Feruloyl esterase mutants with improved specific activity and application of feruloyl esterase mutants

Abstract

The invention provides feruloyl esterase mutants with improved specific activity and application of the feruloyl esterase mutants, feruloyl esterase genes from bacillus pumilus are subjected to directed evolution and expressed in an escherichia coli expression system, and feruloyl esterase mutants DV1 and DV2 with improved enzyme activity and expression efficiency are obtained through screening. The amino acid sequences of the feruloyl esterase mutants DV1 and DV2 are respectively shown as SEQ ID NO.4 and SEQ ID NO.6. Compared with an original bacterium BpFAE, the feruloyl esterase mutants DV1 and DV2 obtained by the invention have the advantages that the protein yield is increased, the specific activity on feruloyl methyl esterase is improved, and the degradation efficiency on a macromolecular p-nitrophenol ester substrate is higher. Therefore, the strain can be used for degrading plant fibers and preparing feed leavening agents, and has a good market application prospect.

Description

Technical Field

[0001] The invention belongs to the technical field of bioengineering, and in particular relates to a ferulic acid esterase mutant with improved specific activity and application thereof. Background Art

[0002] my country is facing a serious shortage of feed resources. It is increasingly important to tap the energy supply potential of fiber in plant feed and improve the utilization rate of feed resources. Ferulic acid in plant cell walls is covalently cross-linked with hemicellulose and lignin, and its structure is complex, which hinders the degradation and utilization of wood fiber. Ferulic acid esterase can act on the ester bond between ferulic acid and polysaccharides to promote the degradation of plant fibers. Improving the gene expression and molecular catalytic efficiency of ferulic acid esterase is the key to whether ferulic acid esters can be used to efficiently degrade plant fibers.

[0003] Since the application of enzymes from microorganisms in industry is subject to many restrictions, it is very important to improve the activity, stability, substrate specificity, etc. of enzymes. Protein engineering technology provides opportunities for this. Protein molecule improvement technology is mainly divided into three types, namely directed evolution, semi-rational design and rational design. Directed evolution is now widely used in molecular modification, including error-prone PCR, DNA shuffling, saturation mutation, staggered extension and other technical methods. Protein modification through error-prone PCR technology has been widely and successfully applied to the modification of the properties of various enzymes.

[0004] The bacterial expression system is a very mature expression system, and Escherichia coli has a clear genetic background, high safety, fast reproduction, low cost, high conversion efficiency, and is easy to culture on a large scale. Ferulic acid esterase achieves extracellular soluble secretion in the Escherichia coli expression host. Summary of the invention

[0005] The purpose of the present invention is to provide a ferulic acid esterase mutant with improved catalytic activity and application thereof. The present invention molecularly transforms a ferulic acid esterase gene derived from Bacillus pumilus, expresses it in Escherichia coli, performs rescreening using an ethyl ferulate plate screening method, and obtains ferulic acid esterase mutants DV1 and DV2 with high catalytic activity and expression efficiency through error-prone PCR technology.

[0006] In order to achieve the above-mentioned purpose, the present invention adopts the following technical solutions: The present invention provides a ferulic acid esterase mutant DV1, whose amino acid sequence is shown in SEQ ID NO.4, which is obtained by changing the 41st amino acid of the amino acid sequence shown in SEQ ID NO.2 from aspartic acid to valine.

[0007] The present invention provides a gene encoding the ferulic acid esterase mutant DV1, and the nucleotide sequence thereof is shown in SEQ ID NO.3.

[0008] The present invention provides a ferulic acid esterase mutant DV2, whose amino acid sequence is shown in SEQ ID NO.6, which is obtained by changing the 41st amino acid of the amino acid sequence shown in SEQ ID NO.2 from aspartic acid to valine and the 147th glycine to alanine.

[0009] The present invention provides a gene encoding the ferulic acid esterase mutant DV2, and the nucleotide sequence thereof is shown in SEQ ID NO.5.

