Cell containing dopamine fluorescence report system and asynchronous co-culture method

Abstract

The invention relates to a genetically modified induced neural stem cell and an asynchronous co-culture method. By providing a CRISPR / Cas9 engineered Nurr1-driven dopamine energy report induced neural stem cell model, the differentiation of dopaminergic neural precursor cells and neurons can be monitored in real time, a key pathway related to differentiation heterogeneity is revealed through RNA sequencing, an asynchronous co-culture method is established, and the method has the advantages of simple operation, low cost and high efficiency. The yield and purity of the dopaminergic nerve precursor cells can be improved, and the dopaminergic nerve precursor cells are successfully transplanted and differentiated into dopaminergic neurons in mouse striatum to prove the treatment potential of the dopaminergic nerve precursor cells for Parkinson's disease.

Description

Technical field

[0001] The present invention relates to the field of stem cells, and in particular to cells containing dopaminergic fluorescence reporter systems and asynchronous co-culture methods. Background technology

[0002] Parkinson's disease (PD) is a progressive neurodegenerative disease characterized by the degeneration of substantia nigra dopaminergic neurons, resulting in severe motor symptoms such as tremor, stiffness and sluggish motor. Current treatment strategies for PD include dopamine replacement and deep brain stimulation, but these strategies can only relieve symptoms but cannot stop the disease progression. Therefore, stem cell-based therapy emerged as a promising regeneration approach that aims to supplement dopaminergic neurons. Induced pluripotent stem cells (iPSCs), embryonic stem cells (ESCs) and neural stem cells (NSCs) have shown potential in the generation of transplantable dopaminergic precursor cells (DAPs) and preclinical studies have shown that they can achieve functional recovery in PD models. For example, in the inventors used a non-integrated Sendai virus reprogramming vector to reprogram peripheral blood mononuclear cells (PBMCs) into inducible neural stem cells (iNSCs) in previous studies, and then differentiated them into Chen, Z., et al. First-in-human transmission of autologousinduced neural stem cell-derived dopaminergic precursors to treat Parkinson’s disease. Science Bulletin, 2023).

[0003] However, this treatment still has key challenges: incomplete differentiation of stem cells to functional midbrain dopaminergic neurons or uncontrolled heterogeneity due to natural differentiation often weakens the therapeutic effect, while variability of cells in survival and integration after transplantation further limits clinical transformation (Xue, J., et al. Clinicalconsiderations in Parkinson’s disease cell therapy. Ageing Research Reviews83, 2023). Therefore, validating dopaminergic identity is very important for developing such treatments. Currently, protocols for verifying dopaminergic identity rely mainly on antibody-based neuronal marker detection, but due to differences in antibody quality and batch consistency, this approach is susceptible to variability and cannot fully meet the need to monitor in vivo differentiation dynamics in real time. Additionally, although recent studies have revealed molecular targets that can improve differentiation efficiency and transplant success rates, such as Corin was initially proposed as a predictive marker for embryonic stem cell (ES)-derived dopaminergic neurons, Corin lacks specificity for ventral midbrain progenitors, and in vitro differentiation is not sufficient to predict survival or functional integration potential after transplantation in mammalian models. In summary, the efficient differentiation of functional dopaminergic neurons from multiple stem cells and the efficient differentiation of functional dopaminergic neurons is still the main challenge in neuronal cell therapy. Improving cell replacement therapy strategies for Parkinson's disease requires evaluating the integration and long-term survival of dopaminergic neurons transplanted for alternative treatment, but the current regimen is still unable to meet these needs.

[0004] In addition, studies have shown that different stages of neuronal differentiation secrete different trophic factors and create a unique brain microenvironment composed of dynamic signaling molecules, extracellular matrix components, and intercellular interactions in specific ecological niches. These microenvironments jointly promote dopaminergic neuron maturation and play an important role in neuronal differentiation and functional maturation (Sainio A et al. Extracellular matrix-cell interactions: Focus on therapeutic applications. Cell Signal, 2020). Therefore, in the treatment strategy of cell replacement, introducing cells with artificially controlled levels of heterogeneity (such as specific combinations of cells at different stages of differentiation) is very beneficial for improving the brain microenvironment and improving the therapeutic effect of cell replacement. However, there is still a lack of sufficient research on how to control the heterogeneity of the cell population used for cell replacement therapy to produce a more favorable brain microenvironment and have better therapeutic effects.

[0005] Regarding the need to differentiate iNSCs into dopaminergic neuronal precursor cells suitable for transplantation and improve cell replacement strategies for the treatment of Parkinson's disease, due to the above defects that have yet to be resolved, there is still a need for a solution that can dynamically track the differentiation process and monitor the development of dopaminergic neuronal precursor cells and dopaminergic neurons in real time and visually. It is further necessary to develop an asynchronous co-culture strategy for iNSC differentiation based on dynamic tracking and real-time monitoring results. By simulating the time course of neuronal development, the differentiation efficiency and the survival rate in vivo are improved. Contents of invention

[0006] In order to solve the above technical problems, the inventor developed a CRISPR / Cas9 engineering in iNSCs Nurr1 A promoter-driven dopaminergic reporting model is used to monitor dopaminergic differentiation in real time; and a key pathway related to differentiation heterogeneity is revealed through RNA sequencing, establishing an asynchronous coculture method; and its therapeutic effect is verified through successful transplantation and differentiation in animals.

[0007] In a first aspect of the invention, there is provided a genetically modified inducible neural stem cell containing a dopaminergic reporter system for real-time monitoring of differentiation dynamics of dopaminergic nerve precursor cells and / or dopaminergic neurons, which is mediated by the CRISPR / Cas9-mediated T2A-ZsGreen box in the inducible neural stem cells Nurr1 The expression frame of the downstream loci of the gene is formed by knocking in the frame, the Nurr1 Genes and ZsGreen are both described by Nurr1 The promoter driver of the gene, wherein the sequence of the T2A-ZsGreen box is shown in SEQ ID NO: 11.

[0008] Preferably, the induced neural stem cells are human induced neural stem cells, the Nurr1 Gibbs Nurr1 Gene.

