Construction and application method of plant genetic transformation system with removable fluorescence labeled gene

Abstract

The invention discloses a construction and application method of an improved plant genetic transformation system. The system is composed of a primary vector with fluorescent protein as a marker gene and a secondary vector capable of removing the marker. As loxP elements are arranged on the two sides of the fluorescence labeling gene of the primary vector, the secondary vector containing the Cre recombinase gene can be removed from a transformed plant genome by transforming the secondary vector, so that an unlabeled transformant is obtained. The secondary vector is arranged on the two sides of the loxP element, so that the Cre gene in the secondary vector can also be removed. The vector mainly takes fluorescent protein as a marker gene, and non-invasive identification and selection can be carried out on instantly or stably transformed plant tissues or plants through agrobacterium tumefaciens-mediated transformation. Besides, the novel plant transformation system can be widely applied, for example, multi-gene transformation is carried out through double transfection, and the gene is temporarily expressed by inserting a target gene expression box into loxP constructs of two vectors.

Description

Technical Field

[0001] The invention belongs to the field of plant genetic engineering, and in particular relates to the construction and use of a plant expression vector with a removable fluorescent marker gene. Background Art

[0002] Plant transformation is a scientific method whereby DNA from any organism is stably inserted into the genome of the species of interest. It has become an indispensable research tool for characterization and functional analysis of specific genes. It is also a practical tool for improving existing varieties of food and fiber crops. Agrobacterium-mediated transformation remains a successful and preferred method for plant genetic modification. This is due to its high transformation efficiency, stable integration of T-DNA into chromosomes, minimal transgene recombination, and transfer of relatively large DNA fragments in small copy numbers. In general, Agrobacterium-mediated transformation relies on plant tissue culture due to its high transformation efficiency. However, Agrobacterium-mediated gene delivery via tissue culture route is a complex method that requires sterile conditions, appropriate medium composition, callus preparation from explants, Agrobacterium transformation DNA, selection of transformed callus, and regeneration of intact plants. This method is time-consuming and labor-intensive, and often regeneration from transformed callus is a major bottleneck. In addition, regenerated plants may exhibit somaclonal variation, morphological abnormalities, genetic instability, and reduced fertility.

[0003] In recent years, Agrobacterium-mediated plant transformation has been widely used in many plant species, especially plants that are difficult to tissue culture. In planta transformation is a method to directly transfect Agrobacterium into plant embryonic tissue or meristem with high division and differentiation ability to obtain contemporary transgenic plants. This method provides a potential alternative method by avoiding tissue culture and regeneration steps. Although in planta transformation is simple to operate and can shorten the breeding cycle, it has a series of defects such as low transformation rate and chimera occurrence. Therefore, in order to eliminate false positive transformants, GUS assay and PCR are usually used to detect target DNA. Agrobacterium-mediated transient transformation is also used for subcellular localization determination and functional analysis of specific genes. In this method, the target gene can be transiently overexpressed in plant leaf tissue by infiltration of Agrobacterium. However, since the expression efficiency of the target gene each time varies depending on the growth state of the infiltrated leaves and the skills of the experimenter, the reproducibility of this method is low. The use of appropriate marker genes is one of the ways to improve the efficiency and reproducibility of Agrobacterium-mediated in planta transformation and transient transformation. In the tissue culture-dependent transformation process, a selectable marker gene is co-transformed with the gene of interest. Selectable marker genes confer a growth advantage over non-transformed cells in culture in the presence of the corresponding selective agent, resulting in the regeneration of transgenic shoots. Approximately 50 selectable marker genes, including many that confer antibiotic resistance or herbicide tolerance, have been used in transgenic plant production. Antibiotic selectable marker genes are not suitable for commercial seed products due to public perception or regulatory concerns about food safety, while some herbicide selectable marker genes may be redundant in trait stacking. In addition, these selectable marker genes are less efficient in in planta transformation and transient transformation because they require invasive assays to verify transformants. Reporter genes can also be used as markers for selection of plant transformants, such as β-glucuronidase (GUS), luciferase (LUC), and fluorescent proteins. Technically, the presence of glucuronide in GUS and luciferin in LUC can be visualized by the naked eye or light microscopy, respectively, which requires specific substrates. Recently, a new reporter gene, RUBY, has been developed that does not require the use of special equipment or foundations. RUBY, which produces the red pigment β-glucuronidase, is directly visible to the naked eye. However, red pigments in leaves or other tissues are irreversible once produced, which may inevitably interfere with biological processes such as photosynthesis. In contrast, fluorescent proteins including GFP, DsRed, eYGFPuv, etc. do not require specific substrates, but only an optical system consisting of excitation light and filters, which can monitor morphs in a non-invasive manner even under field conditions.

[0004] Although there are no reported data on the negative effects of fluorescent proteins on plants or humans, it is best to discard unnecessary co-transformed genes after obtaining transformants with the gene of interest. The Cre / loxP recombination system has been widely reported to remove marker genes in many species. In the Cre / loxP recombinase system, Cre recombinase catalyzes crossover between directly repeated lox (crossover site) recognition sites. In order to excise a marker gene, lox sites are designed on the sides of the marker gene and any other accessory genes, and after successful Cre-mediated excision, the gene of interest and a lox site will remain. Cre / loxP-mediated marker gene excision can be obtained either by sexual hybridization with a cell line expressing the Cre gene or by self-excision method in which the Cre gene is introduced and removed together with the marker gene. The expression of Cre recombinase can be regulated by heat-, cold-, drought- or chemical-induced promoters or developmentally regulated promoters. The advantage of self-excision is that marker-free transformants can be obtained by a single transfection, but it is not suitable for transformation in plants because the basal level activity of the inducible promoter may cause the marker gene to be lost early before selection, thereby reducing the selection efficiency of the transformants. Therefore, in plant transformation, the marker gene and the Cre gene must be introduced by two transfections. The use of fluorescent protein as a marker gene is also conducive to the secondary transformation of the Cre gene, because the lack of fluorescence can be used as a selection indicator for secondary transformants without the use of other marker genes. Summary of the invention

[0005] The object of the present invention is to develop a plant expression vector with a mobile marker gene for Agrobacterium-mediated in-plant transformation. In in-plant transformation, a non-invasive method should be used to improve the selection efficiency of transformants. For this reason, it is appropriate to use fluorescent protein as a marker gene because it has a simple genetic structure and can be optically observed. In addition, in order to ensure the safety of transgenic plants, it is necessary to obtain unmarked transformants. In order to solve the above problems, the present invention constructs a plant transformation system, which consists of a primary vector with a fluorescent protein as a marker gene and a secondary vector capable of discarding the marker gene introduced into the transformant.

