Phage cocktail for preventing and controlling soil-borne bacterial wilt and application thereof

Abstract

The invention discloses a bacteriophage cocktail for preventing and treating soil-borne bacterial wilt, which comprises four strains of ralstonia solanacearum obligate lytic bacteriophages in the following (1)-(4): (1) bacteriophage LC5 with the preservation number of GDMCC NO: 65460-B1; (2) a bacteriophage GC3, the preservation number of which is GDMCC NO: 65459-B1; (3) bacteriophage YH1, the preservation number of which is GDMCCNO: 65461-B1; and (4) bacteriophage YH3, the preservation number of which is GDMCC NO: 65462-B1. Indoor related experiments show that the phage cocktail composed of the four phages GC3, LC5, YH1 and YH3 can effectively inhibit growth of tobacco ralstonia solanacearum, and the effect of the phage cocktail is better than that of a single phage; pot experiments also show that the bacterial wilt can be effectively inhibited.

Description

Technical Field

[0001] The present invention belongs to the field of microbial technology, and relates to a phage cocktail and its application in preventing and controlling soil-borne bacterial wilt of crops, and specifically to a cocktail composed of four lytic phages GC3, LC5, YH1 and YH3 and its application in preventing and controlling soil-borne bacterial wilt of tobacco. Background Art

[0002] Tobacco is an important economic crop. Due to the special climate and planting pattern, soil-borne bacterial wilt has become the main disease of tobacco. The incidence of bacterial wilt is 10% to 70%, causing a large number of tobacco plants to die and causing serious economic losses. As a specialized "killer" of bacteria, bacteriophages have the advantages of specific infection and little disturbance to the environment. They are an important means to prevent and control soil-borne diseases and restore soil health.

[0003] However, the pathogen Ralstonia solanacearum has complex genetic diversity, numerous physiological subspecies, and easy mutation, and the disease-suppressing effect of a single phage is often unstable. Comprehensive analysis found that single phage therapy has the following limitations: 1) Phages are highly specific and have a narrow host range, so phages are often only effective against a certain type or several types of host bacteria, while the lysis effect on other strains is very weak or has no therapeutic effect. 2) The large plasmids in the Ralstonia solanacearum genome carry gene clusters or genetic islands that help improve the pathogenicity and adaptability of Ralstonia solanacearum. For the stress of single phage infection, Ralstonia solanacearum can easily evolve and adapt to form resistance, and even induce increased pathogenicity of Ralstonia solanacearum. 3) Phages have "in situ adaptability", that is, phages are more likely to infect bacteria from the same soil, while the infection ability to bacteria from other soils is relatively weak, which restricts the wide application of phage therapy. Compared with single phages, phage cocktails with different infection receptors have a wider host range, can inhibit bacteria in a targeted manner, and increase the stability of phages under complex and changing conditions. Therefore, the use of phage cocktails to lyse pathogens to prevent and control soil-borne bacterial wilt disease has broad application prospects. Summary of the invention

[0004] The inventors isolated 4 phages LC5, GC3, YH1, and YH3 that can specifically lyse tobacco bacterial wilt from rhizosphere soil of tobacco infected with bacterial wilt in different regions of Fuzhou, and tested the indoor antibacterial effect of the above phages on tobacco bacterial wilt and the prevention and control effect of tobacco potted bacterial wilt. The inventors found that in indoor experiments, the bacterial wilt-specific phages LC5, GC3 or the combination of phages LC5, GC3, YH1 and YH3 can specifically lyse the bacterial wilt isolated from the rhizosphere soil of tobacco, and can also lyse some pathogenic bacterial wilt from other soil-crop systems; in greenhouse potted experiments, the application of phages can effectively prevent the occurrence of tobacco bacterial wilt. The present invention provides a theoretical basis for the development of new and efficient phage preparations against tobacco bacterial wilt.

[0005] The objective of the present invention is achieved through the following technical solutions:

[0006] A bacteriophage LC5, classified and named Ralstonia phage, was deposited in Guangdong Provincial Microbiological Culture Collection Center on November 11, 2024, with the deposit number GDMCC NO: 65460-B1.