[0009] In a second aspect of the invention, an asynchronous coculture method is provided, which is used to culture dopaminergic nerve precursor cells and improves the yield and purity of the dopaminergic nerve precursor cells. The dopaminergic nerve precursor cells are differentiated into dopaminergic neurons after transplantation into the body and used to treat Parkinson's disease, wherein the asynchronous coculture method comprises the steps of: Step 1: In the first stage differentiation medium, start from inducing neural stem cells, and independently differentiate the population of early-stage inducing neural stem cell differentiation and the population of mid-stage inducing neural stem cell differentiation; Step 2: The early-stage induced neural stem cell differentiation population and the mid-stage induced neural stem cell differentiation population obtained in the first stage differentiation medium are combined in the first stage differentiation medium, wherein the early-stage induced neural stem cell differentiation population and the mid-stage induced neural stem cell differentiation population are mixed in a ratio of 1:6 to 8 cells; Step 3: Replace the first stage differentiation medium with the second stage differentiation medium and continue to co-culture to obtain dopaminergic nerve precursor cells; Among them, in the step 1, the differentiation time of the early induced neural stem cell differentiation population is 4-6 days, and the differentiation time of the mid-term induced neural stem cell differentiation population is 7-9 days; The co-culture time in step 2 is 1-3 days; The continued co-culture time in step 3 is 2-4 days; The first stage differentiation medium contains DMEM / F12, B27, N2, NEAA, GlutaMAX, SAG1, FGF8, and the second stage differentiation medium further contains BDNF, GDNF, TGF-β III, DAPT, ascorbic acid and cAMP based on the first stage differentiation medium.

[0010] Preferably, in step 2, the early-stage induced neural stem cell differentiation population and the mid-stage induced neural stem cell differentiation population are mixed in a ratio of 1:7 cells.

[0011] Preferably, the differentiation time of the early induced neural stem cell differentiation population is 5 days, the differentiation time of the mid-term induced neural stem cell differentiation population is 8 days; the co-culture time in step 2 is 2 days, and the continued culture time in step 3 is 3 days.

[0012] Preferably, the composition of the first stage differentiation medium is 96% DMEM / F12, 1% B27, 1% N2, 1% NEAA, 1% GlutaMAX, 1 µM SAG1, 100 ng / mL FGF8; the composition of the second stage differentiation medium is supplemented with 10 ng / mL BDNF, 10 ng / mL GDNF, 1 ng / mL TGF-βIII, 10 µM DAPT, 0.2 mM ascorbic acid and 0.5 mM cAMP on the basis of the first stage differentiation medium.

[0013] Preferably, the induced neural stem cells are human induced neural stem cells.

[0014] Among them, in step 1, "in the first stage differentiation medium, the early-stage induced neural stem cell differentiation population and the mid-stage induced neural stem cell differentiation population are independently differentiated and cultured in different containers, starting from the induction of neural stem cells, respectively." Moreover, those of ordinary skill in the art will easily arrange the start differentiation time for differentiation into early and mid-stage inducing neural stem cell differentiation populations, respectively, according to the needs of co-culture in Step 2. For example, if step 2 requires co-culture using early inducing neural stem cell differentiation populations of 5 days differentiation and mid-stage inducing neural stem cell differentiation populations of 8 days differentiation, then those of ordinary skill in the art will easily learn that it is necessary to start differentiation of the mid-stage inducing neural stem cell differentiation populations of 3 days before the beginning of differentiation inducing neural stem cell differentiation populations of early inducing neural stem cell differentiation populations.

[0015] The inventors used the induction neural stem cells for real-time monitoring of the differentiation dynamics of dopaminergic nerve precursor cells and / or dopaminergic neurons as described in the first aspect to reveal key pathways related to differentiation heterogeneity through RNA sequencing, and established the asynchronous coculture method described in the second aspect of the present invention.

[0016] According to a third aspect of the invention, the use of inducing neural stem cells according to the first aspect of the invention in evaluating the effect of exogenous factors on dopaminergic neuron maturation, including but not limited to small molecules, growth factors, microenvironmental cues, etc. is provided.

[0017] According to a fourth aspect of the invention, there is provided the use of dopaminergic nerve precursor cells for the preparation of a medicament for the treatment of Parkinson's disease, wherein the dopaminergic nerve precursor cells are dopaminergic nerve precursor cells obtained in accordance with the asynchronous co-culture method of the second aspect of the invention.

[0018] Through the technical solutions provided in the above aspects, the present invention uses CRISPR / Cas9 technology to establish a induced neural stem cell (iNSCs) by using CRISPR / Cas9 technology. Nurr1The promoter-driven dopaminergic reporting system enables real-time monitoring of the differentiation dynamics of dopaminergic neurons and dopaminergic neurons, and provides high temporal resolution for this monitoring, which can provide significantly better differentiation dynamic information obtained by the mechanisms that regulate dopaminergic neuron development than traditional static endpoint analysis. Through this dopaminergic reporting system, the ability to identify key developmental events necessary for successful differentiation provides a research tool for optimizing differentiation protocols. The subsequent use of RNA sequencing (RNA-seq) analysis provides comprehensive insights into the molecular mechanisms behind the differentiation process, especially elucidating the mechanisms that regulate differentiation heterogeneity. On this basis, by simulating the time course of neuronal development, the present invention has developed an asynchronous co-culture method, which significantly improves the yield and purity of dopaminergic nerve precursor cells, and improves differentiation efficiency and improves in vivo survival. Therefore, the technical solutions provided by the present invention have good prospects for the transformation of cell therapy in neurodegenerative diseases (especially Parkinson's disease). Attached description of the drawings

[0019] In order to more clearly illustrate the technical solutions in the present invention or the prior art, the accompanying drawings required for use in the embodiment or the prior art description will be briefly introduced below. It is obvious that the accompanying drawings in the following description are only some embodiments of the present invention. For those of ordinary skill in the art, other accompanying drawings can also be obtained based on these accompanying drawings without giving creative labor.

[0020] Figure 1 CRISPR / Cas9-mediated T2A-ZsGreen cassette in induction of neural stem cells hNurr1 Knock in the expression frame of the site. A: Schematic diagram of the construction of dopaminergic reporter iNSCs, showing the steps to generate engineered neural stem cells (iNSCs) that express ZsGreen after successful integration of T2A sequence. B: Gene knock-in site map depicting T2A-ZsGreen box insertion hNurr1 The precise location of the site highlights the target sites and expected results of the gene editing process. C: The identified genotyping results were constructed, and the successful integration of the T2A-ZsGreen box was confirmed by PCR analysis, and the alleles of wild-type and modified iNSCs were clearly distinguished. D: Genetically modified karyotyping analysis demonstrates the integrity and stability of chromosomes in modified iNSCs, ensuring that the editing process does not cause significant cytogenetic abnormalities. E: Immunofluorescence images show the expression of neural stem cell markers SOX1, SOX2, NESTIN and PAX6 in iNSCs, confirming the maintenance of neural stem cell characteristics after genetic modification. F: T7 endonuclease I assay, showing CRISPR / Cas9 in Nurr1 editing efficiency of site. The undigested PCR product (800 bp) was digested into predicted 310 bp and 490 bp fragments. G: Edited by CRISPR Nurr1 Morphological comparison of knock-in-induced neural stem cells (iNSCs) with parental iNSCs, scale bar: 50 μm.

