An engineered exosome-activated T cell and its application in targeted killing of cancer cells
By synthesizing the UPAR-CAR-Ms2bs gene, 293T cells were transfected and exosomes were collected, co-incubated with T cells, and T cells were activated to target cancer cells, which solved the problems of T cell activation and targeting in the prior art and achieved efficient cancer cell killing.
Patent Information
- Application Number
- CN202411982638.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-12-31
- Publication Date
- 2025-04-08
AI Technical Summary
The prior art is difficult to effectively activate T cells so that they can accurately target UPAR proteins on the surface of cancer cells, thereby improving the killing rate of cancer cells.
By synthesizing the target gene UPAR-CAR-Ms2bs, a vector plasmid was constructed, 293T cells were transfected to collect exosomes, and co-incubated with T cells to activate T cells, allowing them to target cancer cells.
The precise activation and targeted killing of T cells are achieved, which significantly improves the killing rate of cancer cells, has high safety and biocompatibility, and reduces damage to normal tissues.
Smart Images
Figure CN119776274A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the field of biomedicine technology, and in particular to an engineered exosome-activated T cell and its application in targeted killing of cancer cells. Background Art
[0002] At present, for many diseases, especially serious diseases such as cancer, traditional treatment methods have certain limitations. Therefore, finding more effective and accurate treatment methods has always been the focus of medical research.
[0003] T cells play a key role in the human immune system and can identify and kill diseased cells. However, how to effectively activate T cells and accurately target diseased cells has always been a challenge.
[0004] Exosomes, as tiny vesicles secreted by cells, have multiple biological functions and can carry specific bioactive molecules. In recent years, the application of exosomes in disease treatment has received widespread attention. Exosomes are small membrane vesicles secreted by cells that can effectively deliver biological molecules such as mRNA to other cells. Using this natural molecular delivery mechanism, exosome-delivered mRNA technology can encapsulate vaccines or therapeutic genes (such as mRNA) in exosomes to achieve efficient and safe gene delivery. This technology has shown great potential in vaccine development and cancer treatment.
[0005] UPAR (epithelial cell carcinoma antigen) is a membrane protein that is highly expressed in a variety of cancers and plays a key role in the proliferation, metastasis and angiogenesis of cancer cells. Therefore, targeting the UPAR gene can effectively kill cancer cells and prevent them from spreading further.
[0006] The technical problem to be solved by the present application is to use exosomes to activate T cells to target and recognize UPAR proteins on the surface of cancer cells, thereby increasing the killing rate of cancer cells. Summary of the invention
[0007] The purpose of the present invention is to provide a method for activating T cells in vivo using exosomes, so that the activated T cells can accurately target and kill lesion cells, thereby improving the effect of disease treatment.
[0008] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:
[0009] The present invention provides a method for preparing engineered exosome-activated T cells, comprising the following steps:
[0010] (1) Synthesizing the target gene UPAR-CAR-Ms2bs and constructing a vector plasmid containing the target gene;
[0011] (2) Transfect the vector plasmid containing the target gene into 293T cells and collect exosomes;
[0012] (3) Co-incubating the exosomes collected in step (2) with T cells to obtain activated T cells.
[0013] Preferably, the primer sequences for synthesizing the target gene UPAR-CAR-Ms2bs in step (1) are as shown in SEQ ID NOs.1 to 2.
[0014] Preferably, the vector plasmid described in step (1) is pcDNA3.1-EGFP.
[0015] The present invention also provides exosomes obtained by the preparation method.
[0016] The present invention also provides T cells activated by the engineered exosomes obtained by the preparation method.
[0017] The present invention also provides a use of the engineered exosome-activated T cells in targeted killing of cancer cells.
[0018] The present invention utilizes a plasmid carrying a specific gene UPAR to transfect the collected exosomes to activate T cells, enabling them to accurately target and kill lesion cells. It has high safety and biocompatibility, improves the therapeutic effect, can reduce damage to normal tissues, and provides a new idea and method for the treatment of diseases. BRIEF DESCRIPTION OF THE DRAWINGS
[0019] Figure 1 is the plasmid map of UPAR-CAR-Ms2bs in Example 1;
[0020] Figure 2 This is the transfection result in Example 1. DETAILED DESCRIPTION
[0021] The technical solutions provided by the present invention are described in detail below in conjunction with the embodiments, but they should not be construed as limiting the protection scope of the present invention.