[0007] A bacteriophage GC3, classified and named Ralstonia phage, was deposited in Guangdong Microbiological Culture Collection Center on November 11, 2024, with the deposit number GDMCC NO: 65459-B1

[0008] Another object of the present invention is to provide the use of the bacteriophage LC5 or the bacteriophage GC3 in preventing and controlling soil-borne bacterial wilt.

[0009] Preferably, the bacteriophage is applied to the rhizosphere soil of the crop by root irrigation.

[0010] Another object of the present invention is to provide a phage cocktail (i.e., a phage composition) for controlling soil-borne bacterial wilt, wherein the phage cocktail comprises four strains of obligate lytic phages of Ralstonia solanacearum selected from the following (1) to (4):

[0011] (1) the bacteriophage LC5;

[0012] (2) the bacteriophage GC3;

[0013] (3) Bacteriophage YH1, classified and named Ralstonia phage, was deposited in Guangdong Microbiological Culture Collection Center on November 11, 2024, with the deposit number GDMCC NO: 65461-B1;

[0014] (4) Bacteriophage YH3, classified and named Ralstonia phage, was deposited in Guangdong Microbiological Culture Collection Center on November 11, 2024, with the deposit number GDMCC NO: 65462-B1.

[0015] The proportions of the phages in the phage cocktail are the same.

[0016] The total titer of phage in the phage cocktail is 1×10 8 PFU / mL~9×10 8 PFU / mL.

[0017] Another object of the present invention is to provide the use of the phage cocktail in preventing and controlling soil-borne bacterial wilt.

[0018] Preferably, the bacteriophage is applied to the rhizosphere soil of the crop by root irrigation.

[0019] Another object of the present invention is to provide a biocontrol agent for controlling soil-borne bacterial wilt, wherein the biocontrol agent comprises the bacteriophage LC5 or the bacteriophage GC3 or the bacteriophage cocktail.

[0020] Preferably, the titer of the bacteriophage in the biocontrol agent is 1×10 8 PFU / mL~9×10 8 PFU / mL.

[0021] More preferably, the titer of the bacteriophage in the biocontrol agent is 1×10 8 PFU / mL.

[0022] Preferably, when the biocontrol agent contains only the LC5 or the bacteriophage GC3, a bacteriophage LC5 suspension or a bacteriophage GC3 suspension is taken respectively, and the volume ratio of the bacteriophage suspension, the host bacterial liquid and the NA medium is 1:1:150, and the bacteriophage suspension and the host bacterial liquid are co-cultured in the NA medium, the co-culture liquid is centrifuged, and the supernatant is taken and filtered through a 0.22 μm filter membrane. The filtrate is the bacteriophage suspension, and the titer is adjusted to 1×10 8 PFU / mL~9×10 8 PFU / mL. The co-culture conditions are: 30°C, 150-180rpm shaking culture for 24h-48h; the centrifugal speed is 13000rpm.

[0023] When the biocontrol agent contains the phage cocktail, take phage LC5 suspension, phage GC3 suspension, phage YH1 suspension, and phage YH3 suspension respectively, and co-culture the phage suspension and the host bacterial liquid in the NA medium according to the volume ratio of phage suspension, host bacterial liquid, and NA medium of 1:1:150. The co-culture liquid is centrifuged, and the supernatant is taken and filtered through a 0.22 μm filter membrane. The filtrate is the phage suspension, and the titer is adjusted to 1×10 8 PFU / mL~9×10 8 PFU / mL; then the four phage suspensions were mixed in equal volumes to obtain the phage cocktail. The co-culture conditions were: 30°C, 150-180rpm shaking culture for 24h-48h; the centrifugal speed was 13000rpm.

[0024] Preferably, the host bacteria liquid is a bacterial liquid of Ralstonia solanacearum in the logarithmic growth phase.