[0010] The present invention further provides a recombinant vector and a recombinant strain containing the feruloyl esterase mutant DV1 or the feruloyl esterase mutant DV2.

[0011] The present invention further provides a starter culture containing the feruloyl esterase mutant DV1 or the feruloyl esterase mutant DV2.

[0012] The present invention further provides the use of the feruloyl esterase mutant DV1 or the feruloyl esterase mutant DV2 in fermenting plant feed.

[0013] Furthermore, the enzymatic hydrolysis reaction conditions of the ferulic acid esterase mutants DV1 and DV2 are: pH 9, 50° C., and reaction time 10 min.

[0014] Furthermore, the ferulic acid esterase mutants DV1 and DV2 are used to catalyze the enzymatic hydrolysis of substrates containing ferulic acid ester bond sites in plant feed.

[0015] Furthermore, the substrate includes methyl ferulate and C4-C16 p-nitrophenol ester.

[0016] Furthermore, the ferulic acid esterase mutants DV1 and DV2 have improved enzyme specific activities for methyl ferulate and p-nitrophenolate substrates, and the larger the molecule, the more the specific activity is improved.

[0017] Compared with the prior art, the advantages and technical effects of the present invention are as follows: the present invention uses the ferulic acid esterase gene BpFAE (shown in SEQ ID NO.1) as a template, performs random mutation on it through error-prone PCR technology, mutates its nucleotides, and obtains the coding gene of the FAE mutant. Using pET22b as an expression vector, constructs a recombinant plasmid carrying the mutant gene, uses Escherichia coli BL21 (DE3) as a host, and expresses the mutant protein. The mutant strain is fermented, and the production of the mutant and the original bacteria fermentation supernatant on the ethyl ferulate substrate plate is compared by Oxford cup, and the positive mutant is screened out. After the protein is purified, methyl ferulate and p-nitrophenol esters of different carbon chain lengths (C4, C6, C8, C12, C16) are used as substrates to determine the activity of the protein.

[0018] The mutants DV1 and DV2 are obtained by mutation screening. Compared with the original BpFAE, the mutants DV1 and DV2 have significantly improved protein yields, significantly improved specific activity for methyl ferulate, and higher degradation efficiency for macromolecular p-nitrophenol ester substrates. The mutants can be used to degrade plant fibers and prepare feed fermentation agents, and have good market application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 A flowchart for constructing a recombinant expression vector; Figure 2 Agarose gel electrophoresis results for linearization identification of target gene and vector; Figure 3 The results of PCR verification of the recombinant bacterial solution; Figure 4 Comparison of the results of extracellular crude enzyme activity assay of mutant ferulic acid esterase; 1: DV2; 2: DV1; Figure 5 These are the results of protein electrophoresis of the mutant protein and the original protein after purification; 1: DV1; 2: DV2; 3: BpFAE. DETAILED DESCRIPTION

[0020] The following embodiment is only a preferred solution of the present invention and does not limit the present invention in any form. There are other variations and modifications without exceeding the technical solution described in the claims. The protection scope of the present invention and the scope of claims are not limited to the cases provided.

[0021] Solution preparation: LB liquid medium: 5 g Yeast extract, 10 g Tryptone, 10 g NaCl, add 1 L deionized water, and autoclave at 121°C for 30 min.

[0022] Ethyl ferulate substrate plate: 0.3 g ethyl ferulate was dissolved in 3 mL N,N-dimethylformamide, and added with 2 g agar powder in 100 mL deionized water, and heated to mix.

[0023] Ampicillin sodium solution (Amp 100 mg / mL): 1 g Amp was dissolved in 10 mL water and sterilized with a 0.22 μM filter membrane for later use.

[0024] PBS buffer (pH 7.4): KCl 0.2 g, NaCl 8 g, KH2PO4 0.24 g, Na2HPO4·12H2O 3.63 g, dissolved in 1 L of deionized water.