[0006] In order to solve the above technical problems, the technical solution adopted by the present invention is: a method for constructing an improved red fluorescent protein expression vector

[0007] The specific steps of the above method are as follows:

[0008] "Primary vector" refers to the Agrobacterium-mediated transformation vector, which first introduces the gene of interest together with the marker gene into the target plant.

[0009] The marker gene of the main vector is a gene encoding a fluorescent protein.

[0010] Fluorescent protein is a protein that emits fluorescence under external excitation light. Fluorescent proteins include green fluorescent protein (GFP), red fluorescent protein (DsRed) and enhanced yellow fluorescent protein-like protein (eYGFPuv), but are not limited to these. Among them, eYGFPuv is most suitable as a fluorescent marker gene because the gap between its maximum excitation wavelength and maximum emission wavelength is the widest.

[0011] The fluorescent marker gene expression box of the primary vector contains a strong promoter that can drive the expression of fluorescent protein at a high level, such as CaMV 35S promoter, Ubiquitin promoter, etc.

[0012] A "gene expression cassette" refers to a functional unit of a vector that incorporates at least a promoter, a protein coding sequence, and a terminator so as to express the gene when introduced into a target plant.

[0013] In addition, as the promoter of the fluorescent marker gene expression cassette, other strong promoters suitable for the target plant can also be used.

[0014] As the terminator of the fluorescent marker gene expression cassette, CaMV 35S poly (a) signal or Nos terminator can be used, but it is not limited thereto. Depending on the target plant, other terminators that can enhance the expression of fluorescent proteins can be used.

[0015] The marker gene expression cassette may also include an enhancer that can increase the expression of the fluorescent protein.

[0016] The above fluorescent marker gene expression cassette was inserted into the loxP construct of the primary vector.

[0017] The expression "loxP structure" refers to a DNA fragment consisting of two loxP elements. The DNA sequence of the so-called loxP element is as follows.

[0018] loxP sequence: 5'-ATAACTTCGTATAGCATACATTATACGAAGTTAT-3'

[0019] The basic sequence of the loxP construct of the main vector is the same as that of gene number 1.

[0020] In the loxP construction of the primary vector, in addition to the fluorescent marker gene expression cassette, there are additional restriction endonuclease recognition sites for the insertion of other temporary gene expression cassettes.

[0021] "Temporary genes" refer to genes that only need to be expressed for a period of time after transformation and do not need to be stably expressed after transformation verification, such as CRISPR / Cas9 and antibiotic resistance genes.

[0022] The loxP construct mentioned above is inserted into the T-DNA fragment of the master vector.

[0023] "T-DNA" refers to the DNA segment of the Agrobacterium-mediated vector that will be inserted into the genome of the transformant.

[0024] The T-DNA portion outside the loxP structure also has additional restriction endonuclease recognition sites, into which the gene expression cassette of interest can be inserted.

[0025] In addition, the T-DNA portion outside the loxP structure of the main vector contains a HygR hygromycin-resistant gene expression cassette containing the CaMV 35S promoter and the CaMV 35S poly (A) signal, whose CDS can be replaced by the target gene CDS between the SmaI and PspXI restriction endonuclease sites.

[0026] The plasmid backbone of the master vector can be based on almost any Agrobacterium-mediated plant transformation vector.

[0027] The expression vector "plasmid backbone" refers to the part of the Agrobacterium-mediated plant transformation plasmid minus the T-DNA portion, which contains the genetic elements required for plasmid replication, maintenance and transfection.

[0028] In addition, the plasmid backbone of the master vector is based on the GV1300 plasmid backbone.

[0029] The present invention includes the construction of a secondary vector that is capable of discarding the loxP construct from the first transformant by the primary vector.

[0030] "Secondary vector" refers to an Agrobacterium-mediated plant transformation vector with an auto-excised Cre recombinase gene expression cassette.

[0031] The Cre recombinase gene of the secondary vector contains an intron inserted into the CDS, which prevents the expression of the recombinase in bacterial cells such as Escherichia coli or Agrobacterium by forming a pseudo ORF.

[0032] The intron inserted into the CDS of the Cre gene can be any intron from a plant source, and preferably has a shorter sequence length.

[0033] The intron inserted into the CDS of the Cre gene of the secondary vector is the third intron (89 bp) of the AaTPPA gene of Actinidia arguta, and its sequence is the same as that of gene number 2.

[0034] The intron sequence can be inserted at any position in the CDS of the Cre gene.

[0035] The constitutive CaMV 35S promoter, as well as stress or chemical inducible promoters or development-specific promoters can all be used as promoters for the Cre gene expression cassette.

[0036] In addition, the CaMV 35S promoter was used as the promoter of the Cre gene expression cassette, and this promoter portion can be replaced by another promoter of interest at the NcoI restriction endonuclease recognition site.

[0037] The terminator of the Cre gene expression cassette may be a CaMV 35S poly (A) signal or a Nos terminator, but is not limited thereto.

[0038] In the secondary vector, the Cre gene expression cassette was inserted into the same loxP structure as that of the primary vector.

[0039] In addition to the Cre gene expression cassette, the loxP construct of the secondary vector contains additional restriction endonuclease recognition sites, so other temporary gene expression cassettes can be additionally inserted therein.

[0040] The T-DNA portion outside the loxP construct of the secondary vector has additional restriction endonuclease recognition sites, so a second desired gene expression cassette can be inserted into it for stable transformation.

[0041] The plasmid backbone of the secondary vector can be based on the backbone of any Agrobacterium-mediated transformation plasmid.

[0042] In addition, the plasmid backbone of the secondary vector is based on the pICSL4723 vector.

[0043] The present invention includes application methods of the plant transformation system composed of the primary vector and the secondary vector in various situations.

[0044] The plant transformation system of the present invention can be effectively used for Agrobacterium-mediated in planta transformation.

[0045] In Agrobacterium-mediated in planta transformation, the primary vector is first transfected into the seed embryos, shoot apical meristems, dormant lateral buds and flowers of the target plant, and then the transformants are selected by monitoring the corresponding fluorescence in a dark room.

[0046] Fluorescence observation of transformed plants can be performed in a non-invasive manner. "Non-invasive" means that fluorescence can be observed without separating or destroying the corresponding plant tissues and without handling any external substances.

[0047] Fluorescence microscopes or corresponding optical systems can be used for fluorescence observation. The so-called corresponding optical system refers to an optical system composed of a lamp that emits excitation light of the corresponding wavelength and a filter that blocks light of other wavelengths except the corresponding fluorescence wavelength.

[0048] In addition, using eYGFPuv fluorescent protein as a marker gene, the fluorescence of the transformed plant tissue can be distinguished by the naked eye under a light source with a wavelength of 365 nm.

[0049] The primary transformed tissue of the target plant is selected and subsequently transfected with the secondary vector, and then the secondary transformants without the fluorescent marker gene or other temporary genes are obtained by monitoring the loss of fluorescence.