[0025] Another object of the present invention is to provide a method for preventing and controlling soil-borne bacterial wilt, comprising: adding the bacteriophage LC5, the bacteriophage GC3 or the bacteriophage cocktail or the biocontrol agent into the rhizosphere soil of crops by root irrigation.

[0026] Preferably, 7 to 30 days after the crop seedlings are transplanted, the bacteriophage LC5, the bacteriophage GC3 or the bacteriophage cocktail or the biocontrol agent is added to the rhizosphere soil of the crop by root irrigation.

[0027] Preferably, 1×10 9 PFU~1.8×10 10 PFU phage.

[0028] Specifically, 10 mL to 20 mL of the biocontrol agent is added to each crop. More specifically, 10 mL of the biocontrol agent is added to each crop.

[0029] The soil-borne bacterial wilt described in the present invention is tobacco soil-borne bacterial wilt and tomato soil-borne bacterial wilt.

[0030] Beneficial effects of the present invention:

[0031] The present invention uses the root irrigation method to apply bacteriophages into the soil to inhibit tobacco soil-borne bacterial wilt. The bacteriophages can only infect Ralstonia solanacearum, which reduces the disturbance to the indigenous microbial community in the soil while preventing and controlling soil-borne bacterial wilt. Indoor related experiments show that the phage cocktail composed of four phages, GC3, LC5, YH1 and YH3, can effectively inhibit the growth of tobacco Ralstonia solanacearum, and the effect is better than that of a single phage; potted experiments also show that it can effectively inhibit the occurrence of bacterial wilt, and the application concentration is 1×10 8PFU / mL, and 10mL was applied to each seedling for the best prevention and control effect, which has broad prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0032] Figure 1 The figures are the plate photographs and electron microscopic morphologies of bacteriophages; A is the plate photograph of bacteriophage GC3; B is the electron microscopic morphology of bacteriophage GC3; C is the electron microscopic morphology of bacteriophage LC5; D is the electron microscopic morphology of bacteriophage YH1; and E is the electron microscopic morphology of bacteriophage YH3.

[0033] Figure 2 This is the genetic development tree of four phages.

[0034] Figure 3 The following are the genome maps of four phage strains.

[0035] Figure 4 The antibacterial effects of the four phage strains in combination or individually.

[0036] Figure 5 The control effect of four phage cocktails at different inoculation concentrations on tobacco bacterial wilt; A is the severity of bacterial wilt, and B is the disease index at the end of potting.

[0037] Biodeposit Information:

[0038] Bacteriophage LC5, classified and named Ralstonia phage, was deposited in Guangdong Provincial Microbiological Culture Collection Center on November 11, 2024, address: 5th Floor, Building 59, No. 100, Xianlie Middle Road, Guangzhou, with the deposit number GDMCC NO: 65460-B1.

[0039] Bacteriophage GC3, classified as Ralstonia phage, was deposited in Guangdong Microbiological Culture Collection Center on November 11, 2024, address: 5th Floor, Building 59, No. 100, Xianlie Middle Road, Guangzhou, with the deposit number GDMCC NO: 65459-B1

[0040] Phage YH1, classified and named Ralstonia phage, was deposited in Guangdong Microbiological Culture Collection Center on November 11, 2024, address: 5th Floor, Building 59, No. 100, Xianlie Middle Road, Guangzhou, with the deposit number GDMCC NO: 65461-B1;

[0041] Bacteriophage YH3, classified and named Ralstonia phage, was deposited in Guangdong Provincial Microbiological Culture Collection Center on November 11, 2024, address: 5th Floor, Building 59, No. 100, Xianlie Middle Road, Guangzhou, with the deposit number GDMCC NO: 65462-B1. DETAILED DESCRIPTION

[0042] The culture medium formula is as follows:

[0043] NA liquid culture medium: 10 g glucose, 5 g peptone, 3 g beef extract, 0.5 g yeast powder, 1000 mL deionized water, adjust pH to 7.2-7.4, and sterilize at 115°C for 30 min.

[0044] NA semi-solid medium: Add 10g agar powder to 1L NA liquid medium.

