Non-coding sRNA of targeted mycobacterium tuberculosis pks2 and application of non-coding sRNA in preparation of anti-tuberculosis drugs

Abstract

The invention relates to a non-coding sRNA (Ribonucleic Acid) of a target mycobacterium tuberculosis pks2, the non-coding sRNA is named as ASpks2, and the base sequence of the ASpks2 is as shown in SEQ ID NO. 1. In a cell experiment of the invention, non-coding RNA expressed by ASpks2 is cloned into an H37Rv strain, the ASpks2 can be over-expressed in the strain, and the mRNA level and the protein level of a complementary target gene pks2 in the strain are remarkably reduced, so that the ASpks2 is proved to be capable of inhibiting expression of the pks2 in a targeted manner. By adopting negative control, an ASpks2 overexpression strain and an ASpks2 knock-down strain infect a human macrophage THP-1 cell strain, the result shows that the number of living cells of human macrophages infected by the ASpks2 overexpression strain is obviously higher than that of a control group or a knock-down group, which indicates that the ASpks2 can reduce the cytotoxicity of mycobacterium tuberculosis. Therefore, the ASpks2 is expected to be developed into an anti-tuberculosis drug.

Description

Technical Field

[0001] The present invention relates to the technical field of research and development of tuberculosis-related target drugs, and more specifically to a non-coding sRNA targeting Mycobacterium tuberculosis pks2 and an application thereof in the preparation of an anti-tuberculosis drug. Background Art

[0002] Mycobacteria are a class of Gram-positive bacteria that include a variety of pathogens that can cause disease in humans and animals. Among them, Mycobacterium tuberculosis (Mtb) is the main cause of tuberculosis. In M. tuberculosis, there is a complex gene cluster that encodes a series of polyketide synthases and related proteins that work together to synthesize specific lipid molecules. The pks2 gene cluster, also known as Rv3825c, encodes a polyketide synthase in Mtb that is involved in the biosynthesis of specific lipid molecules, especially sulfolipid-1 (SL-1) and phenolic glycolipids (PGLs). SL-1 and PGLs are important lipid molecules that play a key role in the virulence of M. tuberculosis, host-pathogen interactions, and bacterial survival in the host. Garcia-Heredia et al., 2016 studied the effect of pks2 gene knockout on the mouse model of Mycobacterium tuberculosis infection and confirmed the importance of pks2 for bacterial virulence. Therefore, Rv3825c / pks2 is considered a potential anti-tuberculosis drug target. H37Rv and H37Ra are two important laboratory strains of Mycobacterium tuberculosis. H37Rv is a highly virulent strain that can cause typical tuberculosis symptoms in animal models. In contrast, H37Ra is a low-virulence or non-virulent strain. It cannot effectively infect hosts with normal immune systems and usually does not cause disease, so it is considered to be an attenuated strain.

[0003] Small RNAs (sRNAs) are a class of non-coding RNA molecules that are usually 50-500 nucleotides in length and play a key role in gene expression regulation and host-pathogen interactions in Mycobacterium tuberculosis. They interact with target mRNAs through base pairing, thereby regulating translation efficiency and mRNA stability.

[0004] However, there are currently no reports on the differences in sRNA expression and their target genes between H37Rv and H37Ra strains, nor have we obtained an effective sRNA against the virulence of the H37Rv strain and its development and application in anti-tuberculosis treatment. Summary of the invention

[0005] 1. Technical issues to be resolved

[0006] In view of the above-mentioned shortcomings and deficiencies of the prior art, the present invention provides a non-coding sRNA targeting Mycobacterium tuberculosis pks2. Cloning the non-coding sRNA into the H37Rv strain can reduce the mRNA level and protein level of the target gene pks2 and achieve the effect of reducing the virulence of the H37Rv strain; therefore, the non-coding sRNA can be used to prepare anti-tuberculosis drugs.

[0007] (II) Technical solution

[0008] In a first aspect, the present invention relates to a non-coding sRNA targeting Mycobacterium tuberculosis pks2, named ASpks2, and its base sequence is shown in SEQ ID NO.1.