[0050] When performing secondary transfections on the next generation of primary transformants, homozygotes must be used to reduce the occurrence of false-negative secondary transformants.

[0051] However, it is not necessary to obtain homozygosity when performing secondary transfection on the shoot apical meristem, dormant lateral buds, or flowers of the generation of primary transformants.

[0052] For the selected secondary transformants, PCR detection must be used to verify the deletion of the corresponding fluorescent marker and Cre gene.

[0053] The primary vectors of the present invention can also be effectively used for transient transformation of target plant tissues.

[0054] Agrobacterium suspensions containing the primary vector can be infiltrated into leaves or roots of target plants, and the degree of transformation can be confirmed by fluorescence observation without isolating the corresponding tissues.

[0055] Confirmed fluorescent tissues can be further cultured and used to analyze the expression levels and function of genes of interest.

[0056] The plant transformation system of the present invention is suitable for use in tissue culture-dependent transformation.

[0057] In this case, the selectable marker for primary transformed callus is gain of fluorescence and the selectable marker for secondary transformed callus is loss of fluorescence. BRIEF DESCRIPTION OF THE DRAWINGS

[0058] The specific embodiments of the present invention are further described in detail with reference to the accompanying drawings.

[0059] Figure 1 A is the construction process of the main vector GVloxP / DsRed containing the red fluorescent gene marker. Figure 1 B is the GVloxP / DsRed vector map.

[0060] Figure 2 The method of inserting the target gene into the master vector GVloxP / DsRed is shown.

[0061] Figure 3 A map of the main vector GVloxP / eYGFPuv-GUS and the UV-visible fluorescent gene marker.

[0062] Figure 4 These are the results of fluorescence observation in tobacco leaves transiently expressing various fluorescent marker genes.

[0063] Figure 5 A is a diagram of the secondary vector piCreloxP. Figure 5 The DNA electrophoresis diagram shown in B shows that the piCreloxP vector without introns is unstable when replicated in E. coli. Figure 5 C: When an intron is introduced into the CDS of the Cre gene, the vector is stable. Figure 5 D is the DNA electrophoresis diagram of precisely spliced ​​Cre mRNA expressed in plant cells. Figure 5 E is the sequencing result of Cre mRNA expression in plant cells.

[0064] Figure 6 A is the construction result of AaTPPA overexpression vector GVloxP / DsRed-AaTPPA. Figure 6 B shows the expression of the red fluorescent marker gene (DsRed) in the leaves of Actinidia arguta infected with Agrobacterium containing the GVloxP / DsRed-AaTPPA vector. Figure 6 C shows the expression level of AaTPPA in Actinidia arguta leaves. Figure 6 D is the DAB staining of leaves of Actinidia arguta transiently overexpressing AaTPPA- under normal conditions and after -4℃ cold stress treatment for 2 h. Figure 6 E is the relative intensity of DAB staining.

[0065] Figure 7 A is the selection of red fluorescence observation of Arabidopsis T1 seedlings transformed with the main vector GVloxP / DsRed on MS medium without Hyg antibiotics. Figure 7 B shows the red fluorescence of different tissues of selected T1 Arabidopsis. Figure 7 C shows the drug resistance of Arabidopsis T2 seedlings transformed with the GVloxP / DsRed vector grown on MS medium containing Hyg antibiotic.

[0066] Figure 8 A shows the selection of Arabidopsis secondary transformants introduced with the piCreloxP secondary vector. Figure 8 B is a DNA electrophoresis gel image, which confirms that the DsRed fluorescent marker gene has been removed from the genome of the secondary transformant. Figure 8 C shows the absence of the Cre gene in the genome of the secondary transformant. DETAILED DESCRIPTION

[0067] The present invention is further explained clearly and completely below in conjunction with the accompanying drawings and specific embodiments of the present invention, but it should be understood that the implementation case described is only a part of the present invention, and other implementation cases obtained in the field all fall within the scope of protection of the present invention.

[0068] Embodiment 1

[0069] Construction of the primary vector of red fluorescent protein marker gene (GVloxP / DsRed)

[0070] Materials: GV1300 vector was provided by the College of Life Sciences, Northeast Forestry University. MtPT4-p3 vector was purchased from Addgene. The loxP fragment was artificially synthesized by China Kemet Biotechnology Co., Ltd. and cloned into the pUC57 vector. Its DNA sequence is the same as that of gene number 1.

[0071] The vector GV1300 was constructed and double digested with EcoRI and PmeI, and then the linearized GV1300 vector was purified by DNA electrophoresis gel extraction. The artificially synthesized loxP DNA fragment was PCR amplified using 2×Phanta Max Master Mix (Vazyme) and GloxP-F / R primers.

[0072] The nucleotide sequence of the upstream primer GloxP-F is

[0073] GloxP-F: 5'-TATGACCATGATTACGAATT ACTCTGTGCCGAATTCGGAT -3';

[0074] The nucleotide sequence of the downstream primer GloxP-R is

[0075] GloxP-R: 5'-CAAACACTGATAGTTTAAACT CCGGGATAACTTCGTATAATG -3'

[0076] (The underlined sequence is the part that matches the artificially synthesized loxP sequence, and the rest is the part homologous to the end of the linearized GV1300 vector)

[0077] Exnase II recombinase was used to homologously recombine the linearized GV1300 vector with the PCR-amplified loxP fragment to construct the GVloxP vector ( Figure 1 A), transform it into chemically competent E. coli DH5α strain, and screen the transformed colonies on Luria Bertani (LB) plates containing 50 μg / mL kanamycin. Perform PCR detection on kanamycin-resistant colonies to verify whether the loxP construct is inserted, and finally perform sequencing. The primers used for PCR detection and sequencing are as follows.

[0078] The nucleotide sequence of the upstream primer M13-R is

[0079] M13-R: 5'-CAGGAAACAGCTATGAC-3'

[0080] The nucleotide sequence of the downstream primer SFc-R is

[0081] SFc-R: 5'-AATGGACGAACGGATAAACC-3'

[0082] Next, the GVloxP vector was isolated from the transformed E. coli culture using a plasmid DNA purification kit, double-digested at the KpnI and SpeI restriction sites within the loxP construct, and then the linearized GVloxP vector was purified by DNA electrophoresis gel extraction.

[0083] The DsRed gene expression cassette of the MtPT4-p3 vector was amplified by PCR using 2 × Phanta Max Master Mix (Vazyme) and UDR-F / R primers.