[0022] Example 1
[0023] Main reagents
[0024] Reagent name brand Part Number High-fidelity PCR amplification kit Toyobo KOD-401 DNA Gel Recovery Kit Tiangen DP209 Endotoxin-free plasmid miniprep kit Tiangen DP118 Seamless Cloning Kit Novozymes C112-02
[0025] 1.1 Prepare a target plasmid that can carry the UPAR gene to activate T cells or enhance their targeting.
[0026] According to the principle of seamless cloning, recombinant sequences homologous to the vector were added before and after the target gene, and the target gene fragment UPAR-CAR-Ms2bs (SEQ ID NO.3-5, formed by sequentially connecting the sequences in SEQ ID NO.3, SEQ ID NO.4, and SEQ ID NO.5) was chemically synthesized.
[0027] Primer sequences for UPAR-CAR-Ms2bs:
[0028] F:TGTAAGACCAACGGGGATTGC SEQ ID NO.1;
[0029] R:AGCCAGTCCGATAGCTCAGG SEQ ID NO.2.
[0030] The synthesized PCR fragments were recovered from agarose gel.
[0031] The pcDNA3.1-EGFP plasmid vector was double-digested with MluI / XhoI. The digestion conditions were as follows:
[0032]
[0033] The digestion products were recovered after 0.5 h of digestion at 37°C.
[0034] The enzyme-digested vector was recovered by cutting the gel from 1.5% agarose gel.
[0035] The target gene fragment was recombined into the pcDNA3.1-EGFP restriction vector. The recombinant system is as follows:
[0036]
[0037] After mixing, the reconstitution reaction was carried out at 37°C for 30 minutes. After the reaction was completed, the reconstitution reaction solution was immediately placed in an ice bath for 5 minutes.
[0038] Add 100ul Top10 competent cells to the recombinant product, mix well, heat shock at 42℃ for 60s, and ice-bath for 120s. Spread the transformed mixture evenly on an LB plate containing ampicillin resistance and culture at 37℃ overnight.
[0039] Positive clone screening and identification
[0040] Pick a single clone for PCR identification reaction
[0041] The positive clones were sent to Beijing Qingke Company for sequencing (sequencing results were sent with the order). The target plasmid UPAR-CAR-Ms2bs was successfully synthesized, and the map is as follows Figure 1 shown.
[0042] 1.2 After obtaining the target plasmid, transfect it into 293T cells using liposome reagent (Lambolide). The specific steps are as follows: add 50 μl IReduced Serum Medium and 0.8 μg of target plasmid DNA, gently mix to make DNA dilution solution. Add 50 μL of I Reduced Serum Medium and 2.0μl Transfection Reagent (make sure to mix well before use), gently mix to make Transfection Reagent dilution solution, and let stand at room temperature for 5 minutes. Then mix the DNA dilution solution and the Transfection Reagent dilution solution, gently mix, and let stand at room temperature for 20 minutes to form a DNA-Transfection Reagent complex. Add the DNA-Transfection Reagent complex to the seeded 293T cells (the viable cell density reaches 2.5×10 6 ), gently shake the culture plate back and forth to disperse the complex evenly, and replace the culture medium (DMEM+10% FBS+1% P / S) after 5 hours of culture in a 37°C CO2 incubator, and continue to culture for 48 hours. Exosomes secreted by 293T cells were collected by differential centrifugation. Specific steps: First, centrifuge at 4°C, 2000g for 30 minutes, and take the supernatant; centrifuge again at 4°C, 12000g for 30 minutes, and take the supernatant; repeat the above two steps until there is no obvious precipitation; filter with a 0.22um filter membrane into a 50mL centrifuge tube to obtain exosomes, resuspend with PBS, and the number of exosome particles is about 150×10 9 grain.
[0043] Take photos of the transfection results, such as Figure 2 As shown, compared with the blank group (untransfected group), the cell expression in the upar group was stable at 24h and 48h, the cell growth rate was normal, and the transfection was successful.
[0044] T cells have an affinity for engineered exosomes. In this experiment, the harvested exosomes were co-incubated with T cells at a ratio of 1×10 9 Particles / mL exosomes: 1×10 6 / mL T cells were cultured in a 37°C, 5% CO2 incubator for 12 hours. The cell suspension was aspirated and centrifuged at 300g for 5 minutes. After the supernatant was aspirated, T cell culture medium (x-vivo-15, Lonza) was added and cultured in a 37°C, 5% CO2 incubator. Fresh culture medium was added every 48 hours and the cell density was adjusted to 1×10 6 / mL; after 7 days of culture, the cell suspension was aspirated and centrifuged at 300g for 5 minutes. The supernatant was discarded and the cell pellet was resuspended in PBS and the density was adjusted to 2×10 7 / mL, and activated T cells were obtained.