[0045] NA solid medium: Add 25 g agar powder to 1 L NA liquid medium.

[0046] SMSA solid medium: Add 50 mg of TTC, 5 mg of crystal violet, 50 mg of polymyxin, 25 mg of bacitracin, 5 mg of chloramphenicol, 50 mg of cycloheximide, and 5 mg of penicillin to 1000 mL of NA solid medium.

[0047] Example 1

[0048] Phage cultivation

[0049] The inventors took tobacco bacterial wilt as the object, collected rhizosphere soil samples from tobacco bacterial wilt disease-affected areas in different regions of Fuzhou, Jiangxi Province, and isolated the host Ralstonia solanacearum and its obligate bacteriophage.

[0050] Isolation and identification of Ralstonia solanacearum RS-YC01:

[0051] Take 1g of soil sample and put it into a sterilized 50mL conical flask containing 9mL of deionized water (soil-water ratio 1:9g / mL). Put the conical flask into a shaker and shake and culture at 30℃ and 170rpm for 30min to obtain a soil suspension. Take the soil suspension for 10-fold gradient dilution. The specific steps are as follows: take 100μL of soil suspension, add it to a centrifuge tube containing 900μL of sterile water, and vortex; take another 100μL of the mixed soil suspension, add it to a centrifuge tube containing 900μL of sterile water, and repeat this step for gradient dilution to obtain a dilution gradient of 10. -2 , 10 -3 , 10 -4 The soil suspension was diluted to 10 -2 , 10 -3 , 10 -4100 μL of soil suspension was applied to SMSA solid medium, a selective medium for Ralstonia solanacearum, with 3 replicates for each gradient. The culture was incubated at 30°C in a constant temperature incubator for 48 h. Single colonies were streaked on SMSA solid medium and incubated at 30°C in a constant temperature incubator for 48 h. Repeat two to three times to obtain purified single bacteria. Single colonies were inoculated into NA liquid medium and cultured in a shaker at 30°C and 170 rpm for 24 h to obtain a Ralstonia solanacearum culture solution in the logarithmic growth phase (OD 600 =1.2). Take 600 μL of Ralstonia solanacearum in the logarithmic growth phase and put it into a 2 mL centrifuge tube, mix it with 600 μL of 30% glycerol, and store it in a -80°C refrigerator. Pick the above single colony and culture it in NA liquid medium. After PCR of the bacterial liquid (primer sequence Endo-F: ATGCATGCCGCTGGTCGCCGC, Endo-R: GCGTTGCCCGGCACGAACACC Poussier S et al., 2000), send it to the company for sequencing. The egl sequence is compared with the NCBI database. The reference sequence with the highest score belongs to Ralstonia pseudosolanacearum, which is Ralstonia solanacearum, and is named Ralstonia solanacearum RS-YC01.

[0052] Isolation of obligate phages of Ralstonia solanacearum:

[0053] From the tobacco Ralstonia solanacearum specific phages isolated from the bacterial wilt disease outbreak areas in Fuzhou, Jiangxi, the Ralstonia solanacearum specific phages with high efficiency lysis ability were screened out by double-layer agar plate method. The specific implementation plan is as follows:

[0054] The glycerol-preserved Ralstonia solanacearum RS-YC01 screened in situ in Fuzhou was streaked and activated on M-SMSA solid medium and cultured in a constant temperature incubator at 30°C for 48 hours. A single colony on the plate was picked and transferred to NA liquid medium and cultured in a shaker at 30°C and 170rpm for 24 hours to obtain a bacterial solution of Ralstonia solanacearum RS-YC01 in the logarithmic growth phase for later use.

[0055] Weigh 1g of fresh soil sample collected, place it in a sterilized triangular flask, add 9mL of sterile water and mix well, and number them respectively; transfer to a shaker and culture at 30℃ and 170rpm for 1h to obtain an enriched soil suspension. Transfer the enriched soil suspension to a sterilized 2mL centrifuge tube, centrifuge at 13000rpm for 3min, take the supernatant, filter it through a 0.22μm microporous filter membrane, and the filtrate is the phage stock solution.