[0021] Figure 2 Multiline differentiation ability of dopaminergic reporters induces neural stem cells (iNSCs). A: Representative protocol for dopaminergic reporter iNSCs spontaneous differentiation under basal neural stem cell maintenance conditions for 30 days. B: Immunofluorescent staining of post-differentiation cultures demonstrated strong expression of neuron-specific class III β-tubulin (TUJ1) and astrocyte calcium-binding protein S100β, confirming the commitment of neuronal and astrocyte lineages, scale bar: 100 μm.

[0022] Figure 3 Nurr1-derived dopaminergic reporter in vitro dopaminergic neuron differentiation of iNSCs is shown. A: Flow diagram or schematic diagram of traditional differentiation protocols used to generate dopaminergic neurons from Nurr1-derived dopaminergic reporter iNSCs in vitro. B: Immunofluorescence image showing the expression of dopaminergic nerve precursor cells and neuronal markers in differentiated cultures, including LMX1A, FOXA2 and TH. C: Quantitative analysis of immunofluorescence staining of dopaminergic markers. D: QPCR quantitative analysis of dopaminergic nerve precursor cell marker LMX1A. E: Quantitative analysis of qPCR of dopaminergic nerve precursor cell marker TH. F: QPCR quantitative analysis of the dopaminergic nerve precursor cell marker NURR1.

[0023] Figure 4 The heterogeneity of RNA sequencing analysis was shown for analyzing dopaminergic differentiation. A: FACS analysis was used for sorting, showing flow cytometry sorting maps based on ZsGreen reporter gene expression, highlighting both positive and negative populations. B: Heatmap clustering analysis of RNA sequencing data, providing a visual representation of gene expression profiles between different cell populations. C: Volcano map of RNA sequencing data highlighting differentially expressed genes associated with dopaminergic differentiation. D: Gene ontology (GO) enrichment analysis summarizes the biological processes and pathways that are significantly enriched in differentially expressed genes.

[0024] Figure 5 It is shown that the efficiency of differentiation of dopaminergic neurons in iNSCs is improved by optimizing asynchronous coculture. A: A flow chart or schematic diagram describing optimized coculture conditions that enhance dopaminergic differentiation, detailing the interaction between experimental setup and cell type. B: Flow cytometry analysis showed that at various differentiation time points, the ZsGreen fluorescence signal in the co-culture group was significantly stronger than that in the non-co-culture control group, indicating that the differentiation efficiency was improved. C: In vivo imaging of ZsGreen fluorescence was supported by optical microscopy. Compared with the control group, the fluorescence intensity and ratio of the co-culture group increased significantly, further supporting the effectiveness of the co-culture strategy. D: Compared with the control group, the fluorescence intensity and ratio of the co-culture group increased significantly; E: Comparison of RNA levels of each dopaminergic marker under different culture conditions showed that there were significant differences in the expression levels of each dopaminergic marker caused by different culture conditions.

[0025] Figure 6 Dopaminergic reporter differentiation of iNSCs into functional neurons in vivo. A: A schematic diagram of the cell transplant workflow, outlining the procedural steps for evaluating dopaminergic differentiation in vivo. B: Immunofluorescence images of TH and ZsGreen expression in tissue sections, comparing the results of co-culture and original differentiation protocols, verifying that dopaminergic neurons differentiate into functional dopaminergic neurons after transplantation into vivo. Specific implementation methods

[0026] The technical solutions in the embodiments of the present invention will be described clearly and completely. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of them. Based on the embodiments in the present invention, all other embodiments obtained by those skilled in the art without making creative labor are within the scope of protection of the present invention.

[0027] When % is used to represent the concentration of substances in the present invention, % refers to the volume percentage if not specified.

[0028] In the specific examples described below, the cell culture method involving iNSCs is as follows: The culture method of inducing neural stem cells (iNSCs) is as reported in the existing literature (Wang, X. et al., Modulation of human induced neural stem cell-derived dopaminergic neurons by DREADD reveals therapeuticeffects on a mouse model of Parkinson’s disease. Stem Cell Research & Therapy 15, 297, 2024). In short, iNSCs were cultured in complete neural stem cell culture medium containing 48% DMEM / F12 (Gibco, 11330-032), 48% Neurobasal-A (Gibco, 10888-022), 1% B27 (Gibco, 17504044), 1% N2 (Thermo Fisher, 17502048), 1% NEAA (Gibco, 11140-050), 1% GlutaMAX (Gibco, 35050-061), 10 ng / mL recombinant human LIF (Millipore, LIF1010), 3 µMCHIR99021 (Gene Operation, 04-0004) and 2 µM SB431542 (Gene Operation, 04-0010). Cells at 37°C, 5% CO 2 cultured in a wet incubator and passaged every 3-4 days using Accutase (Invitrogen, A11105-01), with a passage ratio of 1:3-1:5.

[0029] In the specific examples described below, the composition of the first stage differentiation medium is: 96% DMEM / F12, 1% B27, 1% N2, 1% NEAA, 1% GlutaMAX, 1 µM SAG1, 100 ng / mL FGF8, and the second stage differentiation medium is supplemented with 10 ng / mL BDNF, 10 ng / mL GDNF, 1 ng / mL TGF-βIII, 10 µM DAPT, 0.2 mM ascorbic acid and 0.5 mM cAMP on the basis of the first stage differentiation medium.

