LSR gene recombination system for plants

Abstract

The invention discloses a set of LSR gene recombination system for plants, and belongs to the technical field of biology. The recombinant system comprises Kp03 macroserine recombinase and attP and attB corresponding to the Kp03 macroserine recombinase, and efficient gene knock-in editing can be realized in rice and arabidopsis thaliana cells without additional cofactors. The gene editing protein Kp03 can show efficient plasmid level gene knock-in capability in rice and arabidopsis thaliana cells, a 27kb large DNA fragment can be inserted into an attB target site to the maximum extent, and effective gene knock-in editing can still be performed after an attB sequence is truncated to 15bp, so that the application range of gene editing is expanded. In addition, 3.4 kb exogenous DNA fragments can be successfully inserted into the rice genome, a new gene editor is provided for plant large fragment gene knock-in, and the gene knock-in method has important application value.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and in particular relates to a set of LSR gene recombination systems for plants. Background Art

[0002] Targeted integration of large DNA fragments in plant genomes is an urgent technology for synthetic biology and genetic engineering. The ideal genome insertion technology should be a technology that can provide efficient, one-step directional integration of large DNA fragments, with high specificity and programmability, and is independent of DNA double-strand breaks (DSBs) and homologous recombination systems (HR). In recent years, gene editing technology has developed rapidly and has been widely used in various aspects of biological research, gradually replacing traditional breeding methods with limitations and ushering in a new era of plant genetic improvement. Precise gene modification, such as gene knock-in, base substitution and gene replacement, can achieve the purpose of excellent trait gene aggregation and adding tags to target genes, further accelerating the pace of breeding and having important value for improving crop traits. With the rapid development of genome big data engineering, a large number of plant genome sequences are waiting to be interpreted, and gene mining and application are seriously lagging behind. Therefore, the acquisition of precise large-fragment DNA gene knock-in technology is more urgent.

[0003] Researchers have been exploring a genome-specific editing technology that can knock in large fragments of DNA in plants. Currently, gene knock-in mainly relies on the CRISPR-Cas9 system, which uses artificial nucleases to cut at the target site of the biological genome to produce DNA double-strand breaks (DSBs), thereby activating the cell's DSB repair mechanism to achieve the purpose. However, these DSB-based repair methods usually lead to many adverse consequences, such as the insertion and deletion of gene fragments, chromosome breakage, and chromosome translocation. In addition, although the guide editing system and GRAND editing system developed from the CRISPR-Cas9 system reduce the dependence on DSBs, the guide editing system can only insert small fragments no larger than 108bp, and although the GRAND editing system can insert 1kb DNA fragments, its editing efficiency is only 0.002%.

[0004] Although the transposase gene knock-in system developed in recent years can integrate large DNA fragments into the genome of organisms without DSB and does not rely on host recombination, their DNA insertion pattern is semi-random and lacks copy number control. In contrast, another large DNA fragment knock-in system, the site-specific recombinase (SSR) system, is highly specific and does not require cofactors and host endogenous DNA repair mechanisms. SSR is divided into two families, the tyrosine recombinase family and the serine recombinase family. Tyrosine recombinases, such as Cre and FLP, have been widely used in the modification of eukaryotic genomes, but their recombination events are usually reversible. Serine recombinases, especially large serine recombinases (LSRs), are powerful tools for site-specific insertion and exchange of large DNA fragments in plant and animal genomes. However, only a few LSRs have been identified and applied, and their gene knock-in efficiency in plants and animals is low. Therefore, the development of a more efficient and specific plant gene knock-in technology will be of great significance for gene function research and the promotion of synthetic biology. Summary of the invention

[0005] The purpose of the present invention is to provide a novel and efficient large serine recombinase (LSR) gene knock-in system to solve and realize the knock-in editing of large plant fragment genes that cannot be completed by current technology.

[0006] In order to achieve the above object, the present invention adopts the following technical solution: A plant gene editor, comprising Kp03 serine recombinase and its corresponding attP and attB; the amino acid sequence of Kp03 is shown in SEQ ID NO.1.

[0007] A method for plant gene editing, comprising the following steps: (1) Constructing a recombinant expression vector of the Kp03 serine recombinase gene, a recombinant expression vector of exogenous DNA containing attP, and a recombinant expression vector of attB; (2) introducing the three recombinant expression vectors obtained in step (1) into plant cells; (3) Expressing Kp03 large serine recombinase in plant cells causes recombination between attP and attB, thereby achieving knock-in editing of the target gene.