[0084] The nucleotide sequence of the upstream primer UDR-F is

[0085] UDR-F: 5'-ATTATACGAAGTTATGGTAC ACGTCGTTGTGGTTGGTGC -3'

[0086] The nucleotide sequence of the downstream primer UDR-R is

[0087] UDR-R: 5'-TATAGATCTCTGCAGACTAGT AGCGTCGATCTAGTAACATAG -3'

[0088] (The underlined sequence indicates the portion that matches the MtPT4-p3 vector template, and the rest is the portion homologous to the end of the linearized GVloxP vector.) The PCR-amplified DsRed gene expression cassette contains the AtUbiquitin10 promoter, DsRed CDS, and Nos poly (A) terminator, and its DNA sequence is the same as that of gene number 3.

[0089] Exnase II recombinase was used to homologously recombine the linearized GVloxP vector with the PCR-amplified DsRed gene expression cassette to construct the GVloxP / DsRed vector ( Figure 1A), transformed into the chemically competent Escherichia coli DH5α strain, and the transformant colonies were screened on Luria Bertani (LB) plates containing 50 μg / mL kanamycin. The kanamycin-resistant colonies were subjected to PCR detection to verify whether the DsRed gene expression cassette was inserted, and finally sequenced. The primers used for PCR detection and sequencing were the same as those used for PCR amplification of the DsRed gene expression cassette.

[0090] The detailed map of the GVloxP / DsRed vector is as Figure 1 shown in B. The GVloxP / DsRed vector contains the hygromycin gene (HygR) derived from the GV1300 vector. The coding sequence (CDS) of HygR can be removed by digestion with SmaI and PspXI enzymes, and replaced with the CDS of the desired gene by homologous recombination ligation. The primer sequences for PCR amplification of the CDS of the desired gene and homologous recombination ligation with the GVloxP vector are as follows:

[0091] GeneX-F: 5’-GCTTTCGCAGATCCCGGGGGGCAATGAGAT-<Forward specific primer for GeneX CDS (containing ATG start codon)> -3’

[0092] GeneX-R: 5’-TTATTATGGAGAAACTCGAGCTTA-<Reverse specific primer for GeneX CDS (not containing stop codon)>-3’ The CDS of the inserted gene is driven by the enhanced CaMV 35S promoter of the original HygR gene, and its transcription is terminated by the CaMV poly(A) signal.

[0093] Example 2

[0094] Introduce the gene of interest into the main vector GVloxP / DsRed

[0095] In Example 2, the gene of interest is trehalose-6-phosphate phosphatase A of kiwifruit (AaTPPA).

[0096] The leaves of Actinidia arguta Kuilv (KL) were ground in liquid nitrogen, and then total RNA was extracted using the RNAprep Pure Plant Kit (TIANGEN, Beijing, China).

[0097] cDNA was synthesized according to the instructions of PrimeScript reverse transcriptase kit (Takara, Japan). The CDS of AaTPPA gene was amplified from cDNA template of Actinidia arguta (KL) leaves using 2 × Phanta Max Master Mix (Vazyme) and AaTPPA-F / R primers.

[0098] The nucleotide sequence of the upstream primer AaTPPA-F is

[0099] AaTPPA-F: 5'-GCTTTCGCAGATCCCGGGGGGCAATGAGAT ATGGAACTGGAATCAAATCAC -3'

[0100] The nucleotide sequence of the downstream primer AaTPPA-R is

[0101] AaTPPA-R: 5'-TTATTATGGAGAAACTCGAGCTTA TAATGAGCTTGGCTTCCTC -3' (The underlined sequence indicates the portion that matches the MtPT4-p3 vector template, and the rest are portions homologous to the ends of the linearized GVloxP vector).

[0102] The DNA sequence of AaTPPA CDS is identical to that of gene number 4.

[0103] The GVloxP / DsRed vector mentioned in Example 1 was isolated from the E. coli culture using a plasmid DNA purification kit, and then double-digested at the SmaI and PspXI restriction sites within the HygR gene expression cassette ( Figure 2 ).

[0104] The linearized GVloxP / DsRed vector and the PCR amplification product of AaTPPACDS were purified using a Gel Extraction kit (TIANGEN), and then homologous recombination was performed using Exnase II recombinase to construct the GVloxP / DsRed-AaTPPA vector ( Figure 2 ), transformed into chemically competent Escherichia coli DH5α strain, and transformed colonies were selected on Luria Bertani (LB) plates containing 50 μg / mL kanamycin.

[0105] Kanamycin-resistant colonies were tested by PCR to verify the insertion of AaTPPA CDS, and finally sequenced.

[0106] The primers used for PCR detection and sequencing were the same as those used for the AaTPPA CDS PCR amplification described above.

[0107] Embodiment 3

[0108] Construction of the main vector containing the UV-visible fluorescent marker gene (GVloxP / eYGFPuv-GUS)

[0109] Materials: GVloxP vector constructed in Example 1.

[0110] pCAMBIA1303 and pAXY0001 vectors were purchased from Addgene.

[0111] Construction of GVloxP / eYGFPuv vector The GVloxP vector was isolated from the transformed E. coli culture using a plasmid DNA purification kit, double-digested at the KpnI and PstI restriction sites within the construct, and then the linearized GVloxP vector was purified by DNA electrophoresis gel method.

[0112] The eYGFP-F / R gene expression cassette of the pAXY0001 vector was PCR amplified using 2 × Phanta Max Master Mix (Vazyme) and YGFP-F / R primers.

[0113] The nucleotide sequence of the upstream primer YGFP-F is

[0114] YGFP-F: 5'-CGAAGTTATAGATCTCTGCAG CATGGAGTCAAAGATTCAAAT -3'

[0115] The nucleotide sequence of the downstream primer YGFP-R is

[0116] YGFP-R: 5'-ATTATACGAAGTTATGGTACC GCTCACTCAAAGGCGGTA -3'

[0117] (The underlined sequence is the part that matches the pAXY0001 vector template, and the rest is the part homologous to the linearized GVloxP vector end).

[0118] The PCR-amplified eYGFPuv gene expression cassette contains CaMV 35S promoter, AtCOR47 5′-UTR enhancer, eYGFPuv CDS and AtHSP18.2 terminator, and its DNA sequence is the same as that of gene number 6.

[0119] The linearized GVloxP vector was connected to the PCR-amplified eYGFPuv gene expression cassette by homologous recombination with Exnase II recombinase to construct the GVloxP / eYGFPuv vector, which was transformed into chemically active Escherichia coli DH5α strains, and the transformed colonies were screened on Luria Bertani (LB) plates containing 50 μg / mL kanamycin. PCR detection was performed on kanamycin-resistant colonies to verify whether the DsRed gene expression cassette was inserted, and finally sequencing was performed.

[0120] The primers used for PCR detection and sequencing were the M13-R and SFc-R primers used in Example 1.