[0030] In the specific examples described below, the specific procedure involved in immunofluorescence staining is: For cell analysis: Cells differentiated on poly-D-lysine / laminin-coated coverslips were fixed with 4% formaldehyde (PFA) for 10 minutes, permeabilized with 0.3% Triton X-100 at room temperature, blocked with 3% donkey serum. Primary antibodies were incubated overnight at 4°C, followed by secondary antibodies in a solution containing 1% donkey serum and 0.3% PBST for 1 hour and stained with 4',6-diamidino-2-phenylindole (DAPI) at room temperature for 15 minutes. For tissue analysis: 8 weeks after transplantation, mice were perfused with frozen PBS and subsequently fixed with 4% PFA. The brain was frozen-protected in 30% sucrose and coronal sections were performed using a Leica SM2000R cryosectioner at a thickness of 40 μm and stored in cryoprotective solution (25% glycerol, 30% ethylene glycol in 0.1M PBS). Brain sections were washed twice with PBS for 5 minutes each time, blocked for 2 hours in 3% donkey serum containing 0.3% PBST, and then incubated overnight with primary antibody in a solution containing 1% donkey serum and 0.3% PBST at 4°C. The next day, the samples were incubated with secondary antibodies in a solution containing 1% donkey serum and 0.3% PBST for 2 hours, and then stained with DAPI at room temperature for 15 minutes. The information of the antibody used is shown in Table 1 below.

[0031] Table 1 Antibodies used in immunofluorescence staining.

[0032] Antibody Manufacturing enterprises Lot# Ratio Anti-Pax-6 BioLegend 901301 1:500 Anti-Nestin Millipore MAB353 1:500 Anti-Sox-2 Santa Cruz Biotechnology sc-365823 1:500 Anti-Sox-1 Santa Cruz Biotechnology sc-17318 1:500 Anti-β3 Tubulin Millipore T2200 1:1000 Anti-S100 β Abcam ab52642 1:200 Anti-TH Millipore ab1542 1:500 Anti-Nurr1 Santa cruz sc-991 1:200 Anti-Lmx1a Millipore ab10533 1:500 Anti-hNA Millipore MAB1281 1:500

[0033] In an embodiment of the invention, with respect to statistical analysis, all experiments were performed in three copies and the data were expressed as mean ± standard deviation (SD). Statistical significance was determined using Student’s t-test or one-way analysis of variance (ANOVA), with p-values ​​less than 0.05 being considered significant.

[0034] Regarding ethical approval and participation consent, all experimental procedures in all embodiments of the present invention comply with the "Guidelines for Care and Use of Laboratory Animals" formulated by the Beijing Institute of Laboratory Animal Sciences and the "Guidelines for Care and Use of Laboratory Animals" of the National Institutes of Health. All research procedures involving animals were approved by the Laboratory Animal Ethics Committee of Xuanwu Hospital, Capital Medical University.

[0035] Example 1 CRISPR / Cas9-mediated T2A-ZsGreen cassette was knocked in within the expression box of the hNurr1 site of iNSCs.

[0036] In order to study the dynamic differentiation state of induced neural stem cells (iNSCs) to dopaminergic neurons in vivo, this example integrates the T2A-ZsGreen box into humans through CRISPR / Cas9 technology. Nurr1 ( hNurr1 ) loci, thus constructing a genetic reporting system. Since Nurr1 is a transcription factor necessary to establish and maintain dopaminergic neuronal identity, it is designed by Nurr1 Promoter-driven ZsGreen reporter gene, thereby enabling real-time tracking and dynamic monitoring of dopaminergic nerve precursor cells.

[0037] The specific construction method of the genetic reporting system is, Figure 1 A, for humans Nurr1 The guide RNA of the site (gRNA, see NURR1-gRNA in Table 2) was cloned into the pX458 vector; a donor plasmid containing the T2A-ZsGreen cassette, flanked by the T2A-ZsGreen cassette Nurr1 1-kb homologous arm. For electroporation and cloning selection, iNSCs (5 × 10 6 2 µg donor plasmid and 2 µg sgRNA plasmid were co-electroporous using Amaxa Nucleofector II (Lonza, Program A-033); after electroporation, cells were recovered in nerve maintenance medium for 72 h, followed by 5 µg / mL puromycin selection for 72 h. Single-cell clones were isolated by limited dilution (1 cell per well in 96-well plates). The cells were then amplified and homozygous clones were verified by genotyping PCR (see Table 2 for verification primers). Among them, the structure of the T2A-ZsGreen box is HAL5'arm-T2A-ZsGreen-TGA-pA-PGK-puro-pA-3'arm HAR, and the specific sequence is shown in SEQ ID NO: 11 (Table 3).

[0038] Table 2 CRISPR-related sequences.

[0039] name Forward Primers Reverse primers NURR1-gRNA CACCgATAATGGAAACTGTCAAGAG (SEQ ID NO: 1) AAACCTCTTGACAGTTCCATTATc (SEQ ID NO: 2) T7 detection primers GCAGAGAGACACGGGCTCAAG (SEQ ID NO: 3) TCAACTCATGCCACCCACGCAAC (SEQ ID NO: 4) Insert 1 verification primer AAAGACGAGAAGAAGCGAGCCC (SEQ ID NO: 5) CGTCACCGCATGTTAGCAGACT (SEQ ID NO: 6) Insert 2 verification primers ctgctaacatgcggtgacgtcgagg (SEQ ID NO: 7) GATCCGGTGGATCCCTCAGGGCAAGGCGGAGCCGGA (SEQ ID NO: 8) Homozygous / heterozygous verification primers TGCAAGAGACACGGGCTCAAG (SEQ ID NO: 9) TCAACTCATGCCACCCACGCAAC (SEQ ID NO: 10)

[0040] Table 3 Structural sequence of ZsGreen box.

