitable proteins for screening through enrichment and sequencing Wetland Bacteria samples, overcoming sample complexity; (3) Found a method that can induce Wetland The food additive formula for the large growth of bacteria reduces the screening workload. BRIEF DESCRIPTION OF THE DRAWINGS

[0004] Figure 1 . Wetland The positive band of bacteria screening. M is the marker of DL2000. DETAILED DESCRIPTION

[0005] Example 1. Preparation of YCFA anaerobic medium components Preparation steps: (1) Weigh and add reagents according to the formula in Table 1, and prepare a 1 / 1000 concentration of resazurin stock solution; (2) Add 1 ml of resazurin stock solution (1000 times) to 1 L of liquid culture medium so that the final concentration of resazurin in the culture medium is 1 ppm; (3) Place the liquid culture medium into an anaerobic bottle, pass high-purity nitrogen gas for 1 min, immediately cover it, and sterilize it under high pressure for later use; (4) Prepare 1% cysteine ​​stock solution as a deoxidizer according to Table 2, pass high-purity nitrogen gas for 1 minute, cover immediately, and sterilize under high pressure for later use; Table 1. YCFA liquid medium (1L) Table 2. 1% Cysteine ​​stock solution (1L) Example 2. Wetland Preparation of bacterial enrichment culture Using raw thin-shell pecan kernels as materials, prepare a culture plate suitable for intestinal bacteria culture and transfer according to the following steps: (1) Mix 5 g of chopped raw thin-shell pecan kernels with 100 ml of sterile distilled water and grind them in a mortar at normal speed for 5 min until the kernel particle diameter is <1 mm; dissolve about 50 mg of α-amylase (activity 380 U / mg) in 20 ml of filtered sterilized CaCl2 solution (1 m mol / L, pH = 7.0); place 5 ml of the amylase-CaCl2 solution (see Table 2.3) and the kernel mixture in a 500 ml beaker and incubate the mixture without stirring for 30 min in a 37°C water bath; (2) The kernel mixture was acidified to pH = 2.8 (± 0.1) with 6 mol / L HCL solution, and about 80 mg of pepsin (see Table 2.3) was added to the kernel mixture, and further incubated at 37 °C with shaking at 110 rpm for 2 h; (3) Add 6 mol / L NaOH solution to adjust the pH of the nut mixture to 5.5, dissolve 0.1 g pancreatic enzyme (mainly trypsin and pancreatic lipase with activity > 227 U / mg) and 0.25 g bile extract (see Table 2.3) in 10 mL 0.5 mol / L NaHCO3 solution, inject into 100 ml nut mixture, adjust the pH of the nut mixture to 6.5 (±0.1), and incubate at 37°C with shaking at 110 rpm for 3 h; Example 3. Wetland Bacteria enrichment culture ① In a 5 ml vial, add 1 / 2 pore volume of the YCFA anaerobic medium of Example 1, and then add 1 / 20 pore volume of the enrichment culture mixture of Example 2; ②Add 1 / 20-1 / 10 volume of silicone oil, oily antioxidant and liquid paraffin respectively, and let them naturally separate and block oxygen. Oily antioxidants can be vitamin E and unsaturated fatty acids; ③ Add 1 / 20-1 / 10 volume of 1% cysteine ​​solution, seal and cover, place in the refrigerator or at room temperature for more than 12 hours, and wait for the red color of the oxygen indicator to fade; ④ Take 1g of fresh feces from multiple people, add it to 10ml of basic culture medium solution containing 1% cysteine ​​scavenger, shake and mix, and let it stand for 3-5min; ⑤ Add 1 / 20 volume of the mixed fecal bacterial supernatant to the above-mentioned vial, culture in a 37°C incubator, and after the bacteria grow, dispense directly into 1 ml tubes, add glycerol to a final concentration of 15%, and freeze at -80°C; Example 4. Extraction of intestinal bacterial nucleic acid ① Take 1 ml of the above intestinal bacterial liquid sample, centrifuge at 4000g for 5 minutes and retain the precipitate, add 95% zirconium oxide grinding beads, add 500ul CTAB DNA extraction solution to the centrifuge tube with grinding beads, and grind it in a grinder for 5 minutes; ② Incubate in a 65℃ water bath for 15min, centrifuge at 12000g for 1min; take 400ul of the supernatant into the adsorption column, add 200ul of anhydrous ethanol to the adsorption column, mix thoroughly; centrifuge at 12000g for 1min, and replace the collection tube; ③ Add 500ul of 70% ethanol, centrifuge at 12000g for 1min, replace the collection tube, and repeat this step once more; replace the collection tube again, put in the cleaned adsorption column AC, drop 50μl of elution buffer EB, centrifuge at 12000g for 1min, collect DNA after elution, and perform electrophoresis and imaging scanning on the extracted