[0121] GUS gene expression cassette introduced into GVloxP / eYGFPuv vector. The GVloxP / eYGFPuv vector was isolated from the transformed Escherichia coli culture using a plasmid DNA purification kit, double-digested at the PvuII and PspXI restriction sites in the hygromycin-resistant gene expression cassette, and then the linearized GVloxP / eYGFPuv vector was purified by DNA electrophoresis gel extraction.

[0122] The GUS gene expression cassette in the pCAMBIA1303 vector was amplified by PCR using 2×Phanta Max Master Mix (Vazyme) and GUS-F / R primers.

[0123] The nucleotide sequence of the upstream primer GUS-F is

[0124] GUS-F: 5'-AACCTGTCGTGCCAGCTG AGCAGCTTGAGCTTGGATC -3'

[0125] The nucleotide sequence of the downstream primer GUS-R is

[0126] GUS-R: 5'-TTATTATGGAGAAACTCGAGCTCA TTGTTTGCCTCCCTGCTG -3'

[0127] (The underlined sequence indicates the portion that matches the pCAMBIA1303 vector template, and the rest are portions homologous to the ends of the linearized GVloxP / eYGFPuv vector).

[0128] The PCR-amplified GUS gene expression cassette contains the CaMV 35S promoter and the GUS CDS, but does not contain the termination sequence. The linearized GVloxP / eYGFPuv vector was homologously recombined with the PCR-amplified GUS gene expression cassette using Exnase II recombinase to construct the GVloxP / eYGFPuv-GUS vector ( Figure 3), transformed into the chemically competent Escherichia coli DH5α strain, and the transformed colonies were screened on Luria Bertani (LB) plates containing 50 μg / mL kanamycin. The kanamycin-resistant colonies were subjected to PCR detection to verify whether the GUS gene expression cassette was inserted, and finally sequenced. The primers used for PCR detection and sequencing were the same as those used for PCR amplification of the GUS gene expression cassette.

[0129] The detailed map of the GVloxP / eYGFPuv-GUS vector is as Figure 3 shown. The GUS gene CDS of the GVloxP / eYGFPuv-GUS vector is flanked by NcoI and PspXI restriction sites at the front and back. Digestion with NcoI and PspXI can remove the coding sequence (CDS) of GUS and replace it with the CDS of the desired gene by homologous recombination ligation.

[0130] The primer sequences for PCR amplification of the CDS of the desired gene and homologous recombination ligation with the linear GVloxP / eYGFPuv vector are as follows:

[0131] GeneX-F: 5’-CGGGGGACTCTTGACCATG-<Forward specific primer for GeneX CDS (excluding the ATG start codon)>-3’ GeneX-R: 5’-TTATTATGGAGAAACTCGAGCTTA-<Reverse specific primer for GeneX CDS (excluding the stop codon)>-3’ The CDS of the inserted gene is driven by the CaMV 35S promoter, and its transcription is terminated by the CaMV poly(A) signal.

[0132] Example 4

[0133] Transient transformation of tobacco leaves to determine the fluorescence intensity of various fluorescent proteins

[0134] Materials Nicotiana benthamiana plants, 8 - 10 leaves. The GVloxP / DsRed, GVloxP / CaMV35S::DsRed, GVloxP / GFP, and GVloxP / eYGFPuv vectors were transformed into Escherichia coli DH5α strain. Infiltration buffer: 10 mM MgCl2, 10 mM MES, 100 μM acetosyringone (pH 5.8 adjusted with KOH).

[0135] Isolate the fluorescent vector plasmids from the Escherichia coli DH5α bacterial solution carrying the corresponding vectors, infiltrate the tobacco leaves and observe the fluorescent vector plasmids, and then transform them into the Agrobacterium strain GV3101 (pSoup).

[0136] Agrobacterium GV3101 (pSoup) strains carrying each vector were cultured in LB medium (beef extract peptone 10 g / L + yeast extract 5 g / L + NaCl 10 g / L) containing 50 mg / L kanamycin and 30 mg / L rifampicin at 28°C for 48 h. 5 mL of the culture was inoculated into LB medium containing 50 mg / L kanamycin and incubated until OD600 = 0.8 ~1.0.

[0137] After centrifugation at 4000 rpm for 10 min at 4°C, the bacterial suspension was suspended in 50 mL of infiltration buffer and incubated at 28°C for 2 h.

[0138] The top three young leaves of each tobacco seedling were pierced with the transformed Agrobacterium suspension using a syringe needle and then kept in a dark room for 1 day. The treated seedlings continued to grow for 2 days under normal conditions. The infiltrated leaves were then observed under a fluorescent stereo microscope (NikonSMZ25, Japan). The infiltrated tobacco leaves showed corresponding fluorescence under the corresponding excitation light ( Figure 4 A, B, C).

[0139] eYGFPuv: 398 nm, 512 nm.

[0140] Embodiment 5

[0141] Construction of the secondary vector piCreloxP

[0142] Materials pCAMBIA1303, MtPT4-p3, and pMpGWB337 vectors were purchased from Addgene.

[0143] The DNA sequence of the CDS of the Cre gene in the pMpGWB337 vector is identical to that of gene number 5.

[0144] Construction of the secondary vector piCreloxP

[0145] The MtPT4-p3 vector was double-digested with BamHI and PmeI restriction endonucleases, and the linearized vector (pICSL4723 backbone) was purified by DNA electrophoresis gel extraction.

[0146] The artificially synthesized loxP DNA fragment was amplified by PCR using 2×Phanta Max Master Mix (Vazyme) and PloxP-F / R primers.

[0147] The nucleotide sequence of the upstream primer PloxP-F is

[0148] PloxP-F: 5'-CTCTTGTGCCGAATTCGGAT-3'

[0149] The nucleotide sequence of the downstream primer PloxP-R is

[0150] PloxP-R: 5'-CTGTCAAACACTGATAGTTTCC-3'

[0151] The linearized pICSL4723 backbone was homologously recombined with the PCR-amplified loxP fragment using Exnase II recombinase to construct the pICSL-loxP vector, which was transformed into the chemically active Escherichia coli DH5α strain and screened for transformed colonies on an LB plate containing 50 μg / mL kanamycin. PCR detection was performed on kanamycin-resistant colonies to verify whether the loxP construct was inserted, and finally sequencing was performed. The primers used for PCR detection and sequencing are as follows.

[0152] The nucleotide sequence of the upstream primer PloxP-F is

[0153] SFc-F: 5'-AGCTGTTGGCTGGCTGGT-3'

[0154] The nucleotide sequence of the downstream primer SFc-R is

[0155] SFc-R: 5'-AATGGACGAACGGATAAACC-3'

[0156] Next, the pICSL-loxP vector was isolated from the transformed E. coli culture using a plasmid DNA purification kit, double-digested at the KpnI and SpeI restriction sites within the loxP construct, and then the linearized pICSL-loxP vector was purified by DNA electrophoresis gel extraction.