[0025] Preparation of pH 9 0.05M Tris-HCL buffer: 50mL 0.1M Tris + 7mL 0.1N HCL, dilute to 100mL with water.

[0026] 3 mM methyl ferulate solution: 15.7 mg methyl ferulate was dissolved in 1 mL methanol and then diluted with 24 mL pH 9 0.05 M Tris-HCl buffer.

[0027] Lysis Buffer: 7.80 g NaH2PO4·2H2O, 17.54 g NaCl, 0.68 g imidazole, dissolved in 1 L deionized water, adjusted to pH 8.0 with NaOH solution, and filtered through a 0.22 μM water filter membrane.

[0028] Wash Buffer: Add 1.36 g of imidazole. Other ingredients are the same as Lysis Buffer.

[0029] Elution Buffer: Add 34.0 g of imidazole. Other ingredients are the same as Lysis Buffer.

[0030] Nickel column storage buffer: 1 × PBS containing 20% ​​ethanol.

[0031] Example 1: Construction of expression vector 1. Construction of recombinant expression vector PCR primer design and target fragment amplification and recovery Primers BpFAE-F (pET22b), BpFAE-R (pET22b), pET22b-F, and pET22b-R were designed using SnapGene software. Linearization was performed at the cloning site of the vector, and a 15-20 bp homologous sequence that was completely consistent with both ends of the vector cloning site was introduced at the 5' end of the insert fragment PCR primer. The primers were synthesized by Sangon Biotech (Shanghai) Co., Ltd. The process for constructing a recombinant expression vector is as follows Figure 1 shown.

[0032] BpFAE--F(pET22b): cggcgatggccatggatatcATGAACCTGCAAGAACAAATTAAAAT (SEQ ID NO.7); BpFAE--R(pET22b):tgctcgagtgcggccgcaagTTCAAATGCCTTCTTCAGTTGATC (SEQ IDNO.8); pET22b-F: GATATCCATGGCCATCGCCGGCT (SEQ ID NO.9); pET22b-R: CTTGCGGCCGCACTCGAGCA (SEQ ID NO. 10).

[0033] A plasmid containing the full-length BpFAE encoding nucleotide sequence (SEQ ID NO. 1) (synthesized by Beijing Qingke Biotechnology Co., Ltd.) was used as a template for error-prone PCR amplification to obtain the amplified product.

[0034] The PCR reaction system is as follows: Error-prone PCR mix 15 μL; MnCl2 for Error-prone PCR 3 μL; DNA (4 ng / μL) 5 μL; Primer-F (10 μM) 1 μL; Primer-R (10 μM) 1 μL; add ddH2O to 30 μL.

[0035] PCR reaction conditions: (1) 95°C, 3 min; (2) 95°C, 30 s; 63°C, 30 s; 72°C, 1 min; 40 cycles; (3) 72°C, 10 min.

[0036] Using the plasmid containing the full-length pET22b sequence as a template, the vector was linearized by PCR amplification. The reaction system was as follows: 2×PrimeSTAR Max DNA Polymerase 25μL; DNA (4 ng / μL) 2μL; Primer-F (10 μM) 2.5μL; Primer-R (10 μM) 2.5μL; add ddH2O to 50μL.

[0037] Reaction conditions: (1) 98°C, 2 min; (2) 98°C, 10 s; 55°C, 15 s; 72°C, 20 s; 32 cycles; (3) 72°C, 10 min.

[0038] 2. Agarose gel electrophoresis of PCR products and recovery of target gene Take 1 μL of PCR product, detect it by 1.0% agarose gel electrophoresis to check whether it is a single band, and purify it using a DNA purification kit. Figure 2 As shown, a single band of the target gene BpFAE and vector pET22b was obtained, and the size was correct. The purified PCR products of the target gene and vector were treated with Dpn I to reduce the probability of false positives due to the template plasmid in transformation. The reaction system is as follows: Dpn I 1μL; 10×T buffer 2μL; DNA ≤1 μg; addddH2O to 20μL.