[0045] Example 2
[0046] Target cell killing assay
[0047] This example uses CyQUANT from Thermo Fisher. TM LDH cytotoxicity detection kit was used for detection.
[0048] Cultivation of target cells: Raji cells (Shine Biotech) were cultured using conventional experimental methods in a culture flask containing RPMI-1640 medium and 10% FBS, and the culture flask was placed in a constant temperature incubator at 37° C. and 5% CO 2 .
[0049] Prepare LDH substrate stock solution and assay buffer according to the kit instructions, and then prepare the reaction mixture;
[0050] Prepare 1×LDH positive control: mix 1.5 μl of LDH positive control with 1 mL of PBS containing 1% BSA;
[0051] The target cell concentration was adjusted to 1 × 10 4 / 100 μl, placed in an incubator and cultured overnight, a positive control group, a negative control group, an experimental group, and a blank control group were set up, with 3 replicate wells in each group;
[0052] The effector-target ratios of the activated T cells and Raji cells in the experimental group were set as follows: 0.25:1, 0.5:1, 1:1, 2:1, 4:1;
[0054] Each group was treated as follows:
[0055] Negative control group (spontaneous LDH): add 10 μl of sterile water to three wells of this group;
[0056] Positive control group (maximum LDH): add 10 μl of 10× cell lysate to three wells of this group;
[0057] Experimental group: according to the effector-target ratio, the required number of effector cells / 100 μl was added to the experimental wells in sequence;
[0058] Blank control group: 100 μl of basal medium was added to each well;
[0059] Another control group was set up, which was a plasmid without UPAR gene, and was transfected according to the method of Example 1. The effector-target ratios of the obtained exosome-incubated T cells and Raji cells were as follows: 0.25:1, 0.5:1, 1:1, 2:1, 4:1;
[0061] The 96-well plate was placed in a 37°C, 5% CO2 incubator for 2 hours;
[0062] Transfer 50 μl of the cell suspension from each well to a new 96-well plate;
[0063] Add 50 μl of substrate reaction solution to each well, mix thoroughly, and incubate at room temperature in the dark for 30 minutes;
[0064] Add 50 μl of reaction stop solution to each well and mix thoroughly;
[0065] Determine the absorbance values at 490nm and 680nm, and calculate the result by subtracting the absorbance value at 680nm from the absorbance value at 490nm;
[0066] The relationship between the maximum LDH release control absorbance value minus the spontaneous LDH release control absorbance value and the cell number was plotted to determine the LDH cytotoxicity and target cell killing efficiency. The results are shown in Table 2.
[0067] Table 2 Target cell killing efficiency results
[0068] Group Cell death rate (%) Positive control group 100 Effective target ratio 0.25:1 13.2 Effective target ratio 0.5:1 28.6 Effect-target ratio 1:1 60.2 Effect-target ratio 2:1 78.9 Effect-target ratio 4:1 89.6 Negative control group 0.61
[0069] It can be seen that the higher the effector-target ratio, the better the effect. The cell death rate in the group with an effector-target ratio of 4:1 was close to 90%. However, the results of the control group showed that its highest killing effect was only 12.8%, far lower than that of the experimental group.
[0070] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.
Claims
1. A method for preparing engineered exosome-activated T cells, characterized in that: The steps include: (1) Synthesizing the target gene UPAR-CAR-Ms2bs and constructing a vector plasmid containing the target gene; (2) Transfect the vector plasmid containing the target gene into 293T cells and collect exosomes; (3) Co-incubating the exosomes collected in step (2) with T cells to obtain activated T cells.
2. The preparation method according to claim 1, characterized in that: The primer sequences for synthesizing the target gene UPAR-CAR-Ms2bs in step (1) are shown in SEQ ID NOs. 1 to 2.
3. The preparation method according to claim 2, characterized in that: The vector plasmid described in step (1) is pcDNA3.1-EGFP.
4. Exosomes obtained by the preparation method according to any one of claims 1 to 3.
5. T cells activated by engineered exosomes obtained by the preparation method according to any one of claims 1 to 3.
6. Use of the engineered exosome-activated T cells according to claim 5 in the preparation of a drug that targets and kills cancer cells.