[0157] The Cre gene expression cassette construction method is as follows:

[0158] Using pMpGWB337 vector as template, Cre gene CDS was amplified by PCR using iCre-F / R primers.

[0159] The nucleotide sequence of the upstream primer iCre-F is

[0160] iCre-F: 5'-TTGACCATGGGA ATGTCCAATTTACTGACCGT -3'

[0161] The nucleotide sequence of the downstream primer iCre-R is

[0162] iCre-R: 5'-CACCAATTCA ATCGCCATCTTCCAGCAG -3'

[0163] (The underlined sequence is the part that matches the pMpGWB337 vector template, and the rest are the sequences that match the CaMV 35S promoter and Nos terminator fragments by overlapping PCR).

[0164] The AaTPPA intron 3 sequence (gene number 2) was inserted into the 132 bases of the Cre gene CDS using the overlap-PCR method.

[0165] Here’s how:

[0166] The 5' portion of the iCre gene CDS was PCR amplified using iCre-F and Int-R primers, and the 3' portion of the iCre gene CDS was PCR amplified using Int-F and iCre-R primers. The two portions of the iCre gene CDS were fused by overlapping PCR with iCre-F / R primers. The sequences of the Int-F / R primers are as follows:

[0167] The nucleotide sequence of the upstream primer Int-F is

[0168] Int-F: 5'-GTTTTGTATGAAATATTAGATCTCTTTTTTGACGACCTCTTTCGGTGCTGCAG CTTCTG TCCGTTTGCCG -3'

[0169] The nucleotide sequence of the downstream primer Int-R is

[0170] Int-R: 5'-GAGATCTAATATTTCATACAAACTAAAATACTTAAAGCCCAAACAAAGGGGGAGAATTAC CATTTTCCAGGTATGCTCAG -3'

[0171] (The underlined sequence indicates the part that matches the CDS of the Cre gene, and the rest is the sequence corresponding to the AaTPPA intron 3). At the same time, the CaMV 35S promoter fragment and the Nos terminator fragment were amplified from the pCAMBIA1303 vector using primers Pcmv-F / R and Tnos-F / R, respectively. The primer sequences are as follows:

[0172] The nucleotide sequence of the upstream primer Pcmv-F is

[0173] Pcmv-F: 5'-ATTATACGAAGTTATGGTAC GGATCCTCTAGAGTCGACC -3'

[0174] The nucleotide sequence of the downstream primer Pcmv-R is

[0175] Pcmv-R: 5'-TTGGACATTC CCATGGTCAAGAGTCCCC -3'

[0176] The nucleotide sequence of the upstream primer Tnos-F is

[0177] Tnos-F: 5'-AGATGGCGAT TGAATTGGTGACCAGCTC -3'

[0178] The nucleotide sequence of the downstream primer Tnos-R is

[0179] Tnos-R: 5'-TATAGATCTCTGCAGACTAGTAGGCCT CACTGATAGTTTAATTCCCG -3'

[0180] The CaMV 35S promoter, iCre gene CDS and Nos terminator fragment were connected by overlapping PCR with Pcmv-F and Tnos-R primers to construct the iCre gene expression cassette.

[0181] The linearized pICSL-loxP vector was connected to the PCR-amplified iCre gene expression cassette by homologous recombination with Exnase II recombinase to construct the piCreloxP vector, which was transformed into the chemically active Escherichia coli DH5α strain and screened for transformed colonies on LB plates containing 50 μg / mL kanamycin. PCR detection was performed on kanamycin-resistant colonies to verify whether the iCre gene expression cassette was inserted, and finally sequencing was performed.

[0182] The primers used for PCR detection and sequencing were Pcmv-F and Tnos-R primers. The detailed map of the piCreloxP vector is shown in Figure 5 As shown in A.

[0183] Verification of the role of intron 3 sequence in the AaTPPA gene

[0184] 1) Preventing self-cleavage of loxP constructs in bacterial cells First, the pCreloxP vector containing the Cre gene expression cassette without introns was prepared. The construction of this vector does not require the intron insertion step in the above piCreloxP construction process. The plasmid was isolated from E. coli DH5α, transformed with the pCreloxP vector, and digested with SmaI and StuI, respectively ( Figure 5 B).

[0185] The pCreloxP vector has a SmaI site outside the loxP construct and a StuI site inside the loxP construct ( Figure 5 A).

[0186] like Figure 5B, Some plasmids remained in their original state without being cut by StuI, and two cleavage products of different lengths were produced by SmaI digestion. This is because the Cre gene in the pCreloxP vector, although it has a plant-specific CaMV 35S promoter, is only expressed in small amounts in prokaryotic E. coli cells, thus excising the loxP construct from the vector.

[0187] Sequencing of the loxP construct region of the pCreloxP vector using SFc-F / R primers failed because of the formation of double peaks, which also explains the presence of two vectors in the sample isolated from the partial loxP construct excision plasmid.

[0188] The piCreloxP vector was constructed to prevent the self-cleavage of the loxP vector during the culture process of Escherichia coli or Agrobacterium.

[0189] The Cre gene of the piCreloxP vector contains the AaTPPA intron 3 sequence (89 bp), which prevents the Cre protein from forming a true ORF (open reading frame) in bacterial cells. The plasmid was isolated from E. coli transformed with the piCreloxP vector and cleaved with the StuI restriction endonuclease to obtain a single linearized vector product ( Figure 5 C). This demonstrates that the AaTPPA intron 3 sequence introduced into the Cre gene prevents the self-cleavage of the loxP structure of the piCreloxP vector and stabilizes the plasmid in bacterial cells.

[0190] Tobacco leaves were infected with Agrobacterium tumefaciens GV3101 carrying the piCreloxP vector, stored in a dark room for 1 day and under normal conditions for 2 days, and the transformed tobacco leaves were collected for RNA extraction.

[0191] The samples were ground into powder in liquid nitrogen, and total RNA was extracted using RNAprep Pure Plant Kit (TIANGEN, Beijing, China). cDNA was synthesized according to the instructions of PrimeScript Reverse Transcriptase Kit (Takara, Japan).

[0192] The Cre gene sequence containing the intron fragment was amplified by PCR using qIC-F / R primers. Figure 5 D). The primer sequences are as follows:

[0193] The nucleotide sequence of the upstream primer qIC-F is

[0194] qIC-F: 5'-CCAATTTACTGACCGTACACC-3'

[0195] The nucleotide sequence of the downstream primer qIC-R is

[0196] qIC-R: 5'-ACTTGCACCATGCCGCCCA-3'

[0197] like Figure 5 As shown in D, the length of the Cre mRNA PCR product is shorter than that of the piCreloxP vector. The sequencing results of the Cre mRNA PCR product showed that the intron part was accurately removed ( Figure 5 E). This demonstrates that in plant cells, the AaTPPA intron 3 sequence is accurately spliced ​​during the formation of Cre mRNA.

