Haemophilus parasuis HP-1 strain and application thereof in evaluating efficacy of haemophilus parasuis type 4 inactivated vaccine

Abstract

The invention provides a haemophilus parasuis (HPS) HP-1 strain and an application of the haemophilus parasuis HP-1 strain in evaluation of the efficacy of a haemophilus parasuis type 4 inactivated vaccine, and belongs to the field of biotechnology and animal infectious diseases. According to the invention, a haemophilus parasuis HP-1 strain with strong toxicity and good stability is screened as a standard challenge strain for testing the potency of the HPS 4 type inactivated vaccine, and the challenge strain provided by the invention is used for evaluating the potency of three representative HPS inactivated vaccine products in the market. The challenge strain provided by the invention can accurately evaluate the protective effects of different HPS inactivated vaccine products on the market, and has universality. Meanwhile, the invention also establishes a matched quality evaluation method, a 25-score scoring method is established according to the observation result of the virus detection pig, human influence factors in the process of determining the dissection symptom are reduced through score assignment, and the method has good reliability.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology and animal infectious diseases, and specifically relates to a Haemophilus parasuis HP-1 strain and an application thereof in evaluating the efficacy of Haemophilus parasuis type 4 inactivated vaccine. Background Art

[0002] Haemophilus parasuis ( Haemophilus parasuis , HPS), can cause Haemophilus parasuis disease in pigs, causing symptoms such as fever, coughing, dyspnea, weight loss, lameness, and ataxia. According to the agar diffusion serotyping method, HPS can be divided into 15 serotypes, of which types 4, 5, and 12 are the main prevalent serotypes. At present, the inactivated vaccines approved in China involve six serotypes, 1, 4, 5, 6, 12, and 13, of which type 4 and type 5 products are the most. At present, HPS vaccine products are mainly evaluated based on the product quality standards issued by the Ministry of Agriculture and Rural Affairs. However, due to the different quality control strains and evaluation methods of products from different companies, there is a lack of unified standards, and it is difficult to scientifically and effectively evaluate the efficacy of existing vaccines, which causes certain difficulties in the evaluation work. It is urgent to screen out a unified standard attack strain and establish a supporting evaluation method. Summary of the invention

[0003] The purpose of the present invention is to provide a standard challenge strain of Haemophilus parasuis type 4 inactivated vaccine and a matching quality evaluation method thereof.

[0004] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions: The present invention provides a strain of Haemophilus parasuis ( Haemophilus parasuis ) HP-1 strain, which is deposited in the General Microbiology Center of China Microbiological Culture Collection Administration, located at the Institute of Microbiology, Chinese Academy of Sciences, No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing. The deposit date is October 28, 2024, and the deposit number is CGMCC No.32391.

[0005] The present invention also provides the use of the Haemophilus parasuis HP-1 in evaluating the efficacy of Haemophilus parasuis type 4 inactivated vaccine.

[0006] Preferably, the challenge dose of the HP-1 strain of Haemophilus parasuis to guinea pigs is greater than or equal to 8×10 9 CFU.

[0007] Preferably, the challenge dose of the HP-1 strain of Haemophilus parasuis to pigs is greater than or equal to 3×10 9 CFU.

[0008] Preferably, the method for preparing the challenge bacterial liquid of the HP-1 strain of Haemophilus parasuis is: streak the HP-1 strain of Haemophilus parasuis on a TSA plate containing 4.5-5.5% newborn calf serum and 0.0015-0.0025% NAD, culture at 36-38°C for 45-50 hours, then pick a single colony and inoculate it in 100-150 mL of TSB containing 4.5-5.5% newborn calf serum and 0.0015-0.0025% NAD, and culture on a shaker at 160-200 rpm for 6-10 hours.

[0009] Preferably, the method for evaluating the efficacy of the inactivated vaccine of Haemophilus parasuis type 4 is as follows: the scores are accumulated, and when there are symptoms of pericardial clear effusion, pleural clear effusion, abdominal clear effusion, joint effusion or organ fibrin exudation, each symptom is accumulated with 1 point; When any one or more symptoms of turbid effusion in the pericardium, thorax or abdomen occur, 5 points are awarded; When symptoms of abdominal organ adhesions occur, 5 points are awarded; When any one or both of the symptoms of lung-chest adhesion or lung-pericardium adhesion occur, 5 points are awarded; When symptoms of pericardial thickening and / or villous cardiology are present, 5 points are awarded; When the total score is less than or equal to 3 points, the vaccine is judged to have a protective effect.