[0056] Take 250 μL of R. solanacearum RS-YC01 bacterial solution in the logarithmic growth phase, mix it with 25 mL of NA semi-solid medium at an appropriate temperature (45-50°C), and immediately pour it onto the solidified NA solid medium to make a double-layer plate of R. solanacearum. After the medium solidifies, divide the plate into sections and spot-in 10 μL of gradient dilution (10 -1 , 10 -2 , 10 -3 , 10 -4 , 10 -5 , 10 -6 , 10 -7 , 10 -8 ) phage stock solution, culture at 30℃ for 24h~48h, and observe whether there are plaques. When plaques appear, pick a single plaque with the maximum dilution and inoculate it with 10μL of Ralstonia solanacearum RS-YC01 bacterial solution in the logarithmic growth period into 1.5mL NA medium for co-culture, shake culture at 30℃ and 170rpm for 24h to proliferate the phage, centrifuge the co-culture solution at 13000rpm for 3min, take the supernatant, filter it through a 0.22μm filter membrane, and operate the obtained filtrate through the double-layer agar plate method. Repeat 2 to 3 times to obtain a relatively pure obligate phage that can lyse tobacco Ralstonia solanacearum. The obtained new phages are numbered and recorded as phages GC3, LC5, YH1, and YH3 respectively; take 600μL of pure phage suspension, mix it with 30% sterile glycerol in a ratio of 1:1, and store it in a -80℃ refrigerator.

[0057] Phage LC5, classified and named Ralstonia phage, was deposited in Guangdong Microbial Culture Collection Center on November 11, 2024, address: Institute of Microbiology, Guangdong Academy of Sciences, 5th Floor, Building 59, No. 100, Xianlie Middle Road, Guangzhou, with the deposit number GDMCC NO: 65460-B1.

[0058] Bacteriophage GC3, classified as Ralstonia phage, was deposited in Guangdong Microbiological Culture Collection Center on November 11, 2024, address: Institute of Microbiology, Guangdong Academy of Sciences, 5th Floor, Building 59, No. 100, Xianlie Middle Road, Guangzhou, with the deposit number GDMCC NO: 65459-B1

[0059] Phage YH1, classified as Ralstonia phage, was deposited at the Institute of Microbiology, Guangdong Academy of Sciences, Guangdong Microbiological Culture Collection Center on November 11, 2024, address: 5th Floor, Building 59, No. 100, Xianlie Middle Road, Guangzhou, China, with the deposit number GDMCC NO: 65461-B1;

[0060] Phage YH3, classified and named Ralstonia phage, was deposited at the Institute of Microbiology, Guangdong Academy of Sciences, Guangdong Provincial Microbiological Culture Collection Center on November 11, 2024, address: 5th Floor, Building 59, No. 100, Xianlie Middle Road, Guangzhou, with the deposit number GDMCC NO: 65462-B1.

[0061] Preparation of phage suspension:

[0062] Take 10 μL of the preserved phage suspension and co-culture it with 10 μL of Ralstonia solanacearum RS-YC01 bacterial solution in the logarithmic growth period in 1.5 mL of NA medium. The culture conditions are: 30°C, 170 rpm shaking culture for 24 hours, high-speed centrifugation of the co-culture solution at 13000 rpm for 3 minutes, take the supernatant, filter it through a 0.22 μm filter membrane, and the resulting filtrate is the phage suspension.

[0063] Example 2

[0064] Electron microscopic observation of bacteriophage

[0065] 1. Select the bacteriophages GC3, LC5, YH1, and YH3 that need to be observed.

[0066] 2. Prepare a double-layer plate of Ralstonia solanacearum according to the method in Example 1, and drop 150 μL of phage suspension (1×10 8 PFU / mL), placed in a constant temperature incubator, and cultured at 30℃ for 12-24h until plaques appeared. All four phages formed transparent plaques on the plate, with no obvious difference; among them, the plate morphology of phage GC3 was Figure 1 A.