[0008] Furthermore, when the recombinant expression vector in step (1) is a rice gene knock-in editor expression vector, it includes Ubi-P-Kp03-P2A-GFP, Ubi-P-attB and rice-attP-mCherry; the nucleotide sequence of the Kp03 large serine recombinase gene is shown in SEQ ID NO.2; the nucleotide sequence of the attB is shown in SEQ ID NO.7; and the nucleotide sequence of the attP is shown in SEQ ID NO.9.

[0009] Furthermore, when the recombinant expression vector in step (1) is an Arabidopsis gene knock-in editor expression vector, it includes 35S-Kp03-P2A-GFP, 35S-attB and AT-attP-mCherry; the nucleotide sequence of the Kp03 large serine recombinase gene is shown in SEQ ID NO.12; the nucleotide sequence of the attB is shown in SEQ ID NO.7; and the nucleotide sequence of the attP is shown in SEQ ID NO.9.

[0010] Furthermore, the plant cell is a rice protoplast cell or an Arabidopsis protoplast cell.

[0011] Furthermore, in step (2), the mass ratio of the Kp03 serine recombinase gene recombinant expression vector, the exogenous DNA recombinant expression vector containing attP, and the recombinant expression vector of attB is 1:1:1.

[0012] Furthermore, the target gene sequence is as long as 27kb, and the attB sequence is as short as 15bp.

[0013] A method for introducing foreign DNA into a plant genome comprises the steps of co-expressing a recombinant vector of foreign DNA containing attP and a recombinant vector of Kp03 large serine recombinase gene in plant protoplast cells.

[0014] The beneficial effects of the present invention are as follows: the Kp03 protein of the present invention can exhibit efficient plasmid-level gene knock-in ability in plants, and can successfully insert large exogenous DNA fragments into the plant genome, providing a new gene editor for large-fragment gene knock-in in plants. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] Figure 1 Schematic diagram of plasmid recombination mediated by the Kp03 system.

[0016] Figure 2 Fluorescence microscopy images of the three plasmids of the Kp03 system expressed simultaneously (K+P+B) and in pairs (K+P, K+B, P+B) in single cells of rice and Arabidopsis.

[0017] Figure 3 Fluorescence microscopy images of the three plasmids of the Kp03 system being simultaneously expressed in multiple cells of rice and Arabidopsis.

[0018] Figure 4 This is a diagram showing the efficiency of Kp03 system-mediated molecular-level recombination in rice and Arabidopsis.

[0019] Figure 5 The attL binding site and sequencing map generated after Kp03 system-mediated recombination of rice and Arabidopsis.

[0020] Figure 6 Schematic diagram of the method for rapid detection of Kp03-mediated recombination efficiency based on qPCR.

[0021] Figure 7 This is a graph showing the Kp03-mediated recombination efficiency of plasmids containing attP sequences of different lengths in rice and Arabidopsis.

[0022] Figure 8 This is the sequencing map of the attL binding site formed after Kp03-mediated recombination of plasmids with attP sequences of different lengths.

[0023] Fig. 9 It is a sequence diagram of different lengths of attB.

[0024] Fig.10 This is a graph showing the Kp03-mediated recombination efficiency of plasmids containing attB sequences of different lengths in rice and Arabidopsis.

[0025] Fig.11 This is the sequencing map of the attL binding site formed after Kp03-mediated recombination of plasmids with attB sequences of different lengths.

[0026] Fig.12 Schematic diagram of site-specific genomic integration of DNA donors mediated by Kp03 in rice cells; the identified minimal attB sequence was searched in the rice genome using BLAST, a 3.4 kb attP donor was transformed with Kp03, and the attL site sequence obtained after recombination was detected by sequencing. DETAILED DESCRIPTION

[0027] The present invention is further described in detail below in conjunction with specific embodiments, and the examples provided are only for illustrating the present invention, rather than for limiting the scope of the present invention. The examples provided below can be used as a guide for further improvements by those of ordinary skill in the art, and do not constitute a limitation of the present invention in any way.

[0028] Unless otherwise specified, the materials and reagents used in the following examples can be obtained from commercial sources.