[0039] 3. Construction of BpFAE-pET22b expression vector The target gene PCR product was seamlessly cloned and connected with the vector. The reaction system was as follows: Mix 5; DNA X; Vector Y; add ddH2O to 10. Ligate at 50℃ for 5 min, place on ice or 4℃ for transformation.

[0040] IV. Transformation of cloning host DH5α (1) Thaw DH5α competent cells on ice, add 10 μL of enzyme-linked product, and let stand on ice for 30 min; (2) Heat shock in a 42°C water bath for 45 seconds, then place on ice for 2-3 minutes; (3) Add 0.9 mL of fresh LB liquid and incubate the cells at 37°C, 200 rpm for 1 h.

[0041] (4) Spread on Amp-resistant plates and culture at 37°C overnight.

[0042] Pick a single colony, inoculate it in LB (100 μg / mL Amp), shake the bacteria for 7-8 hours, perform PCR verification on the bacterial solution, and send the verified transformants for sequencing. If the sequencing results are correct, use them for the next step of transformation.

[0043] 5. Transformation of Expression Host The transformation operation of BL21 (DE3) is the same as that of DH5α. Take part of the transformation solution to plate and culture overnight. Take a single colony of the positive transformant, shake the bacteria, and do a PCR verification of the bacterial solution. The result is as follows: Figure 3 Verify that the stripe size is correct as shown.

[0044] Example 2: Fermentation and screening of recombinant bacteria Pick a single colony of the mutant recombinant bacteria and the control original bacteria and shake the bacteria (including resistance), culture at 37℃ for 8 hours as seed liquid, and then inoculate 2% into the fermentation bottle for fermentation, with 3 parallels for each positive bacteria. When the bacteria grow to a liquid OD value of 0.6-0.8, add IPTG (final concentration to 0.5 mM) for overnight induction. Take 200 μL of the fermentation supernatant and add it to the Oxford cup, and observe the production of the plate containing ethyl ferulate after 37℃ and 10 hours. Preliminary screening of the positive mutants DV1 and DV2.

[0045] The amino acid sequence of the feruloyl esterase mutant DV1 is shown in SEQ ID NO.4, which is obtained by changing the 41st amino acid of the amino acid sequence shown in SEQ ID NO.2 from aspartic acid to valine. The nucleotide sequences of the feruloyl esterase mutant DV1 are shown in SEQ ID NO.3. The amino acid sequence of the feruloyl esterase mutant DV2 is shown in SEQ ID NO.6, which is obtained by changing the 41st amino acid of the amino acid sequence shown in SEQ ID NO.2 from aspartic acid to valine and the 147th glycine to alanine. The nucleotide sequences of the feruloyl esterase mutant DV2 are shown in SEQ ID NO.5.

[0046] Example 3: Determination and comparison of enzyme activity and protein content of crude enzyme solution The crude enzyme solution reacted with methyl ferulate substrate, and the reaction product ferulic acid was preliminarily identified by high performance liquid chromatography, with a detection wavelength of 320 nm, a flow rate of 0.8 mL / min, and an injection volume of 10 μL. The mobile phase A was 1‰ formic acid water, and the mobile phase B was methanol.

[0047] Enzyme reaction test conditions: Preheat 3 mM methyl ferulate solution at 50°C for 5 min, take 300 μL, mix with 200 μL crude enzyme solution, react at 50°C for 10 min, add 600 μL methanol to terminate, filter through 0.22 μM filter membrane and detect by HPLC. Three parallels per group, an equal amount of buffer solution instead of enzyme solution as blank control. Standard sample was dissolved in 50% methanol at a concentration of 1 mg / mL.

[0048] Enzyme activity unit definition: the amount of enzyme added that hydrolyzes the substrate MFA to produce 1 μmol FA per minute at 50°C.

[0049] Gel run comparison of fermentation broth proteins.