[0067] 3. Add a small amount of sterile ddH2O (500-1000 μL) to the area where the plaques appear and let it stand for about 1 hour. During the standing period, gently shake it several times to allow the phages to float from the agar to the water surface.

[0068] 4. Take an appropriate amount of phage suspension and use 2% phosphotungstic acid staining solution for negative staining. Take it out from the staining solution after staining for about 90 seconds and let it air-dry naturally at room temperature.

[0069] 5. Use transmission electron microscopy to observe the morphology of bacteriophages.

[0070] Depend on Figure 1 B shows that the head of phage GC3 is a regular hexahedron with a sheath, tail tube, base plate and tail fiber. After comparison with the classification standards of the International Committee on Taxonomy of Viruses, this phage belongs to the order Caudovirales, family Myoviridae.

[0071] Depend on Figure 1C shows that the head of phage LC5 is a regular hexahedron with a sheath, tail tube, base plate and tail fiber. After comparison with the classification standards of the International Committee on Taxonomy of Viruses, the phage belongs to the order Caudovirales, family Myoviridae.

[0072] Depend on Figure 1 D shows that the head of phage YH1 is a regular hexahedron with a tail fiber. After comparing with the classification standards of the International Committee on Taxonomy of Viruses, this phage belongs to the order Caudovirales and the family Brachyuraviridae.

[0073] Depend on Figure 1 E shows that the head of phage YH3 is a regular hexahedron with a tail fiber. After comparing with the classification standards of the International Committee on Taxonomy of Viruses, the phage belongs to the order Caudovirales and the family Brachyuraviridae.

[0074] Phage genome sequencing

[0075] The phage genomic DNA was extracted using a kit (λ phage DNA extraction kit, Abigen) according to the instructions. The purity and concentration of the genomic DNA were detected using a NanoDrop 2000 ultra-micro spectrophotometer (NanoDrop, USA) and sent to Shanghai Lingen Biological Company for sequencing.

[0076] The sequencing results showed that the genome sizes of phages GC3, LC5, YH1, and YH3 were 45.3 kb, 44.576 kb, 61.785 kb, and 61.785 kb, respectively, and the GC contents were 61.56%, 61.62%, 64.95%, and 64.95%, respectively. The genome sequences of the phages were subjected to BLAST analysis with some selected standard phages and a phylogenetic tree was constructed, such as Figure 2 As shown in Figure 2, the homology between YH1 and YH3 among the four phage strains is very high. Figure 3 As shown in the figure, it can be found that there are differences in the gene regions encoding proteins of the four phage strains, and there are certain differences in GC content and distribution.

[0077] Example 3

[0078] The ability of phage cocktail to inhibit Ralstonia solanacearum

[0079] The ability of single phage and phage cocktail to inhibit Ralstonia solanacearum was investigated by microplate experiment. The method is as follows:

[0080] Preparation of bacteriophage agent: Referring to Example 1 "Preparation of bacteriophage suspension", bacteriophage GC3, LC5, YH1, and YH3 phage suspensions were prepared respectively, and then the titer of phage was adjusted to 10 with sterile ddH2O. 9PFU / mL, and obtained phage GC3, LC5, YH1 and YH3 agents respectively.

[0081] Preparation of bacterial suspension of R. solanacearum RS-YC01: The bacterial suspension of R. solanacearum RS-YC01 stored in a -80°C ultra-low temperature refrigerator was streaked on SMSA solid medium for activation, and cultured in a constant temperature incubator at 30°C for 48 h; a single colony was picked and inoculated into NA liquid medium, and cultured in a shaker at 30°C and 170 rpm for 24 h to obtain a bacterial suspension of R. solanacearum RS-YC01 in the logarithmic growth phase (OD 600 =1.2), and OD was adjusted with sterile ddH2O 600 To 0.5.