[0029] Example 1 High Recombinant Activity of Kp03 in Rice and Arabidopsis Protoplasts 1. Construction of rice gene knock-in editor expression vector The rice Kp03 gene editor contains three vectors: Ubi-P-Kp03-P2A-GFP, Ubi-P-attB and rice-attP-mCherry.

[0030] 1.1 Construction of Ubi-P-Kp03-P2A-GFP rice serine recombinase plasmid The amino acid sequence of Kp03 is shown in SEQ ID NO.1. Based on the amino acid sequence of Kp03 and the codon preference of rice, the Kp03 gene sequence for expression in rice is shown in SEQ ID NO.2. Beijing Qingke Biotechnology Co., Ltd. was commissioned to synthesize the 1572bp nucleotide sequence shown in SEQ ID NO.2, which was cloned into the 4.5kb vector backbone of Ubi-P-GFP (purchased from the addgene website) after digestion with BamHI and HindIII, and named Ubi-P-Kp03-GFP. Then the sequence shown in SEQID NO.3 (2A peptide P2A) was connected to the Kp03 sequence to form the Ubi-P-Kp03-P2A-GFP plasmid ( Figure 1 ).

[0031] The main components of plasmid Ubi-P-Kp03-P2A-GFP are as follows: Ubip promoter (SEQ ID NO.4), Kp03 gene (SEQ ID NO.2) optimized according to rice codons, P2A gene (SEQ ID NO.3), GFP gene (SEQ ID NO.5) and NOS terminator (SEQ ID NO.6).

[0032] 1.2 Construction of Ubi-P-attB recombinant plasmid First, the nucleotide sequence of attB of Kp03 was determined as shown in SEQ ID NO.7, and the corresponding forward and reverse oligonucleotide sequences for vector construction were designed according to the nucleotide sequence. After these oligonucleotide sequences were commissioned to Sangon Biotechnology (Shanghai) Co., Ltd. for artificial synthesis, they were phosphorylated and annealed to form double strands using T4 polynucleotide kinase, and the double-stranded nucleotide chains were cloned into the 4.5kb backbone after BamHI and HindIII digestion of the Ubi-P-Flag (Ubi-P-GFP vector was digested with BamHI and SpeI, the GFP sequence was deleted, and the Flag fragment was integrated into the digestion backbone) vector; then, after transformation, colony PCR, digestion verification and sequencing, the obtained recombinant plasmid was named Ubi-P-attB.

[0033] The main components of plasmid Ubi-P-attB are as follows: Ubip promoter (SEQ ID NO.4), nucleotide sequence of attB (SEQ ID NO.7), 3xFlag tag sequence (SEQ ID NO.8) and NOS terminator (SEQ ID NO.6).

[0034] 1.3 Construction of rice-attP-mCherry donor plasmid First, the nucleotide sequences of attP and mCherry of Kp03 were determined, as shown in SEQ ID NO.9 and SEQ ID NO.10, respectively; then the nucleotide sequence of mCherry was connected to the Kp03 attP nucleotide sequence to form a Kp03attP-mCherry fusion gene, which was commissioned to Beijing Qingke Biotechnology Co., Ltd. for synthesis.

[0035] Using the gene synthesized by the company as a template, the primer pair (PHZ202-F1: GACAAGCCCGTCAGACTGCAGTAACGCTCTTCGAGAAAGC and PHZ202-R1: TCACTTAGCGGCCGCACTAGTTATGCGTAATCGGGCACATCAT) was used to amplify the 909bp fusion gene fragment; Ubi-P-GFP was double-digested with PstI and SpeI to recover the 2.52kb vector backbone fragment that does not contain the Ubip promoter (SEQ ID NO.4) and the GFP gene (SEQ ID NO.5). The Kp03attP-mCherry fusion gene and the vector backbone fragment were infused with the help of the ClonExpress II One Step Cloning Kit (purchased from Nanjing Novogene Biotech Co., Ltd.) to obtain the 3.4kb vector rice-attP-mCherry.

[0036] The main components of the rice-attP-mCherry donor plasmid are as follows: attP (SEQ ID NO.9), mCherry (SEQ ID NO.10), 3xHA tag sequence (SEQ ID NO.11) and NOS terminator (SEQ ID NO.6).