[0010] The present invention screens out a Haemophilus parasuis HP-1 strain with strong virulence and good stability as a standard challenge strain for testing the efficacy of HPS type 4 inactivated vaccine. After using the challenge strain provided by the present invention to evaluate the efficacy of three representative HPS inactivated vaccine products on the market, it is found that the challenge strain provided by the present invention can accurately evaluate the protective effects of different HPS inactivated vaccine products on the market and has universal applicability.

[0011] According to the observation results of the poison detection pigs, the present invention refines and distinguishes the typical symptoms of effusion, establishes a 25-point scoring method, and provides a matching quality evaluation method. By assigning points, the human influence factors in the process of autopsy symptom judgment are reduced, and the reliability of the poison detection results is high. BRIEF DESCRIPTION OF THE DRAWINGS

[0012] Figure 1 is the amplification result of 16S rDNA identification in Example 3; Figure 2 The physiological and biochemical identification results in Example 3; Figure 3 It is the typing identification result in Example 3; Figure 4 These are the autopsy pictures of some of the pigs challenged with poison in Example 5.

[0013] Deposit certificate

[0014] Haemophilus parasuis ( Haemophilus parasuis ) HP-1, the strain is deposited in the General Microbiology Center of China Microbiological Culture Collection Administration, located at Institute of Microbiology, Chinese Academy of Sciences, No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing. The deposit date is October 28, 2024, and the deposit number is CGMCC No.32391. DETAILED DESCRIPTION

[0015] In the present invention, TSA and TSB were purchased from Beijing Luqiao Biotechnology Co., Ltd.; NAD was purchased from WebLab Biotechnology Co., Ltd.; newborn calf serum was purchased from Inner Mongolia Aopsay Biotechnology Co., Ltd.; both TSA and TSB were added with 5% newborn calf serum and 0.002% NAD.

[0016] SPF guinea pigs (250-300 g) were purchased from Beijing Weitonglihua Experimental Animal Technology Co., Ltd.; experimental pigs were purchased from a pig farm in Wuming County, Guangxi Zhuang Autonomous Region. All animal experiments were reviewed by the ethics committee.

[0017] The technical solutions provided by the present invention are described in detail below in conjunction with the embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0018] Example 1 Study on Growth Characteristics of Candidate Strains HP-1~HP-10 strains were inoculated into TSA plates and cultured in a 37℃ incubator for 48h. The colony size on the plate was checked and the average diameter of the colonies was calculated. The results are shown in Table 1: Table 1 Average colony size

[0019] Strains with colony size ≥1 mm (i.e., HP-1, HP-3~HP-5, HP-7~HP-9) were selected as candidate strains for further determination of the number of expanded culture bacteria. Single colonies were selected and inoculated into 100 ml TSB, and cultured on a shaker at 37°C and 180 rpm for 8 h. Samples were taken for viable bacterial counts, and the viable bacterial content of the bacterial solution after 8 h of culture was calculated. The experiment was repeated 5 times, and the average of the 5 bacterial counts was calculated. The difference was calculated using the t-test method. The results of the expanded culture are shown in Table 2.

[0020] Table 2 Expanded culture results

[0021] By comparing the mean and variance of the five expansion culture data of each strain in Table 2, HP-1, HP-3 and HP-5 strains with larger live bacteria content and smaller standard deviation of bacterial count were selected for guinea pig toxicity determination.

[0022] Example 2 Guinea pig toxicity test Select three strains of bacteria: HP-1, HP-3, and HP-5, open the strains, dissolve them with 5 ml of bacterial freezing solution (containing 20% ​​newborn calf serum, 10% glycerol, 70% TSB, and 50 ng / μL NAD), and dispense them into 1.5 mL EP tubes, 1 mL per tube, and store the frozen bacteria at -80°C. Take the frozen bacteria, thaw them at room temperature, streak them inoculated in TSA, and culture them in a 37°C incubator for 48 hours. Pick a single colony, inoculate it in 100 mL TSB, culture it in a shaker at 37°C and 180 rpm for 8 hours, and take samples for live bacteria count. According to the live bacteria count results, concentrate or dilute the bacterial solution to 3.0×10 9 CFU / mL, 5.0×10 9 CFU / mL, 8.0×10 9 CFU / mL, 1.0×10 10 CFU / mL, 1.2×10 10 CFU / mL.

[0023] 80 guinea pigs were divided into 16 groups, 5 in each group, and challenged with the virus (grouping is shown in Table 3), and 1 ml of bacterial solution was injected into each guinea pig's abdomen. After the challenge, the guinea pigs were observed every day, and the number of guinea pigs in each group that were sick was recorded. Guinea pigs were judged to be sick if they had clinical symptoms such as rough fur, depression, and bloody stools, and the symptoms lasted for more than 2 days. The results are shown in Table 4.