[0041] HAL5'arm- T2A-ZsGreen-TGA-pA-PGK-puro-pA-3'arm HAR GTGACTCTTAAATCCCTCATTTATTGCTCTTCAAGTAATTAGTTGTTTAGCTTTTCTCTCTCTCTCTCTTTTTTCCCCTCTCTCTCTCTTTGGTATTAATTGCAGGTCCAACCCCAGTGGAGGGTAAACTCATCTTTTGCAATGGGGTGGTCTTGCACAGGTTGCAATGCGTTCGTGGCTTTGGGAATGGATGGATTGATTGATTCCATTGTTGAATTCCTCCAACTTGCAGAATATGAACAT TTCTGCCTTCTCCTGCATTGCTGCCCTGGCTATGGTCACAGGTCAGTACTGCAGGCGCAGGGCGCTTCCCTCCCTCCAGAACTGCCTAGCAGGATTTGTCCTGAGTTTCCCTTGTCCCCTTGTCACTAGCTTGGTTTTGCCAACTAGCTAACTGTCTTGTACATTCTTTTTTTCTGATTATGTTTTCTGCAGAGAGACACGGGCTCAAGGAACCCAAGAGAGTGGAAGAACTGCAAAACA AGATTGTAAATTGTCTCAAAGACCACGTGACTTTCAACAATGGGGGTTGAACCGCCCCAATTATTTGTCCAAACTGTTGGGAAGCTCCCAGAACTTCGTACCCTTTGCACAGGGGCTACAGCGCATTTTCTACCTGAAATTGGAAGACTTGGTGCCACCGCCAGCAATAATTGACAAACTTTTCCTGGACACTTTTCGAGGGCAGAAGTCTGCTAACATGCGGTGA CGTCGAGGAGAATCCTGGCCCAATGGCCCAATGGCCAGTCCAAGCACGGCCTGACCAAGGAGATGACCATGAAGTACCGCATGGAGGGCTGCGTGGACGCCACAAGTTCGTGATCACCGGCGAGGCATCGGCTACCCCTTCAAGGGCAAGCAGGCCATCAACCTGTGCGTGGAGGCGGCCCTTGCCCTTCGCCGAGGACATCTTGTCCGCCGCCTTCATGTACGGCAACCGCGTGTTCA CCGAGTACCCCCAGGACATCGTCGACTACTACTTCAAGAACTCCTGCCCCGCCGGCTACACCTGGGACCGCTCCCTTCCTTCCTGTTCGAGGACGGCGCCGTGTGCATCTGCAACGCCGACATCACCGTGAGCGTGGAGGAGAACTGCATGTACCACGAGTCCAAGTTCTACGGCGTGAACTTCCCGCCGTGATGAAGAAGAT CATCCCCGTGCCCAAGCAGGGCATCTTGAAGGGCGTGAGCATGTACCTGCTGCTGAAGGACGGTGGCCGCTTGCGCTGCCAGTTCGACACCGTGTACAAGGCCAAGTCCGTGCCCCGCAAGATGCCGGACTGGCACTTCATCCAGCAAGCTGACCCGCGAGGACCGCAGCGCCGCCAAGAACCAGAAGTGGCACCTCCGCCTCCGCCTCCGCCTCCGCCTTGCCCT GAGGATCCACCGGATCTAGGATCAGCCTCGACTGTGCCTTCTAGTTGCCAGCCATCTGTTGTTGCCCTCCCCCCGTGCCTTCCTTGACCCTGGAAGGTGCCACTCCCACCTGTCCTTTCCTTAATAAAATGAGGAAATTGCATCGCATTGTCTGAGTAGGTGTCATTCTATTCTGGGGGTGGGGTGGGCAGGACAGCAAGGGGGAGGATTGGGAAGTCAATAGCAGGCATGCTGGGGGGGG ATGCGGTGGCTCTATGGGCGCCGTTAATTAAGCAATTCTACCGGGTAGGGGAGGCGCTTTCCCAAGGCAGTCTGGAGCATGCGCTTTAGCAGCCCCGCTGGCACTTGGCGCTACACAAGTGGCCTCTGGCCTCGCACACAATTCCACCGGTAGGCGCCAACCGGCTCCGTTCTTGGTGGCCCCCCG CCCCGCAGCTCGCGTCGTGCAGGACGTGACAAATGGAAGTAGCACGTCTCACTAGTCTCGTGCAGATGGACAGCACCGCTGAGCAATGGAAGCGGTAGGCCTTTGGGCAGCGGCCAATAGCAGCTTTGCTCCTTCGCTTTCTGGGCTCAGAGGCTGGGAAGGGTGGTCCGGGCGGGCTCAGGGGCGGCTCAGGGGCGGGCGGCGCCCCGAAGGTCCTCCGGAGGGCCCGGC ATTCTGCACGCTTCAAAAGCGCACGTCTGCCGCGCTGTTCTCCTCTTCCTTCTCATCTCCGGGCCTTTCGACCTGCAGCCCAAGCTTACCATGACCGAGTACAAGCCACCACGGTGCGCCTCGCCACCCGCGACGTCCCCAGGGCCGTACGCACCTCGCCGCCGCGTTCGCCGACTACCCCCGCCGCGTTCGCCGACTACCCCCGCCGTCGCAAGA ACTCTTCCTCACGCGCGTCGGCTCGACATCGGCAAGGTGTGGTCGCGACGACGGCGCCGCGCGTGGCGTCTGGACCACGCCGGAGAGCGTCGAAGCGGGGCGTGTTCGCCGAGATCGGCCGCGCATGGCCGAGTTGAGCGGTTCCCGGCTGGCCGCAGCAACAGATGGAAGGCCTCCTGGCGCACCGCCGCCCAAGGAGCCCGTGGTTCCTGGCCACCGTCGGTC TCGCCCGACCACCAGGGCAAGGGTCTGGCAGCGCCGTCGTGCTCCCCCCGGAGTGGAGGCGCCGAGCGCCGGGTGCCGCCGCCGCCTTCCTGGAGACCTCCGCGCGTGCCGCCGCAACCTCCCCCTTCGAAGCCTGGAAGCCGTCTGCCTTCTA GTTGCCAGCCATCTGTTGTTTGCCCCCCCCGTGCCTTCCTTGACCCTGGAAGGTGCCACTCCCACCTGTCCTTTCCTTAATAAAATGAGGAAATTGCATCGCATTGTCTGAGTAGGTGTCATTCTATTCTGGGGGTGGGGTGGGCAGGACAAGGGGGAGGATTGGGAAGTCAATAGCAGGCATGCTGGGATGGGATGCGGTGGCTCTATGGGCGGCCTCTAGATCAAGAGGGGGCA AGTCACATGGGCAGAGATAGCCGTGTGAGCAGTCTCAGCTCAAGCTGCCCCCCATTTCTGTAACCCTCTAGCCCCCTTGATCCCTAAAAAACAAACAAACAAACAAACAAACAAAACAAAACAAAACAAAACTGTTTTTCCTCAGGCAGAACCTGAAAAGGGCATTTTGGCTCCGGGCATCCTGGATTTAGAACATGGACTACATGGACTACTACAATACAGTGGTATAAACTTTTTATTCTCAGTTTAAAAATCA GTTTGTTCAGAAGAAAGATTGCTATAATGTATAATGGGAAATGTTTGGCCATGCTTGGTTGTTGCAGTTCAGACAAATGTAACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACATCTTAAGGGGACCCAAGTATTGCCCTTTAACAAGACTTCAAAGTTTCTGCTGTAAAGAAAGCTGTAATATATAGTAAAACTAAATGTTGCGTGGGTGGCATGA AGAAGGCAAAGGCTTGTAAATTTACCCAATGCAGTTTGGCTTTTTAAATTATTTTGTGCCTATTTATGAATAATATTACAAATTCTAAAAGATAAAGTGTGTTTGCAAAAAAAAAGAAAAAATAAATAAATACATAAAAAGGGACAAGCATGTTGATTCTAGGTTGAAAATGTTATAGGTTGAAAATGTTATAGGCACTTGCTACTTCAGTAATGTCTATTATAAATAAATAGTATTTCAGACACTATGTAGTCTG (SEQ ID NO: 11)