[0198] Embodiment 6

[0199] Transient transformation of GVloxP / DsRed-AaTPPA vector in Actinidia arguta leaves and observation of gene expression and phenotypic characteristics

[0200] The Longcheng No. 2 (L2) kiwifruit plant is 2 months old.

[0201] The GVloxP / DsRed-AaTPPA vector was used to transform the Escherichia coli DH5α strain (prepared in Example 2).

[0202] Agrobacterium tumefaciens GV3101 (pSoup) competent cell infiltration buffer: 10 mM MgCl2, 10 mM MES, 100 μM Acetosyringone (pH 5.8, KOH adjustment)

[0203] Preparation and infiltration of Agrobacterium strain carrying GVloxP / DsRed-AaTPPA vector

[0204] The GVloxP / DsRed-AaTPPA plasmid was transformed into the E. coli strain GV3101 (pSoup). The GVloxP / DsRed vector was used as a mock plasmid ( Figure 6 A). The young leaves of Actinidia arguta seedlings (L2) were infiltrated with the transformed Agrobacterium suspension (suspended in infiltration buffer, OD600 = 0.6-1.0), cultured in a dark room for 1 day, and continued to grow for 2 days under normal conditions. The attachment state of the infiltrated leaves was observed under a fluorescent stereomicroscope (Nikon SMZ25, Japan). After passing through a 600 nm filter and under 540 nm excitation light, the infiltrated Actinidia arguta leaves showed bright red fluorescence ( Figure 6 B).

[0205] Detection of AaTPPA gene expression and observation of some phenotypic characteristics To determine the expression level of AaTPPA gene, leaves of Actinidia arguta showing red fluorescence were collected, ground into powder in liquid nitrogen, and then total RNA was extracted using RNAprep Pure Plant Kit (TIANGEN, Beijing, China).

[0206] cDNA was synthesized according to the instructions of the PrimeScript Reverse Transcriptase Kit (Takara, Japan).

[0207] 18S rRNA was used as an internal reference. qPCR was performed using the Premix ExTaqTM (TaKaRa) mixture on the Lightcycler480 system (Roche, USA). Three biological replicates were used for each sample. All data were relative quantification (2− ΔΔCt ) method for analysis. The AaTPPA gene specific primer sequences are as follows:

[0208] The nucleotide sequence of the upstream primer qTPPA-F is

[0209] qTPPA-F: 5'-GCCTCTGAGCTGGTATTAACTG-3'

[0210] The nucleotide sequence of the downstream primer qTPPA-R is

[0211] qTPPA-R: 5'-CCGCTCAAAAGATGCAAGTG-3'

[0212] The results showed that the expression level of AaTPPA in the GVloxP / DsRed-AaTPPA transformed group (OE) was significantly higher than that in the mock group (EV) or the untransfected control group (CK) transfected with the GVloxP / DsRed empty vector ( Figure 6 C).

[0213] Next, the A. arguta (L2) plants with red fluorescent leaves were incubated under normal conditions for 2 days and then subjected to cold stress at -4°C for 2 h to observe the accumulation of ROS ( Figure 6 D).

[0214] Histochemical analysis of H2O2 was performed by staining with 3,3-diaminobenzidine (DAB). Actinidia arguta leaves were immersed in DAB (0.05 g / mL DAB, 50 mmol / L Tris-HCl, pH 5.6) staining solution and incubated in the dark at 37°C for 3 h. Chlorophyll was then decolorized in Carnoy solution (ethanol: lactic acid: glycerol = 3:1:1). The relative average intensity of DAB staining was analyzed using ImageJ software.

[0215] DAB staining showed that the H2O2 accumulation in the EV group was significantly increased, which may be due to the damage of leaf tissue during transfection, or the overexpression of marker genes such as DsRed and HygR had a negative impact on plant physiology ( Figure 6 D, E). However, the H2O2 level in the OE group after cold stress was significantly lower than that in the CK group. This allows monitoring the transformation efficiency of the main vector and observing the effects of gene expression on plant tissues.

[0216] Embodiment 7

[0217] The original vector was transformed into Arabidopsis thaliana in plants using the floral dip method and screened.

[0218] GVloxP / DsRed(HygR + ) The vector was transformed into Escherichia coli DH5α (the preparation method is as in Example 1) Potted Arabidopsis thaliana Agrobacterium tumefaciens GV3101 strain competent cells Transfection buffer: 10% sucrose, 0.5% MES (pH 5.7, adjusted with KOH) Murashige and Skoog 1962 (MS) medium, containing 8 g / L agar and 30 g / L sucrose (pH 5.8).

[0219] From the GVloxP / DsRed (HygR + ) vector was isolated from Escherichia coli DH5α culture and transformed into Agrobacterium GV3101. Arabidopsis thaliana (Col-0) was transformed by Agrobacterium-mediated floral dip method. The transformed Agrobacterium was cultured by shaking until OD600 reached 0.6-1.0, and the bacteria were collected by centrifugation and suspended in transfection buffer at a concentration of OD600=0.8.

[0220] Add 5 μL of Silwet L-77 and 0.5 μL of 1 mg / mL 6-BA to 50 mL of Agrobacterium suspension. Soak all flowers of Arabidopsis in the suspension for 1 minute, culture in a dark room for 2 days, and then grow under normal conditions. Harvest T0 generation seeds.

[0221] The selection of Arabidopsis transformants was as follows: all T0 seeds were plated on MS plates without antibiotics, placed at 4°C for 2 d, and then cultured in an incubator at 25°C for 12 d (16 h light / 8 h dark per day). The plates were observed under a fluorescent stereomicroscope (Nikon SMZ25, Japan) to look for red fluorescent seedlings ( Figure 7 A).

[0222] Select seedlings with red fluorescence and transplant them into pots and further grow them in a greenhouse. Collect different parts of the plant and observe them under a fluorescent stereo microscope. All tissues of the transformed Arabidopsis, including leaves, stems, flowers, apical meristems, and seeds, showed red fluorescence ( Figure 7 B), showing that transformed tissue can also be monitored in planta at generation 0.

[0223] T1 seeds were inoculated on MS medium containing hygromycin (50 mg / L) and incubated at 4°C for 2 days and then at 25°C for 12 days (16 h light / 8 h dark per day). Figure 7 As shown in C, all seeds germinated on hygromycin medium and the seedlings grew normally, indicating that the transformed HygR gene was accurately expressed and played a role.

[0224] Embodiment 8

[0225] The secondary vector was transformed into Arabidopsis primary transformants and secondary transformants without fluorescent markers were selected.