[0009] In a second aspect, the present invention also relates to the use of a non-coding sRNA according to the base sequence shown in SEQ ID NO.1 in the preparation of an anti-tuberculosis drug; or,

[0010] According to the use of the non-coding sRNA with the base sequence shown in SEQ ID NO.1 in the preparation of a toxicity inhibitor of Mycobacterium tuberculosis, for example, in a research experiment on the toxicity of Mycobacterium tuberculosis, the non-coding sRNA can be used to reduce the toxicity of Mycobacterium tuberculosis.

[0011] (III) Beneficial effects

[0012] In the cell experiment of the present invention, the non-coding RNA represented by ASpks2 is cloned into the H37Rv strain, ASpks2 can be overexpressed in the strain, and the mRNA level and protein level of the complementary target gene pks2 in the strain are significantly reduced, which shows that ASpks2 can target and inhibit the expression of pks2. Further, negative control, OE-ASpks2 (ASpks2 overexpression) strain and KD-ASpks2 (ASpks2 knockdown) strain were used to infect human macrophage THP-1 cell line. The results showed that the number of viable cells of human macrophages infected with OE-ASpks2 strain was significantly higher than that of control strain or KD-ASpks2 strain group, which shows that ASpks2 can reduce the cytotoxicity of Mycobacterium tuberculosis. Therefore, ASpks2 is expected to be developed into an anti-tuberculosis drug. BRIEF DESCRIPTION OF THE DRAWINGS

[0013] Figure 1 Schematic diagram of the process of using 3'RACE to verify a coding RNA (named ASpks2) in Mycobacterium tuberculosis.

[0014] Figure 2The expression levels of pks2 and ASpks2, two endogenous non-coding small RNAs found in Mycobacterium tuberculosis, are compared between H37Rv and H37Ra.

[0015] Figure 3 Comparison of the relative transcription levels of ASpks2 and pks2 in the negative control strain (NC), ASpks2 overexpression strain (OE-ASpks2 strain) and ASpks2 underexpression strain (KD-ASpks2 strain); Figures A and B are qRT-PCR analysis of ASpks2 and pks2 in the negative control strain (NC), overexpression strain (OE-ASpks2) and underexpression strain (KD-ASpks2); Figure C is Northern blot analysis of ASpks2 transcripts in the negative control strain (NC), underexpression strain (KD-ASpks2) and overexpression strain (OE-ASpks2); Figure D is Western blot detection of pks2, PapA1A and GroEL2 in two strains (NC and KD-ASpks2); *p<0.05.

[0016] Figure 4 The figure is a comparison of the growth of the negative control strain (NC), the overexpression strain (OE-ASpks2) and the low expression strain (KD-ASpks2) before infecting human macrophage THP-1 cells in vitro, the number of live cells after infecting human macrophage THP-1 cells, the number of colonies, the relative transcription levels of ASpks2 and the target gene pks2 in Mycobacterium tuberculosis, etc.; Figure A is the growth of the three strains in non-rolling 7H9 liquid culture medium; Figure B is the growth curve of the three strains in non-rolling 7H9 liquid culture medium; Figure C is the growth curve of the three strains The number of macrophages 4h (day 0), 4 days and 7 days after infection of human macrophages; D is the number of intracellular viable bacteria measured 4h (day 0), 4 days and 7 days after infection of human macrophages by the three strains; E is the transcription level of ASpks2 of intracellular viable bacteria measured 4h (day 0), 4 days and 7 days after infection of human macrophages by the three strains; F is the transcription level of pks2 of intracellular viable bacteria measured 4h (day 0), 4 days and 7 days after infection of human macrophages by the three strains (qRT-PCR analysis); *p<0.05.

[0017] Figure 5 Schematic diagram of the mechanism by which ASpks2 reduces the toxicity of Mycobacterium tuberculosis. DETAILED DESCRIPTION

[0018] In order to better explain the present invention and facilitate understanding, the present invention is described in detail below through specific implementation modes in conjunction with the accompanying drawings.