[0042] To evaluate CRISPR / Cas9 in Nurr1 The editing efficiency of the site was determined using T7 endonuclease I. The specific method for T7 endonuclease I assay is as follows: genomic DNA was extracted from edited iNSCs (DNeasy Blood & Tissue Kit, Qiagen, 69504), PCR amplicons were denatured, reannealed, and digested with T7 endonuclease I (NEB, M0302L) for 1 hour at 37°C (see Table 2 for T7 primers). The products were analyzed by agarose gel electrophoresis.

[0043] The specific process of genomic PCR is to use the QIAamp DNA Mini Kit (Qiagen, 51306) from Nurr1 Genomic DNA was extracted from knocked-in iNSCs. DNA concentration was quantified and adjusted for subsequent testing using a Nanodrop spectrophotometer (NanoDrop 2000, Thermo FisherScientific). For PCR amplification, the target genomic region was amplified using the following reaction mixture (final volume: 50 µL): 10 ng of genomic DNA, 0.5 µM forward and reverse primers, 200 µM dNTP, 1 U rTaq DNA polymerase (TAKARA, R001A), 5 µL 10× reaction buffer, and nuclease-free water to achieve the final volume. Primers were designed according to the homologous arms of the knock-in cassette and the T2A-ZsGreen cassette (see Table 2 for the two sets of validation primers inserted). PCR cycle conditions are performed according to the manufacturer's instructions. PCR products were subjected to agarose gel electrophoresis (1.5% agarose gel) in 1× TAE buffer, developed under UV light, and compared with DNA ladder diagrams to determine the amplicon size.

[0044] For the experimental results of this example, genomic PCR confirmed the modified iNSCs of T2A-ZsGreen box hNurr1 Specific integration of sites ( Figure 1 B, Figure 1 C); Karyotyping analysis showed that modified iNSCs maintained normal chromosomal integrity (46, XY), and no structural or quantitative abnormalities were detected ( Figure 1 D); the results of immunofluorescence analysis showed that modified iNSCs maintained strong expression of typical neural stem cell markers, including SOX1, SOX2, NESTIN and PAX6, which were comparable to those observed in iNSCs ( Figure 1 E); assayed by T7 endonuclease I, Figure 1 F demonstrates the editing efficiency of CRISPR / Cas9 at the Nurr1 site, and it can be seen that the undigested PCR product (800 bp) was digested into 310 bp and 490 bp fragments as expected; in addition, Figure 1 Edited by CRISPR in G Nurr1 By comparing the morphological aspects of knocking in iNSCs with parent iNSCs, it can be seen that the modified iNSCs maintain typical morphological characteristics.

[0045] Example 2 Dopaminergic reporter iNSCs exhibit multilinear neurodifferentiation potential.

[0046] To evaluate the potential of dopaminergic reporter iNSCs to differentiate into different nervous systems, this example first conducted natural differentiation experiments in vitro, and then confirmed the expression of pan-neuron markers by immunofluorescence staining.

[0047] The specific process of natural differentiation is as follows: Figure 2 As shown in A, the dopaminergic reporter iNSCs obtained in Example 1 were isolated into single cells and 1 x 10 per well 5 The cells were seeded on 24-well plates coated with poly-D-lysine (PDL, 10 µg / mL; Sigma-Aldrich, P7886) and laminin (5 µg / mL; Roche, 11243217001) and cultured in natural differentiation medium for 30 days. Natural differentiation medium consists of 96% DMEM / F12 medium, 1% B27, 1% N2, 1% NEAA and 1% GlutaMax. Change the culture medium every 2 days. Immunofluorescence staining analysis was then performed.

[0048] It turns out that Figure 2 B shows that neuron-specific class III β-tubulin (TUJ1) is strongly expressed in differentiated cells, a key component of neuronal cytoskeleton integrity. In addition, the differentiation potential of iNSCs to astrocytes is verified by detecting S100 calcium-binding protein β (S100β), which is mainly concentrated in astrocytes, which are crucial in maintaining homeostasis and supporting neuronal function in the central nervous system. These results confirm the pluripotency of dopaminergic reporter iNSCs, demonstrating their potential for multilinear neurodifferentiation.

[0049] Example 3 Dopaminergic reporters the in vitro differentiation ability of iNSCs to dopaminergic neurons.

[0050] To evaluate the in vitro differentiation potential of dopaminergic reporter iNSCs to dopaminergic neurons, this example uses the following Figure 3 Differentiation scheme shown in A.

[0051] like Figure 3 A, the specific process of dopaminergic differentiation is to separate the dopaminergic reporter iNSCs obtained in Example 1 into single cells and at 2×10 per well. 5 The density of individual cells was seeded onto 6-well plates coated with poly-D-lysine and laminin. Differentiation started with the first stage differentiation medium for 10 days, followed by continued culture for differentiation using the second stage differentiation medium. After differentiation, immunofluorescence staining was performed to evaluate the expression of key dopaminergic neuron-specific markers that play a role in the development of the midbrain base plate and in the specificity and maintenance of dopaminergic neurons in the midbrain.

[0052] It turns out that Figure 3 As shown in B, strong expression of LMX1A, FOXA2 and tyrosine hydroxylase (TH) can be observed, confirming the successful generation of dopaminergic neurons.

[0053] Quantitative analysis shows that Figure 3 C shows that about 20% to 30% of cells showed ZsGreen signal relative to DAPI, with 80% of ZsGreen-positive population co-expressing FOXA2. RNA expression analysis was performed to quantify upregulation of dopaminergic specific markers at different stages of differentiation. like Figure 3 D. Figure 3 E. Figure 3 F shows that significant upregulation of key dopaminergic markers, including LMX1A, TH and NURR1, was observed, further confirming the successful differentiation of iNSCs into functionally mature dopaminergic neurons. To summarize, this result shows that dopaminergic reports that iNSCs retain the ability to differentiate into functional dopaminergic neurons in vitro.