[0037] 2. Construction of Arabidopsis gene knock-in editor expression vector The Arabidopsis Kp03 gene editor contains three vectors: 35S-Kp03-P2A-GFP, 35S-attB and AT-attP-mCherry.

[0038] 2.1 Construction of 35S-Kp03-P2A-GFP Arabidopsis thaliana Serine Recombinase Plasmid According to the amino acid sequence of Kp03 (SEQ ID NO.1) and the preference of Arabidopsis codons, the Kp03 gene sequence that can be used for Arabidopsis expression was determined as shown in SEQ ID NO.12, and Beijing Qingke Biotechnology Co., Ltd. was commissioned to synthesize the 1572bp nucleotide sequence shown in SEQ ID NO.12, which was cloned into the 4.2kb vector backbone of HBT-35S-GFP (purchased from the addgene website) after digestion with BamHI and StuI, and named 35S-Kp03-GFP. Then SEQID NO.3 (2A peptide P2A) was connected to the Kp03 sequence to form the 35S-Kp03-P2A-GFP plasmid.

[0039] The main components of plasmid 35S-Kp03-P2A-GFP are as follows: CMV35S promoter (SEQ ID NO.13), Kp03 gene (SEQ ID NO.12) optimized according to rice codons, P2A gene (SEQ ID NO.3), GFP gene (SEQ ID NO.5) and NOS terminator (SEQ ID NO.6).

[0040] 2.2 Construction of 35S-attB recombinant plasmid The forward and reverse oligonucleotide sequences of Kp03attB (SEQ ID NO.7) artificially synthesized by Sangon Biotechnology (Shanghai) Co., Ltd. were phosphorylated and annealed to form double strands by T4 polynucleotide kinase, and the double-stranded nucleotide chain was cloned into the 4.23kb backbone after BamHI and Stu1 double digestion of the HBT-35S-Flag (modified from HBT-35S-GFP purchased from Addgene, the HBT-35S-GFP vector was digested with stu1 and pst1, and the GFP sequence was replaced with the Flag sequence) vector; then after transformation, colony PCR, enzyme digestion verification and sequencing, the obtained recombinant plasmid was named 35S-attB.

[0041] The main components of plasmid Ubi-P-attB are as follows: CMV35 promoter (SEQ ID NO.13), nucleotide sequence of Kp03 attB (SEQ ID NO.7), 3xFlag tag sequence (SEQ ID NO.8) and NOS terminator (SEQ ID NO.6).

[0042] 2.3 Construction of AT-attP-mCherry donor plasmid The Kp03 attP-mCherry fusion gene synthesized by Beijing Qingke Biotechnology Co., Ltd. was cloned into the 2.92kb HBT-35S-GFP backbone fragment after XhoI and PacI digestion, from which the CMV35S (SEQID NO.13) and GFP (SEQ ID NO.5) sequences had been removed, and finally a 3.8kb AT-attP-mCherry plasmid was obtained.

[0043] The main components of the Arabidopsis expression vector AT-attP-mCherry are as follows: Kp03 attP (SEQ ID NO.9), mCherry (SEQ ID NO.10), 3xHA tag sequence (SEQ ID NO.11) and NOS terminator (SEQ ID NO.6).

[0044] 3. Efficient plasmid recombination in rice and Arabidopsis protoplasts using Kp03 3.1 PEG-mediated Kp03 system transformation of japonica rice cultivar Kitaake and Arabidopsis thaliana Col-0 protoplasts 1) Preparation of rice protoplasts: 180 hulled mature rice seeds were treated with 50% commercial disinfectant for 30 minutes; after washing with sterile water three times, the sterilized seeds were transferred to a sterile culture dish and excess water was absorbed; the seeds were then placed on 1 / 2MS culture medium (2.2 g / L MS powder; 30 g / L sucrose; 6 g / L plant gel; pH 5.7) and cultured in a 30°C light culture room for 8-10 days. Cut the rice stems of 8-10 days old with a single-sided blade, the thinner the better, and transfer the cut rice material to a sterile triangular bottle, add 10ml of enzymatic solution (1.5% cellulase; 0.3% analyte; 0.4M mannitol; 2mM 2-(N-morpholine)ethanesulfonic acid (MES); 0.1% W5 solution); after mixing, wrap the bottle with tin foil, vacuum for 30 minutes, place it on a horizontal shaker (speed 40-60rpm), enzymatic hydrolysis for 6h, and collect protoplasts by filtering with a nylon mesh with a pore size of 35um. After centrifugation of rice protoplasts at room temperature (centrifugal force 200g, time 2 minutes), discard the supernatant to obtain protoplast precipitate; add W5 solution to the precipitate to resuspend the protoplasts, centrifuge the resuspended solution at room temperature again, discard the supernatant, and finally add an appropriate amount of MMG solution (0.4M mannitol; 20mM CaCl 2; Resuspend the rice protoplasts again in 25 mM MES.