[0019] Example 1

[0020] Strains H37Rv and H37Ra were cultured in 7H9 medium. Culture conditions: Mycobacterium tuberculosis H37Rv and H37Ra were cultured in Middlebrook 7H9 medium supplemented with 10% (v / v) OADC, 0.5% glycerol and 0.05% Tween 80. The cultures were grown under static conditions at 37°C until the logarithmic phase (OD600 = 0.7-0.8), at which time the cells were harvested for downstream RNA. The GSE3999 dataset was analyzed using GEO2R, ​​and 41 genes were detected to show consistent differential expression patterns in 7H9 medium, of which two genes, Rv3825c (pks2) and Rv2289 (cdh), showed significant differential expression in both transcriptome sequencing and PRM experiments. Specific single-stranded DNA probes were designed to complement the sRNAs corresponding to these two proteins, and the 5' ends of these single-stranded DNAs were labeled with the radioactive isotope γ-32P. Using Northern blot technology, we finally verified the existence of a new ncRNA, Seesd6886, in the H37Rv strain. Given its relative relationship with pks2 in gene location, we named it ASpks2, the antisense transcript of pks2. As described in the experimental procedure, 3'RACE analysis was performed by connecting the adapter to the 3'hydroxyl group of H37Rv total RNA. ASpks2 was successfully verified by 3'RACE ( Figure 1 ).

[0021] The RNA extracted from Mycobacterium tuberculosis H37Rv and H37Ra was further used to verify the transcriptional expression level of ASpks2 in H37Rv and H37Ra strains using qPCR and Northern blot techniques. Figure 2 As shown in A and B, the transcript expression of ASpks2 in H37Rv was significantly lower than that in H37Ra. At the same time, the mRNA and protein levels of pks2 in H37Rv were significantly higher than those in H37Ra (see Figure 2 C and D). In the H37Rv strain, pks2 was upregulated at both the transcriptional and protein levels, while in the H37Ra strain, ASpks2 was upregulated at both the transcriptional and protein levels. Therefore, it is inferred that there may be a negative correlation between ASpks2 and pks2, and the significant increase in the mRNA and protein levels of pks2 may be due to the reduced expression of ASpks2 in H37Rv, which makes it unable to effectively inhibit the transcription or translation process of the pks2 gene.

[0022] Example 2

[0023] This embodiment designs an experiment to further verify whether ASpks2 can specifically target and negatively regulate pks2. During the experiment, ASpks2 was cloned into the H37Rv strain using the pMV261 plasmid vector to construct an ASpks2 overexpression strain, recorded as the OE-ASpks2 strain; then, the complementary fragment (about 85bp) of the endogenous ASpks2 of the H37Rv strain was cloned into the H37Rv strain using the pMV261 plasmid vector to construct an ASpks2 knockout strain, recorded as the KD-ASpks2 strain. The negative control strain is the H37Rv strain and is not treated, recorded as the NC strain. The specific experimental method is as follows:

[0024] (1) ASpks2 was cloned into the pMV261 plasmid vector (RrnB promoter replaced Hsp60 promoter, and VrrA terminator was added), and then the plasmid vector was used to transform into the H37Rv strain to obtain the ASpks2 overexpression strain OE-ASpks2.

[0025] ASpks2 is a non-coding sRNA, and its base sequence is as follows (SEQ ID NO.1):

[0026] CTGCGACCACAGCCGCGGCCGACTCACCCATTGAGTGGCCGATCACGGCGCCCGGGCGCACTCCGTATGCCGCCATCGTGGCTGCCAACGCGACCTGCATCGCGAAGATGGTCGGCTGAACTCTGTCGATGCCAGT CACGGTCTCGGGCGCCGTCATCGCCTCGGTGACCGAGAACCCGGACTCCGCGGCGATCAATGGCTCTAGCTCCGCAACGGTCGCGGCGAACACCGATTCGTTCGTCAGCAGATCGGCGCCCATCGCTGCCCACTG.

[0027] (2) The complementary fragment (about 95 bp) of the endogenous ASpks2 of the H37Rv strain was cloned into the pMV261 plasmid vector (RrnB promoter replaced Hsp60 promoter, and VrrA terminator was added), and then the plasmid vector was used to transform into the H37Rv strain to knock down the endogenous ASpks2 of H37Rv, thereby constructing the ASpks2 knockout strain KD-ASpks2.