[0054] Example 4 The heterogeneity of dopaminergic differentiation was resolved using FACS and RNA-seq.

[0055] Heterogeneity of differentiated populations remains a challenge in the field, as differentiation heterogeneity of stem cells to functional midbrain dopaminergic neurons can weaken the therapeutic effect. In order to gain an in-depth understanding of the key mechanisms regulating dopaminergic cell differentiation, this example performed fluorescent activated cell sorting (FACS) at a specific differentiation time point, and Nurr1 positive (ZsGreen) + ) and Nurr1 negative (ZsGreen - ) populations were separated for subsequent RNA sequencing (RNA-seq) analysis. like Figure 4 As shown in A, ZsGreen is separated by FACS + cell.

[0056] The specific process of fluorescence activated cell sorting (FACS) was to isolate dopaminergic reporter iNSCs obtained from Example 1 ( Nurr1::ZsGreen ) Dopaminergic nerve precursor cells after 15 days of differentiation were filtered through a 70 micron cell filter and sorted on BD FACS Aria II (nozzle diameter 100 micron, sheath fluid pressure 20 psi). Put ZsGreen + and ZsGreen - The cell population was collected in ice-cold second-stage differentiation medium. The cell activity after sorting was confirmed by trypan blue exclusion method and then downstream analysis was performed.

[0057] The specific process of RNA sequencing analysis is to prepare RNA-seq libraries using TruSeq RNA Library Prep Kit and sequence them on the Illumina NovaSeq 6000 platform. Original reads were aligned to the human genome (GRCh38) using STAR and differential gene expression analysis was performed using DESeq2. Gene ontology (GO) enrichment analysis was performed using the DAVID database.

[0058] The results show that RNA-seq data shows ZsGreen + and ZsGreen - There are different gene expression profiles between these two populations. Figure 4 The differential gene expression analysis shown in B shows that ZsGreen + and ZsGreen - The cells have clear clustering, highlighting significant transcriptional differences. Figure 4 The volcanic map in C further illustrates the amplitude and statistical significance of differentially expressed genes, of which 1468 genes were upregulated and 899 genes were downregulated. Gene ontology (GO) enrichment analysis identified significant enrichment of biological processes and pathways associated with neural differentiation, neuronal maturation, and dopaminergic neuronal development ( Figure 4 D).

[0059] These findings suggest that ZsGreen + The population is highly enriched for cells undergoing active dopaminergic (DA) differentiation, while ZsGreen - Population represents a more heterogeneous mix of undifferentiated or lineage-restricted progenitor cells. The results of RNA-seq analysis elucidate the transcriptional panorama of DA differentiation, which can provide a reference for optimizing differentiation protocols.

[0060] Example 5 The efficiency of differentiation from iNSCs to dopaminergic nerve precursor cells was improved by an optimized asynchronous coculture method.

[0061] During the development of the nervous system, neurons at different stages of differentiation secrete specific trophic factors, and form a dynamic microenvironment by regulating brain region-specific cell interactions, driving the differentiation and functional maturity of neurons. However, the existing differentiation scheme cannot accurately control the dynamic characteristics of the temporal and spatial characteristics of the cell population. In order to improve the differentiation efficiency of differentiation from inducing neural stem cells (iNSCs) to dopaminergic neural precursor cells, this example combines the key pathways of DA differentiation revealed by the RNA-seq analysis results of Example 4 to innovatively develop a stage-specific asynchronous co-culture method, optimize the microenvironment through the "stage complementarity" strategy and break through the bottleneck of DA differentiation efficiency.

[0062] The specific process of asynchronous co-culture of dopaminergic nerve precursor cell differentiation is (see Figure 5 A, where DIV refers to Days in vitro , i.e. the number of days the cells were cultured in vitro): iNSCs were separated into single cells and 2×10 per well 5 The density of individual cells was seeded onto 6-well plates coated with poly-D-lysine and laminin. The two cell populations were differentiated for 5 days (early) and 8 days (medium) in the first stage differentiation medium, respectively. Subsequently, the early and mid-stage differentiation populations were mixed in a ratio of 1:7 and co-cultured with poly-D-lysine and laminin on a 6-well plate coated with poly-D-lysine and laminin for 2 days, followed by continued culture in the second stage differentiation medium for 3 days. This asynchronous coculture method strategically combines early (day 5) and mid-term (day 8) differentiated populations to reproduce spatiotemporal niche interactions. It should be noted that in order to facilitate tracking and observation, the dynamic process of inducing neural stem cells to differentiate into dopaminergic nerve precursors is more objectively evaluated. This example uses iNSCs with dopaminergic reporter system in Example 1, but after establishing a preferred culture method for culturing dopaminergic nerve precursor cells, the iNSCs used to culture dopaminergic nerve precursor cells for treatment dopaminergic nerve precursor cells do not need to contain dopaminergic reporter system.

[0063] The results of the asynchronous co-culture method and the control method were systematically compared with the asynchronous co-culture method using dopaminergic nerve precursor cells differentiated from iNSCs as the control group. The results of flow cytometry analysis showed that at various differentiation time points, the ZsGreen fluorescence signal in the co-culture group was significantly stronger than that in the control group without co-culture ( Figure 5 B. Figure 5 C). In vivo imaging of ZsGreen fluorescence was further supported by optical microscopy, and the results showed that the fluorescence intensity and ratio of the co-culture group increased significantly compared with the control group ( Figure 5 D).

[0064] In addition, to quantitatively analyze molecular changes associated with dopaminergic differentiation, quantitative PCR (qPCR) was performed to evaluate the expression of dopaminergic markers, including tyrosine hydroxylase (TH), FOXA2, LMX1A, NURR1. The specific process of qPCR is to extract total RNA from differentiated dopaminergic (DA) cells and operate according to the manufacturer's protocol using RNeasy Plus MiniKit (Qiagen, product number 74134). Quantitative polymerase chain reaction (qPCR) was performed on the LightCycler 480 II system (Roche) using SYBR Green with thermal cycle parameters: 95°C for 5 minutes and 40 cycles followed by 95°C for 10 seconds and 60°C for 30 seconds. Dopaminergic lineage markers (TH, FOXA2, LMX1A, NURR1) were normalized with GAPDH by 2^(-ΔΔCt) method. See Table 4 for detailed information on the primer sequence used therein.

[0065] Table 4 qPRC primers.