[0024] Table 3 Guinea pig challenge grouping

[0025] Table 4 Disease results of guinea pigs challenged with poison

[0026] As shown in Table 4, the minimum dose that causes 100% of guinea pigs to become ill is the minimum dose for disease onset, and the minimum dose for disease onset of HP-1 strain is 8.0×10 9 CFU; the minimum dose for HP-3 strain is 1.0×10 10 CFU; the minimum pathogenic dose of HP-5 strain is 1.2×10 10 CFU, among which HP-1 strain had the strongest virulence, therefore, HP-1 strain was selected as the candidate quality control strain for evaluating Haemophilus parasuis type 4 inactivated vaccine.

[0027] Example 3 Bacterial species identification 1. Observation of colony morphology and culture characteristics: HP-1 strain was taken, reconstituted with TSB, and then streaked onto a TSA plate containing 10% newborn calf serum and 0.002% NAD, and cultured at 37°C for 48 hours. The growth of colonies on the TSA plate was observed. The results showed that the colonies of HP-1 strain were round, smooth and moist.

[0028] 2. 16S rDNA identification HP-1 strain TSA plate culture was used as a template, and its 16S rDNA sequence was amplified using 16S rDNA universal primers. The amplification system and reaction procedure are shown in Table 5: 16S rRNA universal primers 27F and 1492R were synthesized by Shanghai Shenggong Biotechnology Co., Ltd., and 2×PCRmaster mix and DNA maker DL1500 were purchased from Takara Biotechnology (Dalian) Co., Ltd., batch number 2222201J.

[0029] Table 5 Amplification system and reaction procedure

[0030] The size of the amplified product is Figure 1 As shown, the PCR product was sent to Beijing Liuhe BGI Technology Co., Ltd. for sequencing, and then the sequencing results were imported into the NCBI database for sequence comparison. The comparison results showed that the PCR product sequence was 100% homologous to Haemophilus parasuis, and the HP-1 strain was identified as Haemophilus parasuis.

[0031] 3. Physiological and biochemical identification The HP-1 strain was streaked onto a TSA plate containing 10% newborn calf serum and 0.002% NAD, and cultured at 37°C for 48 hours. Then, the BUG+B medium (BUG medium + 10% defibrinated sheep blood) was streaked and cultured at 37°C for 24 hours to obtain the IF-C inoculum. The IF-C inoculum was placed in a turbidity meter, and the transmittance of the turbidity meter was adjusted to 100%T. A single colony was vertically dipped with a sterile cotton swab and added to the inoculum. The transmittance was adjusted to 65%, and the suspension was allowed to stand for a while. The suspension was poured into the sample tank, and the suspension was added to the microwells of the GenIII identification plate with a pipette, 100 μL per well, and the lid was covered. The plate was cultured at 37°C for 18 hours. The results are as follows: Figure 2 Shown is Haemophilus parasuis.

[0032] 4. Typing and Identification The plate culture of HP-1 strain was used as a template, and F4 (SEQ ID NO.1: ATGAATAATAAAGTCTCAATTATAA) and R4 (SEQ ID NO.2: TTACATATGTTTTACAATTCC) were used as primers for amplification. The amplification system and reaction procedure are shown in Table 6: PCR primers F4 and R4 were synthesized by Beijing Liuhe BGI Genomics Co., Ltd.; 2×PCR master mix and DNAmaker DL1500 were purchased from Takara Biotechnology (Dalian) Co., Ltd., batch number 2222201J.

[0033] Table 6 Amplification system and reaction procedure

[0034] like Figure 3 As shown, a 753 bp band should appear after serotype 4 amplification, so the typing result of the HP-1 strain was determined to be serotype 4.

[0035] Example 4 Virulence determination of HP-1 strain The sera of 100 experimental pigs were tested using a Haemophilus parasuis antibody detection kit to screen out pigs with negative Haemophilus parasuis antibodies.

[0036] HP-1 strain virulence assay: 20 experimental pigs aged 2 to 4 weeks were divided into 4 groups, with 5 pigs in each group. 9 CFU, 3×10 9 CFU, 6×10 9 CFU, 9×10 9 CFU. Intraperitoneal injection, 5 ml of bacterial solution per head.

[0037] Disease criteria for experimental pigs (if any of the following 4 conditions are met, the pigs will be considered to be on the disease): (1) Death; (2) The body temperature rises by 1°C above the basal body temperature and lasts for 2 days or more; (3) Systemic reaction observation: clinical symptoms such as obvious mental depression, loss of appetite, dyspnea, inability to get up from the ground, diarrhea, and lameness, which last for 3 days or more; (4) The autopsy result is that the patient is ill. The specific evaluation method is shown in the following table: Table 7 Necropsy evaluation method

[0038] The results of toxicity testing in experimental pigs for the four dose groups are shown in Tables 8 to 10.