[0082] Phage GC3, LC5, YH1, YH3 and phage cocktail (titer of 10 9 The ability of phage GC3, phage LC5, phage YH1 and phage YH3 (equal volumes of phage GC3, LC5, YH1 and YH3) to infect Ralstonia solanacearum was measured. A total of 6 treatments were set up: (1) phage cocktail culture group: 180 μL NA liquid culture medium, 10 μL Ralstonia solanacearum RS-YC01 bacterial solution, and 10 μL phage cocktail were added to each well; (2) single phage culture group: 180 μL NA liquid culture medium, 10 μL Ralstonia solanacearum RS-YC01 bacterial solution, and 10 μL single phage were added to each well; (3) single culture group: 190 μL NA liquid culture medium and 10 μL Ralstonia solanacearum RS-YC01 bacterial solution were added to each well; (4) blank control: 200 μL NA liquid culture medium was added to each well (to observe whether the culture medium was contaminated). Three replicates were set for each treatment, and the culture was shaken at 30°C and 170 rpm. The OD at 0 h, 8 h, 16 h, and 24 h was measured using an enzyme-labeled instrument. 600 Calculate the antibacterial rate.

[0083] Inhibition rate = 1-(OD 600CK -OD 600p ) / OD 600CK × 100%, where OD 600CK The OD of the single culture group 600 , O.D. 600p Indicates the OD of the pathogen and phage inoculated simultaneously 600 .

[0084] The results are as follows Figure 4As shown. Among the four single phage culture groups, phage GC3 and phage LC5 showed significant inhibitory effects on Ralstonia solanacearum, and the biomass of Ralstonia solanacearum decreased, indicating that phage GC3 and LC5 can specifically lyse tobacco Ralstonia solanacearum; while phage YH1 and phage YH3 cannot inhibit the growth of Ralstonia solanacearum; phage cocktail can significantly inhibit the growth of Ralstonia solanacearum, and the effect is better than that of single phage treatment. Overall, phage cocktail further inhibited the growth of Ralstonia solanacearum.

[0085] Example 4

[0086] Effects of different inoculation concentrations on the efficacy of phage cocktail in controlling tobacco bacterial wilt

[0087] Based on the fact that phage cocktails can improve their antibacterial ability indoors, the inventors further used potted plant experiments to investigate the effects of phage cocktails of different inoculation concentrations in preventing and controlling bacterial wilt in the greenhouse of Nanjing Agricultural University's Baima Base.

[0088] The test soil was a seedling medium without Ralstonia solanacearum.

[0089] Preparation of Ralstonia solanacearum RS-YC01 bacterial suspension: The Ralstonia solanacearum RS-YC01 bacterial suspension stored in a -80℃ ultra-low temperature freezer was streaked on SMSA solid medium for activation and cultured in a constant temperature incubator at 30℃ for 48h. A single colony was picked and transferred to 1.5mL NA liquid medium and cultured in a shaker at 30℃ and 170r / min for 24h. The Ralstonia solanacearum RS-YC01 bacterial suspension was adjusted to OD 600 =0.8, for standby use.

[0090] After surface disinfection of tobacco seeds: soak in 70% alcohol for 1 min, wash once with sterile water, soak in 3% NaClO solution for 5 min, and rinse with sterile water 6 times. Place the disinfected seeds in a sterile plate padded with filter paper soaked in sterile deionized water and germinate at 30°C for two days. Transplant the germinated seeds into a seedling tray (containing a matrix), culture them in the seedling tray until the seedling stage, and transplant the tobacco seedlings into pots. One week after transplanting, take the prepared bacterial solution of Ralstonia solanacearum RS-YC01, dilute it 10 times with ddH2O, and inoculate the bacterial solution of Ralstonia solanacearum RS-YC01 by root irrigation. Inoculate 10 mL of the bacterial solution for each seedling. Five days after inoculation with Ralstonia solanacearum, use the root irrigation method to inoculate the rhizosphere soil of tobacco with different titers of bacteriophage cocktails, taking the titers of 10 in Example 3. 9 PFU / mL of phage GC3, phage LC5, phage YH1, and phage YH3 were mixed in equal volumes and then the total titer of the phages was adjusted to 1.0×10 4 , 1×10 6 , 1×10 8PFU / mL (each phage in each multi-phage cocktail has the same proportion), 10mL was inoculated for each seedling; no phage inoculation was used as a control. Each treatment was repeated 3 times, with 8 seedlings in each repeat. After the inoculation, the growth status of the tobacco plants was recorded, and the soil was kept at a certain humidity. If the leaves turned yellow or other nutrient deficiencies occurred during the growth of the tobacco plants, MS basal culture medium solution (4.74gMS culture medium dissolved in 1L distilled water; MS culture medium, Qingdao Hi-Tech Park Haibo Biotechnology Co., Ltd.) was appropriately added to supplement the nutrition. The incidence of tobacco plants was recorded every week, and the position of the cart was moved once a week to reduce the errors caused by different spatial conditions such as light. After 5 weeks, the incidence of tobacco plants has basically stabilized and the seedlings were harvested.