[0066] Target Forward Primers Reverse primers NURR1 GCTGGACTCCCCATTGCTTT (SEQ ID NO: 12) CGGAGCTGTATTCTCCCGAA (SEQ ID NO: 13) LMX1a CGCCAGGAGGAAGTTTCAG (SEQ ID NO: 14) GCCAGGAGGGAGAGAGAGAGG (SEQ ID NO: 15) TH TGTCTGAGGAGCCTGAGATTCG (SEQ ID NO: 16) GCTTGTCCTTGGCGTCACTG (SEQ ID NO: 17) FoxA2 GGGGTAGTGCATCACCTGTT (SEQ ID NO: 18) CCGTTCTCCATCAACAACCT (SEQ ID NO: 19) GAPDH AAGAAGGTGGTGAAGCAGG (SEQ ID NO: 20) AGGTGGAGGAGTGGGTGTCG (SEQ ID NO: 21)

[0067] The results show that Figure 5 E shows that the expression of the above markers in the co-culture group was significantly upregulated compared with the control group that was not co-cultured, confirming the enhanced differentiation of dopaminergic neurons. These findings suggest that coculture methods can enhance the commitment to differentiation from iNSCs to dopaminergic lineages.

[0068] Example 6 Dopaminergic nerve precursor cells differentiate into functional neurons in vivo.

[0069] To confirm that dopaminergic nerve precursor cells generated by dopaminergic reporter iNSCs can differentiate into functional dopaminergic neurons in vivo, this example transplants dopaminergic nerve precursor cells obtained by asynchronous co-culture method of Example 5 to the striatum, followed by immunofluorescence analysis ( Figure 6 A).

[0070] The specific procedures for animal surgery and cell transplantation are: Adult male SCID-Beige mice at 6 to 8 weeks old were anesthetized, and 1×10 were used to place a stereotactic device. 5 Dopaminergic nerve precursor cells were transplanted into the striatum (anterior and posterior = 0.5 mm, left and right = 2.1 mm, vertical = -3.1 mm). Postoperative care included daily monitoring and ibuprofen analgesia, and samples were taken 4 or 8 weeks after transplantation for tissue sections and immunofluorescence staining analysis.

[0071] The results showed that immunofluorescence images showed the expression of tyrosine hydroxylase (TH) and ZsGreen in tissue sections, thus confirming that it can differentiate into dopaminergic neurons in vivo ( Figure 6 B). Fluorescence microscopy analysis revealed the precise positioning of these markers in brain tissue. Meanwhile, ZsGreen, as a fluorescent reporter gene, has its expression that indicates the activity and integration of transplanted dopaminergic nerve precursor cells. In summary, these results provide strong evidence for effective neuronal differentiation and integration, showing the therapeutic potential of dopaminergic neuronal precursor cells obtained by an optimized asynchronous coculture approach in neurodegenerative disease models.

Claims

1. A genetically modified induced neural stem cell, wherein the induced neural stem cell contains a dopaminergic reporter system for real-time monitoring of the differentiation dynamics of dopaminergic neural precursor cells and / or dopaminergic neurons, wherein the dopaminergic reporter system is inserted into the induced neural stem cell through a CRISPR / Cas9-mediated T2A-ZsGreen box. Nurr1 The expression of the gene downstream site is knocked into the gene, Nurr1 Gene and ZsGreen are described Nurr1 The promoter of the gene drives The sequence of the T2A-ZsGreen box is SEQ ID NO:

11.

2. The induced neural stem cell according to claim 1, wherein the induced neural stem cell is a human induced neural stem cell, Nurr1 Genes are human Nurr1 Gene.

3. An asynchronous co-culture method for culturing dopaminergic neural precursor cells and improving the yield and purity of the dopaminergic neural precursor cells, wherein the dopaminergic neural precursor cells differentiate into dopaminergic neurons after being transplanted into the body and are used to treat Parkinson's disease, wherein: The asynchronous co-cultivation method comprises the following steps: Step 1: starting from induced neural stem cells, the early induced neural stem cell differentiation population and the mid-induced neural stem cell differentiation population are differentiated independently in the first stage differentiation medium; Step 2: co-culturing the early induced neural stem cell differentiation population and the mid-stage induced neural stem cell differentiation population obtained in step 1 in the first stage differentiation medium, wherein the early induced neural stem cell differentiation population and the mid-stage induced neural stem cell differentiation population are mixed at a ratio of 1:6-8 in terms of cell number; Step 3: replacing the first stage differentiation medium with the second stage differentiation medium, and continuing the co-culture to obtain dopaminergic neural precursor cells; Wherein, in step 1, the early induced neural stem cell differentiation population is a differentiation population differentiated for 4-6 days, and the mid-induced neural stem cell differentiation population is a differentiation population differentiated for 7-9 days; The co-cultivation time in step 2 is 1-3 days; The continued co-cultivation time in step 3 is 2-4 days; The first stage differentiation medium contains DMEM / F12, B27, N2, NEAA, GlutaMAX, SAG1, and FGF8. The second stage differentiation medium further contains BDNF, GDNF, TGF-βIII, DAPT, ascorbic acid, and cAMP based on the first stage differentiation medium. 4 . The asynchronous co-culture method according to claim 3 , wherein in step 2, the early induced neural stem cell differentiation population and the mid-induced neural stem cell differentiation population are mixed at a ratio of 1:7 in terms of cell number.

5. The asynchronous co-culture method according to claim 3, wherein the differentiation time of the early induced neural stem cell differentiation population is 5 days, and the differentiation time of the mid-term induced neural stem cell differentiation population is 8 days; the co-culture time in step 2 is 2 days, and the continued culture time in step 3 is 3 days.

6. The asynchronous co-culture method according to claim 3, wherein the composition of the first stage differentiation medium is 96% DMEM / F12, 1% B27, 1% N2, 1% NEAA, 1% GlutaMAX, 1 µM SAG1, and 100 ng / mL FGF8; the composition of the second stage differentiation medium is supplemented with 10 ng / mL BDNF, 10 ng / mL GDNF, 1 ng / mL TGF-β III, 10 µM DAPT, 0.2 mM ascorbic acid, and 0.5 mM cAMP based on the first stage differentiation medium. 7 . Use of the induced neural stem cell according to claim 1 in evaluating the effects of exogenous factors on the maturation of dopaminergic neurons.

8. Use of dopaminergic neural precursor cells for preparing a drug for treating Parkinson's disease, wherein the dopaminergic neural precursor cells are dopaminergic neural precursor cells obtained by the asynchronous co-culture method according to any one of claims 3 to 6.

Images