DNA sample; Example 5. High-throughput sequencing and analysis of bacterial samples ① Specific primers with barcodes were synthesized for high-throughput sequencing targeting the V4-V5 region of 16S rRNA. TransGen AP221-02: TransStart Fastpfu DNA Polymerase was used for PCR; PCR instrument: ABI GeneAmp®9700. After mixing the PCR products, they were detected by 2% agarose gel electrophoresis, and the PCR products were recovered by gel excision using the AxyPrepDNA gel recovery kit (AXYGEN). ② The original sequencing data was spliced ​​after removing the primer adapter sequence and each low-quality base (Phred Quality Score = 20). After removing non-specific amplification sequences and chimeras, the valid sequence data of each sample was obtained. The Mothur software package was used to divide the 16S sequence into operational taxonomic units (OTUs) with a threshold of 97%. RDP classifier2.2 was used to perform taxonomic analysis on the OTU representative sequences at the 97% similarity level to obtain the species classification information corresponding to each OTU, and the bacterial community composition of each sample was statistically analyzed at the kingdom, phylum, class, order, family, and genus levels; the results after the experimental test are as follows: Only minimal medium (CK) and minimal medium contain Wetland The bacterial flora ratio of the bacterial enrichment (RA) is shown in Table 3. The dominant bacteria were 5% bacterial content, and no dominant bacteria appeared in the CK group. Wetland bacteria, and the content of RA group reached the level of dominant bacteria, indicating that RA medium has successfully induced Wetland The RA group had a higher Wetland The abundance level of bacterial genus increased by about 200 times; Table 3 RA medium affects the composition and structure of dominant bacterial genus in intestinal flora CK advantage abundance (%) RA advantage abundance (%) 64.77 27.17 15.44 13.86 6.30 10.66 9.67 7.10 6.98 Example 6. Isolation and cultivation of Blautia strains ① Sterilize 15% agar by high pressure alone, and when it cools down to a temperature that is not too hot, add the preheated liquid culture medium of the above-mentioned Example 1 and Example 2, mix evenly, pour into a plate, dry on a clean bench for 10 minutes, and put into a ready-to-use anaerobic bag prepared in advance for bacterial liquid coating (utility model patent product "A ready-to-use anaerobic bag for anaerobic plate separation and culture", patent number: ZL201920214535.7); ② After the color of the plate fades, operate and coat according to the requirements of the ready-to-use anaerobic bag, and culture at 37℃ overnight; ③ Pick the clones and culture them in the liquid culture medium of Example 1 above, and finally add glycerol to a final concentration of 15% for cryopreservation for testing; Example 7. Molecular identification of intestinal bacteria ① Take 1 ml of the preserved intestinal bacterial liquid sample, centrifuge at 4000g for 5 min and retain the precipitate, add 95% zirconium oxide grinding beads, add 500ul CTAB DNA extraction solution to the centrifuge tube with grinding beads, and grind it in an MM400 grinder at 25HZ for 5 min; ② Incubate in a 65℃ water bath for 15min, centrifuge at 12000g for 1min; take 400ul of the supernatant into the adsorption column, add 200ul of anhydrous ethanol to the adsorption column, mix thoroughly; centrifuge at 12000g for 1min, and replace the collection tube; ③ Add 500ul of 70% ethanol, centrifuge at 12000g for 1min, replace the collection tube, and repeat this step once more; replace the collection tube again, put in the cleaned adsorption column AC, drop 50μl of elution buffer EB, centrifuge at 12000g for 1min, collect DNA after elution, and perform electrophoresis and imaging scanning on the extracted DNA sample; ④ Carry out PCR experiment according to the following formula: reaction volume 20ul, 10X Taq Buffer 2ul, 2.5 mM dNTPmixture 1.6ul, Taq 1u, 10uM primer 0.8ul each, upstream primer is BlaLP: GGCGAAAGACCAGACTCTCC, downstream primer BlaRP is: GCAACTGTCAGTGCTCTCTG, template volume is 1ul, and the rest is made up with pure water; PCR reaction program is: 95°C 300s; 94°C 15s, 56°C 45s, 72°C 45s, a total of 35-40 cycles; 72°C 300s. The PCR instrument is genepro Thermal Cycler (Bori), the electrophoresis device is Beijing Liuyi horizontal electrophoresis device, and the electrophoresis M is the marker of DL2000 (Takara), as shown in the screenshot. Figure 1 The bacterial sample with a 200bp band is Wetland bacteria.