[0045] 2) Preparation of Arabidopsis protoplasts: Arabidopsis protoplasts were prepared according to the method disclosed by Yoo et al. (Yoo, SD, Cho, YH, and Sheen, J. (2007). Arabidopsis mesophyll protoplasts: Aversatile cell system for transient gene expression analysis. Nat. Protoc. 2, 1565– 1572.).

[0046] 3) PEG-mediated transformation of rice and Arabidopsis protoplasts Take 10ug of each of the three plasmids of the Kp03 system, then mix the three plasmids, and introduce 30ug of the plasmid mixture into rice or Arabidopsis protoplasts (2×10 4 ). The transformed protoplasts were incubated in 6-well plates containing 1 ml of mannitol (0.5 M), KCl (20 mM), and (4 mM MES) buffer for 48 h (rice) or 24 h (Arabidopsis). After incubation, the protoplasts were harvested by centrifugation for plasmid DNA or genomic DNA extraction, or for observation by scanning laser confocal microscopy (Zeiss LSM900).

[0047] 3.2 Detection of plasmid integration efficiency in rice and Arabidopsis In order to verify whether the attB plasmid can successfully integrate the attP plasmid containing the promoter-free mCherry gene under the catalysis of Kp03 large serine recombinase, thereby generating a recombinant large plasmid expressing mCherry protein ( Figure 1 The efficiency of Kp03-catalyzed recombination can be quantified by the number of cells with mCherry fluorescence. Fluorescence confocal microscopy of protoplasts after 48 hours (rice) or 24 hours (Arabidopsis) incubation revealed that strong mCherry fluorescence could be observed in rice and Arabidopsis cells only when Kp03, attB, and attP plasmids were all co-transformed ( Figure 2-3 The recombination efficiency of Kp03 in rice and Arabidopsis cells was determined by calculating the ratio of red fluorescent cells to green fluorescent cells. Figure 4 As shown, the Kp03 editing system has an extremely high editing efficiency, with an editing efficiency of 99.1% in rice protoplast cells and 94.4% in Arabidopsis protoplast cells.

[0048] To clarify how Kp03 integrates the attP plasmid into the attB plasmid, plasmid DNA was extracted from transformed rice and Arabidopsis protoplasts and PCR amplified using specific primers (UbiP-F1: ATGCAGCAGCTATATGTGGA and mcherry-R1: ttggagccgtacatgaactg; PHZ-F: ACAGCTTGTCTGTAAGCGGA and Nost-R1: CATCGCAAGACCGGCAAC) ( Figure 5 , Table 1, Table 2), the results showed that the expected PCR products were obtained only after co-transformation of all three plasmids, whether in rice cells or Arabidopsis cells. Sequencing of the junction of the amplicon confirmed the presence of attL and attR recombinant products, each of which contained half sites from attP and attB ( Figure 5 ). These results indicate that the three-component Kp03 recombination system can drive site-specific intramolecular recombination in rice and Arabidopsis cells, which means that the activity of the recombinase in plant cells does not require additional cofactors.

[0049] Table 1 Reaction system Table 2 Amplification procedures Example 2 Recombination efficiency of Kp03 in plant cells 1. qPCR-based detection method The present invention establishes a qPCR rapid detection method to detect the efficiency of Kp03-mediated large-fragment gene knock-in, and quantifies the Kp03 recombination efficiency by amplifying the recombinant DNA product using specific F1 (GTCGATGCTCACCCTGTTG) and R1 (TGGCCATGTTATCCTCCTCG) primers. The amplification system and procedure are the same as those in Tables 1 and 2, and the extension time is determined according to the fragment length. The mCherry gene is used as an internal standard and amplified by primers F2 (GTTCATGCGCTTCAAGGTG) and R2 (TTGGAGCCGTACATGAACTG) (the amplification system and procedure are the same as those in Tables 1 and 2, and the extension time is determined according to the fragment length) to quantify the recombination efficiency of donors and acceptors of different lengths ( Figure 6 ).