[0050] The results of enzyme activity test are as follows Figure 4 As shown, the results showed that the extracellular enzyme activity of the mutants was increased, among which the extracellular enzyme activity of DV1 was increased by about 2 times.

[0051] Example 4: Purification of recombinant ferulic acid esterase BpFAE-pET22b protein The positive mutant bacteria with higher enzyme activity in the fermentation supernatant were fermented, and the supernatant was taken for protein purification. After the bacterial solution was centrifuged, the supernatant was taken and concentrated 10 times by ultrafiltration tube. The ultrafiltration conditions were: 5000 g, 20 min, and the concentrated enzyme solution was purified by self-assembled nickel column. The operation process is as follows: (1) Add 5 column volumes of Lysis Buffer to the Ni gravity column to equilibrate the filler. Repeat twice.

[0052] (2) Sample loading. Add the enzyme solution to the gravity column, control the dripping rate to ensure full contact between the sample and the medium, collect the effluent and repeat the sample loading to improve the binding efficiency.

[0053] (3) Add 12 column volumes of Wash Buffer to remove weakly bound impurities and collect the wash buffer for detection.

[0054] (4) Add 5 times column volume of Elution Buffer to elute the target protein, collect the solution and analyze it by SDS-PAGE to verify the band and molecular weight.

[0055] (5) Determine the concentration of the purified protein by the BCA method.

[0056] The experimental results are as follows Figure 5 As shown, single protein bands of mutants DV1, DV2 and BpFAE were obtained with the correct size.

[0057] Example 5. Enzyme activity levels of mutant ferulic acid esterase on different substrates Using methyl ferulate and p-nitrophenol esters with different C chain lengths: p-nitrophenylbutyrate (C4), p-nitrophenylhexanoate (C6), p-nitrophenyl octanoate (C8), p-nitrophenyl laurate (C12), p-nitrophenyl palmitate (C16), etc. as substrates, the enzyme activity levels of FAE before and after mutation on different substrates were compared.

[0058] The reaction conditions were the same as above with methyl ferulate as substrate. The results in Table 1 showed that the enzyme specific activities of mutants DV1 and DV2 were increased by 45.98% and 50.96% respectively.

[0059] Table 1 Results of enzyme activity using methyl ferulate as substrate

[0060] With p-nitrophenol esters of different C chain lengths as substrates, ferulic acid esterase can decompose the substrate p-nitrophenol esters to produce 4-NP with a strong absorption peak at a wavelength of 410 nm. Assay conditions: 100 μL of 10 mM substrate DSMO solution, 800 μL of 0.1 M Tris-HCl (pH9) containing 2.5% (v / v) Triton X-100, 100 μL of enzyme solution, react at 50°C for 10 min, terminate the reaction on ice for 5 min, 3 parallels per group, and calculate the enzyme activity.

[0061] The enzyme activity unit is defined as the amount of 1 μmol 4-NP released from 4-NPF in 1 min. The results are shown in Table 2. Among the three substrates C4, C6, and C8, the catalytic specific activity of mutants DV1 and DV2 was significantly improved compared with the wild-type BpFAE, and the improvement level was C8>C6>C4.

[0062] Table 2 The results of enzyme activity using different p-nitrophenol esters as substrates

[0063] Example 6. Catalytic efficiency of mutant ferulic acid esterase 0.02, 0.04, 0.06, 0.08, 0.1, 0.2, 0.4, 0.6, 0.8, 1.0, 2.0, 3.0, 4.0, 5.0 mM methyl ferulate was prepared respectively, and an equal amount of purified feruloyl esterase was added, and the reaction was carried out at an optimum temperature of 50°C and an optimum pH of pH 9 for 10 min. The enzyme activity was measured by high performance liquid chromatography, and the Km and Vmax were calculated by double reciprocal plotting, and the Kcat and Kcat / Km values ​​were calculated. The kinetic parameters of feruloyl esterase are shown in Table 3.