[0039] Table 8 Observation of systemic reactions of poisoned pigs

[0040]

[0041] Table 9 Results of autopsy of toxic pigs

[0042] Table 10 Results of toxicity testing in experimental pigs

[0043] As shown in Table 10, according to the minimum disease dose criteria, the minimum disease dose of HP-1 strain is 3×10 9CFU, and the disease results obtained by systemic reaction observation are consistent with the disease results obtained by autopsy, indicating that the toxicity detection results obtained by the quality evaluation method established by the present invention have good reliability.

[0044] Example 5 Vaccine Efficacy Evaluation Study The candidate strain HP-1 and three vaccine product quality control strains MD0322, SH, and BJ02 were used for immunization and challenge. The sources are shown in Table 11. Table 11 Proposed vaccines and manufacturers

[0045] The preparation method of the challenge bacterial solution is as follows: streak HP-1 on a TSA plate (containing 5% newborn calf serum and 0.002% NAD), culture it in a 37°C incubator for 48 hours, then pick a single colony, inoculate it into 100 mL TSB (containing 5% newborn calf serum and 0.002% NAD), and culture it at 37°C, 180 rpm in a shaking incubator for 8 hours.

[0046] The challenge and immunization procedures of the three quality control strains are shown in Table 12. The other 15 immunized pigs were challenged with HP-1 strain. Five pigs were used as the control group and were not immunized. The results of the efficacy evaluation of the 7 groups of challenged pigs are shown in Tables 13 to 15. Figure 4 The autopsy results of some of the challenged pigs are as follows: Table 12 Immunization and challenge procedures for the three vaccines

[0047] Table 13 Observation of systemic reactions of challenged pigs

[0048]

[0049] Table 14 Necropsy results of challenged pigs

[0050] Table 15 Results of the efficacy evaluation of HP-1 strain on three products

[0051] The present invention compares the growth characteristics of 10 HPS type 4 strains, and screens out 5 candidate strains with stable growth and easy cultivation; then the candidate strains are subjected to guinea pig virulence assay, and the HP-1 strain with the strongest virulence is further screened out as the candidate strain, and then the HP-1 strain is used as the challenge strain to evaluate the efficacy of three representative HPS inactivated vaccine products in the market, and verify the protectiveness of existing vaccine products against the candidate standard strains. The results show that all three products can produce a protective effect against the HP-1 strain, and can be used to evaluate the protective effects of different HPS inactivated vaccine products.

[0052] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A strain of Haemophilus parasuis ( Haemophilus parasuis ) HP-1 strain, which is deposited in the General Microbiology Center of China Microbiological Culture Collection Administration, located at the Institute of Microbiology, Chinese Academy of Sciences, No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing. The deposit date is October 28, 2024, and the deposit number is CGMCC No.32391.

2. Use of the Haemophilus parasuis HP-1 strain according to claim 1 in evaluating the efficacy of Haemophilus parasuis type 4 inactivated vaccine.

3. The use according to claim 2, characterized in that: The challenge dose of the HP-1 strain of Haemophilus parasuis to guinea pigs is greater than or equal to 8×10 9 CFU.

4. The use according to claim 2, characterized in that: The challenge dose of the HP-1 strain of Haemophilus parasuis to pigs is greater than or equal to 3×10 9 CFU.

5. The use according to claim 2, characterized in that: The preparation method of the challenge bacterial liquid of the HP-1 strain of Haemophilus parasuis is as follows: streak the HP-1 strain of Haemophilus parasuis on a TSA plate containing 4.5-5.5% newborn calf serum and 0.0015-0.0025% NAD, culture it at 36-38°C for 45-50 hours, then pick a single colony and inoculate it in 100-150 mL of TSB containing 4.5-5.5% newborn calf serum and 0.0015-0.0025% NAD, and culture it on a shaker at 160-200 rpm for 6-10 hours.

6. The use according to claim 2, characterized in that: The method for evaluating the efficacy of Haemophilus parasuis type 4 inactivated vaccine is as follows: the scores are accumulated. When there are symptoms of pericardial clear effusion, pleural clear effusion, abdominal clear effusion, joint effusion or organ fibrin exudation, each symptom is scored 1 point. When any one or more symptoms of turbid effusion in the pericardium, thorax or abdomen occur, 5 points are awarded; When symptoms of abdominal organ adhesions occur, 5 points are awarded; When any one or both of the symptoms of lung-chest adhesion or lung-pericardium adhesion occur, 5 points are awarded; When symptoms of pericardial thickening and / or villous cardiology are present, 5 points are awarded; When the total score is less than 3 points, the vaccine is judged to have a protective effect.

Images