[0050] 2. Detection of Kp03-mediated recombination efficiency of donor DNA of different sizes It was confirmed that Kp03 can insert approximately 3.4 kb and 3.8 kb DNA donors containing attP into attB plasmids in rice and Arabidopsis cells with extremely high recombination efficiency ( Figure 4), and then explored whether Kp03 can mediate the integration of larger DNA fragments into plant cells. Therefore, this example constructed four different sizes of plasmids containing attP: 5.0 kb, 9.9 kb, 17.4 kb and 27.0 kb for rice protoplast cells, and 6.5 kb, 9.9 kb, 17.4 kb and 27.0 kb for Arabidopsis cells. For this reason, this example developed a qPCR-based method that can quickly and accurately detect the recombination efficiency of attP donor plasmids of different lengths catalyzed by Kp03.

[0051] Specific primers (F1 / R1) were designed to amplify the DNA sequence at the attL junction ( Figure 6 ). The recombination efficiency of 3.4 kb donor DNA in rice and 3.8 kb donor DNA in Arabidopsis were set as the baseline of integration efficiency of 100%, respectively. When the length of donor DNA in rice cells was less than 10 kb, the recombination efficiency only decreased slightly. Compared with 3.4 kb donor DNA, the integration efficiency of 5.0 kb and 9.9 kb DNA donors in rice cells was still high, 80.8% and 80.5%, respectively ( Figure 7 However, for donor DNA larger than 17 kb, the recombination efficiency dropped significantly, with the recombination efficiency of the 17.4 kb attP plasmid dropping to 42.5% and that of the 27 kb attP plasmid dropping further to 8.2% ( Figure 7 A similar trend was observed in Arabidopsis, with recombination efficiencies of 77.9%, 51.4%, 26.5%, and 11.9% for 6.5 kb, 9.9 kb, 17.4 kb, and 27.0 kb donor DNA, respectively ( Figure 7 In addition, sequencing results of the attL binding site confirmed that the donor attP sequence in rice and Arabidopsis had indeed been recombined into the attB plasmid DNA sequence as expected ( Figure 8 ). Taken together, these results indicate that the Kp03 recombination system can efficiently insert large DNA donors up to 27 kb in length into plant cells.

[0052] Example 3 Detection of the Minimum attB Sequence for Kp03-Mediated Recombination The LSR-mediated recombination reaction has unidirectionality and sequence specificity, which makes LSR very suitable for genetic engineering research. However, it is also this sequence specificity that limits the application of LSR targeting plant endogenous genomic DNA insertion. The insertion of large fragment DNA of the targeted genome is generally achieved by a two-step method. First, it is necessary to insert the attachment pad into the host genome through HDR or a guide editing tool. Although the intramolecular integration efficiency mediated by Kp03 is very high, the sequence length of the attB attachment site corresponding to Kp03 is 113bp, and the DNA sequence length of 113bp significantly increases the difficulty of installing the landing pad using methods such as guide editing and HDR. In order to solve this problem, the present embodiment then uses the qPCR method to determine the minimum attB sequence required for the Kp03-mediated recombination reaction, and the efficiency and success of the recombination are verified by sequencing the DNA sequence of the attL junction formed after the recombination.

[0053] In this example, a series of plasmids containing attB of different DNA lengths were designed, with lengths of 26 bp, 21 bp, 15 bp, and 13 bp ( Fig. 9 ). In rice cells, compared with the 113 bp attB sequence set as the 100% integration efficiency baseline, the integration efficiencies of the 26 bp and 21 bp attB sequences were 69.6% and 48.3%, respectively, and the integration efficiency of the 15 bp attB sequence dropped to 2.3%. However, no recombination was detected when the attB sequence length was 13 bp ( Fig.10 ). Similar results were observed in Arabidopsis cells. For attB lengths of 26 bp, 21 bp, 15 bp, and 13 bp, the recombination efficiencies were 53.2%, 34.1%, 2.9%, and 0.0%, respectively ( Fig.10 In addition, the correct occurrence of the recombination event was confirmed by amplifying the specific DNA junction fragment after recombination and sequencing ( Fig.11 ). The above results indicate that the 15 bp attB sequence is the shortest attB sequence required for Kp03-mediated recombination reactions. Existing gene editing tools can easily insert 15-26 bp attB attachment sites into plant genomes, thus increasing the possibility of directly integrating large donor DNA into plant genomes by pre-installing landing pads, providing the application scope and value of Kp03 recombinase.