[0028] The base sequence of the complementary fragment of endogenous ASpks2 of the H37Rv strain is as follows:

[0029] CCCAAGCTTACCGTGACTGGCATCGACAGAGTTCAGCCGACCA TCTTCGCGATGCAGGTCGCGTTGGCAGCCACGATGGCGGCATATGG AATTCC (SEQ ID NO. 2).

[0030] (3) The NC strain, OE-ASpks2 strain, and KD-ASpks2 strain were cultured in 7H9 medium. The culture conditions were as follows: cultured in Middlebrook 7H9 medium supplemented with 10% (v / v) OADC, 0.5% glycerol, and 0.05% Tween 80. The cultures were grown at 37°C under static conditions until the logarithmic phase (OD600 = 0.7-0.8), at which time the cells were harvested for downstream RNA and protein extraction. After the culture, RNA of the three strains was extracted and subjected to qRT-PCR analysis, Northern blot hybridization analysis, and Western blot detection.

[0031] The RNA extraction and qRT-PCR analysis methods included: resuspension and lysis by bead beating, centrifugation of the resulting slurry, extraction of the supernatant with chloroform twice, precipitation with isopropanol, and washing with 80% ethanol. The extracted RNA was treated with 10U DNase I (Fermentas) at 37°C for 30min to prevent genomic DNA contamination and further purified. The extracted total RNA was reverse transcribed using the Superscript III first-strand synthesis kit (Invitrogen). Real-time fluorescence quantitative PCR detection was performed using the CFX96 real-time PCR detection system (Bio-Rad). All real-time PCR detections were performed under the conditions of a total reaction volume of 20μL, a total reaction volume of 10μL SYBR Green Master Mix (Thermo scientific) and 10μM primers. The cycling conditions were 94°C for 4min, followed by 40 cycles of amplification (94°C for 15s, 60°C for 15s, and 72°C for 15s). The average transcript level was calculated based on the values ​​obtained from technical replicates of at least three independent biological replicates.

[0032] The method of Northern blot hybridization analysis includes: 10 μg of total RNA of Mycobacterium tuberculosis H37Rv and low-range ssRNA ladder (New England Biolabs) are denatured and separated on 8% polyacrylamide gel containing 8M urea. The separated RNA is electroblotted onto Hybond-N+ membrane (Amersham) and then cross-linked under short ultraviolet (UV) light. DNA oligonucleotide probes specific for each candidate sRNAs are radiolabeled with [γ-32P]ATP. Hybridization signals are exposed on a phosphor screen or determined by autoradiography on superfilm (Amersham).

[0033] Western blot detection: H37Rv total protein was separated by 10% or 15% SDS-PAGE and then transferred to polyvinylidene fluoride (PVDF) membrane (GE Healthcare). The target protein was detected with the corresponding polyclonal antibody at a dilution of 1:1000.

[0034] (4) Experimental results

[0035] like Figure 3 As shown, compared with the negative control strain (NC), qPCR and Northern blot results showed that in the OE-ASpks2 strain, ASpks2 was overexpressed; in the KD-ASpks2 strain, ASpks2 was knocked down, while pks2 was overexpressed ( Figure 3 A and B), the mRNA and protein levels of the complementary target gene pks2 were significantly reduced in the OE-ASpks2 strain, while in the KD-ASpks2 strain, the mRNA and protein levels of pks2 were significantly increased ( Figure 3 C). The experiment also tested whether ASpks2 affects the level of PapA1 protein downstream of pks2. The results showed that PapA1 did not change in the OE-ASpks2 strain and the KD-ASpks2 strain ( Figure 3 D). This indicates that the non-coding small RNA expressed by ASpks2 can specifically target pks2 to inhibit the transcription level of pks2 and reduce the protein level of pks2 in the strain.