[0064] Table 3 Kinetic parameters of enzymes with methyl ferulate as substrate

[0065] 0.8, 1.0, 2.0, 3.0, 4.0, 5.0, 6.0, 7.0, 8.0, 9.0, 10.0, 11.0, 12.0, 13.0, 14.0 mM p-nitrophenyl butyrate (C4), p-nitrophenyl hexanoate (C6), p-nitrophenyl octanoate (C8) were prepared respectively, and an equal amount of purified ferulic acid esterase and 0.1 M Tris-HCl buffer containing Triton X-100 were added, and the reaction was carried out at the optimal temperature and pH for 10 minutes. After the reaction was terminated, the enzyme activity was determined, and the Km and Vmax were calculated by double reciprocal plotting, and the Kcat and Kcat / Km values ​​were calculated. The kinetic parameters of p-nitrophenol ester are shown in Table 4.

[0066] Table 4 Kinetic parameters of enzymes with different p-nitrophenol esters as substrates

[0067] Vmax represents the maximum value of the enzymatic reaction rate with the increase of substrate concentration under the premise of a certain amount of enzyme; Km ​​represents the affinity between the enzyme and the substrate. The larger the Km, the smaller the affinity of the enzyme for the substrate; Kcat represents the ability of the enzyme to catalyze a specific substrate. The larger the Kcat, the stronger the catalytic ability; Kcat / Km reflects the catalytic efficiency of the enzyme for the substrate. This value reflects both the affinity and catalytic ability of the enzyme for the substrate. The larger the Kcat / Km, the higher the catalytic efficiency. As shown in Table 3, the catalytic efficiency of mutants DV1 and DV2 for methyl ferulate is improved. As shown in Table 4, the catalytic efficiency of mutants DV1 and DV2 for different p-nitrophenol ester substrates is improved.

[0068] The above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit the same. Although the present invention has been described in detail with reference to the aforementioned embodiments, it is still possible for a person skilled in the art to modify the technical solutions described in the aforementioned embodiments, or to replace some of the technical features therein by equivalents. However, these modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions claimed to be protected by the present invention.

Claims

1. A ferulic acid esterase mutant DV1, characterized in that The amino acid sequence is shown in SEQ ID NO.4, which is obtained by changing the 41st amino acid of the amino acid sequence shown in SEQ ID NO.2 from aspartic acid to valine.

2. The gene encoding the ferulic acid esterase mutant DV1 according to claim 1, characterized in that: Its nucleotide sequence is shown in SEQ ID NO.

3.

3. A ferulic acid esterase mutant DV2, characterized in that The amino acid sequence is shown in SEQ ID NO.6, which is obtained by changing the 41st amino acid of the amino acid sequence shown in SEQ ID NO.2 from aspartic acid to valine and the 147th glycine to alanine.

4. The gene encoding the ferulic acid esterase mutant DV2 according to claim 3, characterized in that: Its nucleotide sequence is shown in SEQ ID NO.

5.

5. A recombinant vector or a recombinant strain comprising the feruloyl esterase mutant DV1 according to claim 1 or the feruloyl esterase mutant DV2 according to claim 3. 6 . A starter culture comprising the feruloyl esterase mutant DV1 according to claim 1 or the feruloyl esterase mutant DV2 according to claim 3 .

7. Use of the feruloyl esterase mutant DV1 according to claim 1 or the feruloyl esterase mutant DV2 according to claim 3 in fermenting plant feed.

8. The use according to claim 7, characterized in that: The ferulic acid esterase mutants DV1 and DV2 are used for catalyzing the enzymatic hydrolysis of substrates containing ferulic acid ester bond sites in plant feed.

9. The use according to claim 8, characterized in that: The substrates include methyl ferulate and C4-C16 p-nitrophenol esters.

10. The use according to claim 8, characterized in that: The ferulic acid esterase mutants DV1 and DV2 have improved enzyme specific activities for methyl ferulate and p-nitrophenol ester substrates, and the larger the molecule, the more the specific activity is improved.

Images