[0054] Example 4: Insertion of large fragments of rice endogenous genomic DNA using Kp03 Through in vivo plasmid recombination experiments, it was determined that the shortest attB sequence corresponding to the Kp03 recombinase is 15 bp ( Fig.11), and then used BLAST to find a genomic site in the rice genome that matched the 15 bp sequence and had 100% identity. The site is located on chromosome 2, position 5,539,656-5,539,670 ( Fig.12 To investigate the ability of Kp03 to directly edit the rice genome, we examined whether it could catalyze the integration of a donor DNA containing 3.4 kb attP into this specific genomic site. Kp03 and a plasmid containing attP were co-expressed in rice protoplasts for 48 h, and then the junction of the rice genome and the attP integration site was detected by PCR using specific primers (F3: GCTGTCAAAGTCTCAATGCT; R3: CACCAATGCAATAGCTACACTC) ( Fig.12 ). The sequencing results further confirmed that Kp03 can indeed directly integrate exogenous DNA into the endogenous genome of rice in a one-step method ( Fig.12 ).

[0055] In summary, the Kp03 system has very efficient recombination capabilities, and its large-fragment integration capability and simplicity of operation make it a valuable tool for advancing plant synthetic biology and agricultural biotechnology.

[0056] The above description is only a preferred embodiment of the present invention. All equivalent changes and modifications made according to the scope of the patent application of the present invention should fall within the scope of the present invention.

Claims

1. A plant gene editor, characterized in that: The gene editor includes Kp03 serine recombinase and its corresponding attP and attB; the amino acid sequence of Kp03 is shown in SEQ ID NO.

1.

2. A method for plant gene editing, characterized in that: The following steps are involved: (1) Constructing a recombinant expression vector of the Kp03 serine recombinase gene, a recombinant expression vector of exogenous DNA containing attP, and a recombinant expression vector of attB; (2) introducing the three recombinant expression vectors obtained in step (1) into plant cells; (3) Expressing Kp03 large serine recombinase in plant cells causes recombination between attP and attB, thereby achieving knock-in editing of the target gene.

3. The method according to claim 2, characterized in that: When the recombinant expression vector in step (1) is a rice gene knock-in editor expression vector, it includes Ubi-P-Kp03-P2A-GFP, Ubi-P-attB and rice-attP-mCherry; the nucleotide sequence of the Kp03 large serine recombinase gene is shown in SEQ ID NO.2; the nucleotide sequence of the attB is shown in SEQ ID NO.7; and the nucleotide sequence of the attP is shown in SEQ ID NO.

9.

4. The method according to claim 2, characterized in that: When the recombinant expression vector in step (1) is an Arabidopsis gene knock-in editor expression vector, it includes 35S-Kp03-P2A-GFP, 35S-attB and AT-attP-mCherry; the nucleotide sequence of the Kp03 large serine recombinase gene is shown in SEQ ID NO.12; the nucleotide sequence of the attB is shown in SEQ ID NO.7; and the nucleotide sequence of the attP is shown in SEQ ID NO.

9.

5. The method according to claim 2, characterized in that: The plant cells are rice protoplast cells or Arabidopsis protoplast cells.

6. The method according to claim 2, characterized in that: In step (2), the mass ratio of the Kp03 serine recombinase gene recombinant expression vector, the exogenous DNA recombinant expression vector containing attP and the recombinant expression vector of attB is 1:1:

1.

7. The method according to claim 2, characterized in that: The sequence of the exogenous DNA is up to 27 kb, and the shortest sequence of attB is 15 bp.

8. A method for incorporating foreign DNA into a plant genome, characterized in that: The recombinant vector containing exogenous DNA of attP and the recombinant vector of Kp03 big serine recombinase gene are co-expressed in plant protoplast cells.

Images