[0091] like Figure 5 As shown in the figure, with the increase of phage cocktail inoculation concentration, the severity and disease index of tobacco bacterial wilt disease decreased significantly; the severity of the disease was significantly negatively correlated with the inoculation concentration ( Figure 5 A); Inoculation with phage cocktail can significantly reduce the disease index, and high concentration of phage cocktail has a better effect in reducing the disease index ( Figure 5 B).

[0092] Based on the above results, the inventors found that phage cocktail can improve the prevention and control efficiency of bacterial wilt disease, and the higher the inoculation concentration of phage cocktail, the better the prevention and control effect.

Claims

1. A bacteriophage LC5, classified and named Ralstonia phage, was deposited in Guangdong Provincial Microbiological Culture Collection Center on November 11, 2024, with the deposit number GDMCC NO: 65460-B1.

2. A bacteriophage GC3, classified and named Ralstonia phage, was deposited in Guangdong Provincial Microbiological Culture Collection Center on November 11, 2024, with the deposit number GDMCC NO: 65459-B1.

3. Use of the bacteriophage LC5 described in claim 1 or the bacteriophage GC3 described in claim 2 in preventing and controlling soil-borne bacterial wilt.

4. A phage cocktail for controlling soil-borne bacterial wilt, characterized in that: The phage cocktail includes the following four strains of Ralstonia solanacearum obligate lytic phages (1) to (4): (1) The bacteriophage LC5 according to claim 1; (2) The bacteriophage GC3 according to claim 2; (3) Bacteriophage YH1, classified and named Ralstonia phage, was deposited in Guangdong Microbiological Culture Collection Center on November 11, 2024, with the deposit number GDMCC NO: 65461-B1; (4) Bacteriophage YH3, classified and named Ralstonia phage, was deposited in Guangdong Microbiological Culture Collection Center on November 11, 2024, with the deposit number GDMCC NO: 65462-B1.

5. The phage cocktail for controlling soil-borne bacterial wilt according to claim 4, characterized in that: The proportions of the phages in the phage cocktail are the same.

6. The phage cocktail for controlling soil-borne bacterial wilt according to claim 4 or 5, characterized in that: The total titer of phage in the phage cocktail is 1×10 8 PFU / mL~9×10 8 PFU / mL.

7. Use of the phage cocktail according to claim 4 in preventing and controlling soil-borne bacterial wilt.

8. A biocontrol agent for controlling soil-borne bacterial wilt, characterized in that: The biocontrol preparation comprises the bacteriophage LC5 or the bacteriophage GC3 or the bacteriophage cocktail.

9. The biocontrol agent according to claim 8, characterized in that: The titer of the bacteriophage in the biocontrol agent is 1×10 8 PFU / mL~9×10 8 PFU / mL.

10. A method for preventing and controlling soil-borne bacterial wilt, characterized in that: include: The bacteriophage LC5 of claim 1, the bacteriophage GC3 of claim 2, the bacteriophage cocktail of claim 4 or the biocontrol agent of claim 8 is added into the rhizosphere soil of the crop by root irrigation; 1×10 9 PFU~1.8×10 10 PFU phage.

Images