Claims

1. Enrichment and screening Blautia The method of claim 1, wherein: The method comprises the following steps: (1) Preparation of basic anaerobic culture medium: Prepare the basic culture medium components according to the growth rules of most intestinal bacteria and adjust the pH value. These culture media generally contain necessary sugars, proteins, vitamins, and some short-chain fatty acids. Add 1 / 1000 concentration of resazurin as an oxygen indicator, fill with nitrogen, autoclave or filter sterilize; prepare a cysteine ​​solution with a concentration of more than 1%, fill with nitrogen, autoclave or filter sterilize, and use it before inoculation; (2) Preparation of enrichment culture: ① Mix 1-5g of fresh walnuts with 100ml of sterile distilled water and grind them in a mortar at normal speed for 5min; dissolve about 50mg of amylase (activity 380 U / mg) in 20ml of filtered and sterilized CaCl2 solution (1m mol / L, pH=7.0); place 5ml of amylase-CaCl2 solution and the ground mixture in a 500ml beaker and incubate the mixture without stirring for 30min in a 37℃ water bath; ② Acidify the mixture in ① above to pH = 2.8 (± 0.1) with 6 mol / L HCL solution, add about 80 mg of pepsin (activity > 3000 U / mg) to the mixture, and further incubate at 37°C with shaking at 110 rpm for 2-4 h; ③ Add 6 mol / L NaOH solution to the above solution to adjust the pH of the above ② mixture to 5.5, dissolve 0.1g pancreatic enzyme (mainly trypsin and pancreatic lipase with activity >227U / mg) and 0.25g bile extract in 10mL 0.5 mol / L NaHCO3 solution, inject into the above 100ml mixture, adjust the mixture to pH = 6.5 (±0.1), and incubate at 37℃ with shaking at 110rpm for 3-5h; (3) Enrichment culture: ① In a 5 ml vial, add 1 / 2 pore volume of the basic anaerobic medium from step (1) and then 1 / 20 pore volume of the mixed solution from step (2); ②Add 1 / 10 volume of silicone oil, oily antioxidant and liquid paraffin respectively, and let them naturally separate and block oxygen; the oily antioxidant can be vitamin E and unsaturated fatty acid; ③ Add 1 / 10 volume of 1% cysteine ​​solution, seal and cover, place in the refrigerator or at room temperature for more than 12 hours, and wait for the red color of the oxygen indicator to fade; ④ Take 1g of fresh feces from multiple people, add it to 10ml of basic culture medium solution containing 1% cysteine ​​deoxidizer, shake and mix, and let it stand for 3-5min; ⑤ Add 1 / 20 volume of the mixed bacterial solution supernatant to the above-mentioned vial, culture in a 37°C incubator, and after the bacteria grow, aliquot into 1 ml tubes, add glycerol at a final concentration of 15%, and freeze; (4) Extraction of intestinal bacterial nucleic acid ① Take 1 ml of the above intestinal bacterial liquid sample, centrifuge at 4000g for 5 minutes and retain the precipitate, add 95% zirconium oxide grinding beads, add 500ul CTAB DNA extraction solution to the centrifuge tube with grinding beads, and grind it in a grinder for 5 minutes; ② Incubate in a 65℃ water bath for 15min, centrifuge at 12000g for 1min; take 400ul of the supernatant into the adsorption column, add 200ul of anhydrous ethanol to the adsorption column, mix thoroughly; centrifuge at 12000g for 1min, and replace the collection tube; ③ Add 500ul of 70% ethanol, centrifuge at 12000g for 1min, replace the collection tube, and repeat this step once more; replace the collection tube again, put in the cleaned adsorption column AC, drop 50μl of elution buffer EB, centrifuge at 12000g for 1min, collect DNA after elution, and perform electrophoresis and imaging scanning on the extracted DNA sample; (5) High-throughput sequencing and analysis: ① Design high-throughput sequencing for the 16s rRNA v3-v4 region, and estimate the proportion of each bacterial genus through sequence alignment; ②Analysis samples include Blautia If the proportion of bacteria is less than 5%, the cryopreserved tube is removed and the enrichment culture and nucleic acid extraction of intestinal bacteria in step (3) and step (4) are repeated; ③If Blautia If the bacterial ratio is greater than 5%, continue with the strain separation in step (6); (6) Strain isolation and cultivation: ① Prepare in advance the solid culture medium plates containing the ingredients of step (1) and step (2) above, and the ready-to-use anaerobic bags for bacterial liquid coating; ② Take 50ul of the frozen intestinal bacteria sample, dilute it 10 times, and spread it on the above solid culture medium plate, and then culture it at 37℃ for 1-2 days; ③ Pick the clones and carry out enrichment culture as described in step (3) above. After the bacteria grow out, they are used for subsequent nucleic acid extraction; (7) Molecular identification of intestinal bacteria: ① Extract nucleic acid from single colony cultures one by one according to the above step (4) for intestinal bacterial nucleic acid extraction; ②Perform PCR experiment according to the following formula: reaction volume 20ul, 10X Taq Buffer 2ul, 2.5 mM dNTPmixture 1.6ul, Taq 1u, 10uM primer 0.8ul each, upstream primer is BlaLP: GGCGAAAGACCAGACTCTCC, downstream primer BlaRP is: GCAACTGTCAGTGCTCTCTG, template volume is 1ul, and the rest is made up with pure water; PCR reaction program: 95°C 300s; 94°C 15s, 56°C 45s, 72°C 45s, a total of 35-40 cycles; 72°C 300s; ③ The product is detected by electrophoresis. If there is a 200bp characteristic band, it is a positive colony; the bacteria to which the positive band belongs are Blautia bacteria.

Images