[0036] Example 3

[0037] This example further studies the differences between the three strains NC, OE-ASpks2, and KD-ASpks2. The research items and results are as follows:

[0038] (1) Three strains, NC, OE-ASpks2, and KD-ASpks2, were cultured in parallel in non-rolling 7H9 medium. The culture conditions were as follows: culture in Middlebrook 7H9 medium supplemented with 10% (v / v) OADC, 0.5% glycerol, and 0.05% Tween 80. For strains requiring plasmid maintenance, 20 μg / mL kanamycin was added. The cultures were grown at 37°C under static conditions. The results are shown in Figure 4 As shown in A and B, the OE-ASpks2 strain cultured in the non-rolling 7H9 liquid medium precipitated at the bottom of the flask and the liquid was clear, while the NC strain and the KD-ASpks2 strain were evenly dispersed in the medium. Under the same culture conditions, there was no significant difference in the growth curves of the three strains.

[0039] (2) The negative control NC, OE-ASpks2, and KD-ASpks2 strains were used to infect human macrophage THP-1 cell lines (MOI: 10:1). 7 THP-1 cells were seeded and infected at an MOI of 10. The survival rate of THP-1 cells was determined by trypan blue staining on days 4 and 7 after infection. The results showed that the number of viable cells of the OE-ASpks2 strain was significantly higher than that of the control strain or the KD-ASpks2 strain (e.g. Figure 4 (as shown in C).

[0040] The intracellular Mycobacterium tuberculosis of the surviving THP-1 cells was serially diluted on 7H10 agar for CFU counting to observe its intracellular growth. The number of bacteria in the adherent living cells was evaluated by colony forming unit (CFU) counting, and it was found that the number of colonies of the OE-ASpks2 strain increased significantly (e.g. Figure 4 D). This confirmed that ASpks2 can indeed reduce the toxicity of Mycobacterium tuberculosis to human macrophages and reduce cell necrosis, while the negative control and KD-ASpks2 strains significantly promote cell death, which occurs when bacteria are released from the lysate at the late stage of infection.

[0041] (3) 4 hours, 4 days, and 7 days after infection of human macrophage THP-1 cells, 50 mL of GTC lysis buffer was added and gently shaken to ensure that all macrophages were lysed. The bacterial pellets were collected by centrifugation and extracted and purified according to the above RNA extraction method. The expression of ASpks2 and target gene pks2 in Mycobacterium tuberculosis in cells infected with different bacteria was detected by RT-qPCR. The results showed that during the infection of cells with OE-ASpks2 strain, ASpks2 was overexpressed, while the target gene pks2 was downregulated (such as Figure 4This indicates that in the H37Rv strain, Aspks2 still targets pks2 during the infection process to improve the survival of Mycobacterium tuberculosis in cells. This means that Aspks2 reduces the damage of Mycobacterium tuberculosis to host cells by targeting pks2, thereby improving the survival rate of Mycobacterium tuberculosis in cells.

[0042] like Figure 5 The figure shows the mechanism by which ASpks2 reduces the toxicity of Mycobacterium tuberculosis. pks2 is a key enzyme for the synthesis of SL1278 (lipid) from SL659 (lipid), and SL1278 (lipid) can be used to synthesize SL-1, a component of the cell wall of Mycobacterium tuberculosis. Aspks2 can complement pks2 in Mycobacterium tuberculosis to inhibit the function of pks2. When Aspks2 is upregulated in the cell, pks2 is inhibited and the synthesis of SL-1 is reduced, leading to changes in the composition of the cell wall of Mycobacterium tuberculosis, which helps Mycobacterium tuberculosis to achieve a relatively stable relationship with macrophages and reduce the death of macrophages.

[0043] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or replace some or all of the technical features therein with equivalents. However, these modifications or replacements do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.

Claims

1. A non-coding sRNA targeting Mycobacterium tuberculosis pks2, which is named ASpks2. The base sequence of ASpks2 is shown in SEQ ID NO.

1.

2. Use of the non-coding sRNA with the base sequence shown in SEQ ID NO.1 in the preparation of anti-tuberculosis drugs.

3. Use of the non-coding sRNA according to the base sequence shown in SEQ ID NO.1 in the preparation of a toxicity inhibitor of Mycobacterium tuberculosis.

Images