[0226] Arabidopsis thaliana T1 seeds were transformed with the GVloxP / DsRed vector (same as in Example 7), and Escherichia coli DH5α was transformed with the piCreloxP vector (same as in Example 4). Agrobacterium tumefaciens GV3101 strain competent cells were transfected with the buffer: 10% sucrose, 0.5% MES (pH 5.7, adjusted with KOH) MS medium, containing 8 g / L agar and 30 g / L sucrose (pH 5.8).

[0227] About 30 seeds harvested from the T1 generation of the primary transgenic Arabidopsis thaliana carrying the GVloxP / DsRed vector were inoculated onto MS plates. After incubation for 12 days, 10 seedlings showing red fluorescence were selected and transplanted one by one into each pot, and T2 seeds were harvested from each pot. A portion of the T2 seeds (about 30 seeds) of each line were inoculated onto MS plates, incubated for 12 days, and the fluorescence was observed. One line was selected in which all seedlings on one plate showed red fluorescence. This line was considered to be a homozygous transformation of the T3 generation. The homozygous T3 seedlings obtained by this method were transplanted into pots for the next secondary vector transformation.

[0228] The transformation of the secondary vector and the selection of the secondary transformation plasmid were isolated from the E. coli DH5α culture and then transformed into Agrobacterium GV3101. The above selected homozygous primary transformed Arabidopsis thaliana was homozygous transformed using the Agrobacterium-mediated floral dip method described in Example 7. The seeds of the 0th generation were harvested.

[0229] Selection of secondary vectors was performed as follows: all T0 seeds were plated on MS plates without antibiotics at 4 °C for 2 d, and then cultured in an incubator at 25 °C for 12 d (16 h light / 8 h dark per day). Each plate was observed under a fluorescent stereomicroscope to look for seedlings that did not show red fluorescence ( Figure 8 A).

[0230] Select seedlings without red fluorescence and transplant them into pots and grow them in a greenhouse for one week. Collect 1 to 2 leaves and separate genomic DNA using the CTAB method. The deletion of DsRed and Cre genes was confirmed by primer PCR detection as follows:

[0231] DsRed gene PCR product length (961 bp)

[0232] The nucleotide sequence of the upstream primer DRCDS-F is

[0233] DRCDS-F: TTAATGGGGTCATCCAAGAATG

[0234] The nucleotide sequence of the downstream primer DRCDS-R is

[0235] DRCDS-R: AGCGTCGATCTAGTAACATAG

[0236] Cre gene PCR product length (257 bp)

[0237] The nucleotide sequence of the upstream primer qIC-F is

[0238] qIC-F: 5'-CCAATTTACTGACCGTACACC-3'

[0239] The nucleotide sequence of the downstream primer qIC-R is

[0240] qIC-R: 5'-ACTTGCACCATGCCGCCCA-3'

[0241] from Figure 8 As can be seen from B and C, all selected lines lack DsRed and Cre genes.

[0242] The foregoing description of specific exemplary embodiments of the present invention is for the purpose of illustration and demonstration. These descriptions are not intended to limit the present invention to the precise form disclosed, and it is clear that many changes and variations can be made based on the above teachings, and some substitutions and modifications of some of the technical features can be made without creative labor, all within the scope of protection of the present invention.

[0243] Gene sequence: Gene number 1 (loxP structure nucleotide sequence) 92 bp ATAACTTCGTATAGCATACATTATACGAAGTTATGGTACCACTAGTCTGCAGAGATCTATAACTTCGTATAGCATACATTATACGAAGTTAT Gene number 2 (AaTPPA intron 3 nucleotide sequence) 89 bp GTAATTCTCCCCCTTTGTTTGGGCTTTAAGTATTTTAGTTTGTATGAAATATTAGATCTCTTTTTTGACGACCTCTTTCGGTGCTGCAG Gene number 3 (nucleotide sequence of DsRed gene expression cassette) 2460 bp Gene number 4 (nucleotide sequence of the protein coding region of the AaTPPA gene) 1146 bp Gene number 5 (nucleotide sequence of the Cre recombinase gene protein coding region) 1029 bp Gene number 6 (nucleotide sequence of eYGFPuv gene expression cassette) 2211 bp

Claims

1. An improved plant gene transformation system consists of two vectors, including a primary vector marked with a fluorescent protein and a secondary vector containing a Cre recombinase gene.

2. The construction method and characteristics of the primary carrier according to claim 1 are as follows: 1) The primary vector was constructed based on GV1300. 2) After double digestion of GV1300 vector with EcoRI and PmeI, the synthetic loxP construct was connected to prepare GVloxP vector. The synthetic loxP construct has KpnI, SpeI, PstI and BglII restriction endonuclease recognition sites located between the loxP elements in sequence. The sequence is the same as gene number 1. 3) After restriction digestion, the GVloxP vector is connected to a fluorescent protein expression cassette to construct a primary vector. Fluorescent proteins include, but are not limited to, DsRed, eYGFPuv and eGFP. 4) The primary vector loxP construct has an extra restriction endonuclease recognition site, into which the desired gene can be inserted. 5) The loxP construct of the primary vector contains redundant restriction endonuclease recognition sites, so temporary expression genes (such as CRISPR / Cas9, antibiotic resistance genes, etc.) can be inserted into this site.

3. The construction method and characteristics of the secondary carrier according to claim 1 are as follows: 1) The backbone of the secondary vector is based on the pICSL4723 vector. 2) The MtPT4-p3 vector was double-digested with BamHI and PmeI restriction endonucleases and then connected to the loxP construct to prepare the pICSL-loxP vector. The sequence of the loxP structure is the same as that of claim 2. 3) The pICSL-loxP vector was double-digested with KpnI and SpeI, and then connected to the Cre recombinase expression cassette to construct the secondary vector piCreloxP. The third intron (89 bp) of the AaTPPA gene of Actinidia arguta was inserted into the CDS of the Cre recombinase gene, and its sequence was the same as that of gene number 2. 4) Since the secondary vector has redundant restriction endonuclease recognition sites outside the loxP construct, a second desired gene expression cassette can be inserted into it. 5) Insert the transient expression gene into the SpeI and StuI restriction endonuclease recognition sites of the loxP construct in the secondary vector.

4. Through Agrobacterium-mediated infection, the primary vector can be used alone to introduce the target gene into the plant. 1) During the transient transformation of the primary vector into plant leaves, the transfection efficiency can be monitored by a non-invasive method using fluorescence observation. 2) In the case of tissue culture-dependent transformation or direct plant transformation, transformants can be directly selected by fluorescence observation.

5. By introducing the secondary vector into plants transformed with the primary vector, the loxP construct containing the fluorescent marker gene can be removed. 1) After Agrobacterium-mediated infection of the secondary vector, secondary transformants are selected by observing the loss of fluorescence. 2) Secondary transformation can remove the fluorescent marker gene or the Cre gene of the secondary vector itself.

Images