Cotton sodium-calcium exchange protein gene GhNCX19 and application thereof in regulation and control of growth and development of cotton fibers

Abstract

The invention discloses a cotton sodium-calcium exchange protein gene GhNCX19 and application of the cotton sodium-calcium exchange protein gene GhNCX19 in regulation and control of growth and development of cotton fibers. The invention discloses an application of a sodium-calcium exchange protein coding gene GhNCX19 in improvement of cotton fiber length or cultivation of a new germplasm with significantly improved cotton fiber quality. The nucleotide sequence of the encoding gene GhNCX19 of the Na-Ca exchange protein is as shown in SEQ ID NO: 1, and the amino acid sequence of the encoding protein of the encoding gene GhNCX19 of the Na-Ca exchange protein is as shown in SEQ ID NO: 2. The invention reports the function of the sodium-calcium exchange protein coding gene GhNCX19 in cotton fiber development for the first time. The GhNCX19 can negatively regulate and control development start and elongation of cotton fibers, long-fiber cotton can be constructed by knocking out expression of the GhNCX19 gene, the length of cotton fibers is increased, and important gene resources and new breeding materials are provided for cultivation of high-quality cotton.

Description

Technical Field

[0001] The present invention relates to the field of plant gene technology, in particular to a cotton sodium-calcium exchanger gene GhNCX19 and an application thereof in regulating the growth and development of cotton fibers. Background Art

[0002] Cotton fiber is a natural fiber produced on cotton plants, carrying a wealth of characteristics and functions. Its unique moisture absorption, heat preservation, heat resistance and alkali resistance make cotton fiber widely used in textiles, clothing and many industrial fields.

[0003] The importance of cotton fiber quality is mainly reflected in three aspects: economic benefits, textile quality, and consumer welfare. From the perspective of economic benefits, as an important source of natural fiber in the world, the quality of cotton fiber is directly related to the quality of textiles and market demand. High-quality cotton fiber can attract higher sales prices, increase the added value of cotton textiles, and thus increase the economic benefits of the cotton industry. The quality of cotton fiber has an important impact on the quality, performance, appearance and comfort of textiles. High-quality cotton fiber has better moisture absorption, breathability and warmth retention, and can improve the comfort and durability of textiles. From the perspective of consumer welfare, high-quality cotton fiber can meet the needs of consumers and provide a comfortable wearing experience. By improving the quality of cotton fiber, consumers' demand for high-quality textiles can be met, thereby improving consumer welfare.

[0004] The cotton fiber development process can be divided into four but overlapping periods, including initial differentiation (-3-2DPA, Days post anthesis), cell elongation (1-20DPA), secondary wall thickening (15-45DPA), and dehydration maturity (40-50DPA). Among them, the initial differentiation stage determines the number of fibers on each ovule, and the formation of the primary wall and secondary wall determines the fiber length and strength. The three developmental stages from initial differentiation to secondary wall thickening determine the overall yield and quality of cotton fibers.

[0005] In terms of cotton fiber quality improvement technology, researchers have genetically improved cotton varieties through gene editing, gene transformation and other technical means to improve fiber length, strength and other quality traits. Therefore, using bioinformatics methods, combined with molecular biology and genetic engineering and other technical means, to explore and identify important functional genes that affect cotton fiber development and analyze their molecular mechanisms will help provide a theoretical basis for the genetic improvement of cotton varieties and improve the quality and yield of cotton fibers. At present, some genes related to regulating cotton fiber development have been identified, and other cotton fiber functional genes still need to be explored. Summary of the invention

[0006] The purpose of the present invention is to overcome the above-mentioned deficiencies of the prior art and provide a cotton sodium-calcium exchanger gene GhNCX19 and its application in regulating the growth and development of cotton fibers.

[0007] The first object of the present invention is to provide an application of a sodium-calcium exchanger encoding gene GhNCX19 in improving cotton fiber length or in cultivating new germplasm with significantly improved cotton fiber quality.

[0008] The second object of the present invention is to provide a recombinant vector.

[0009] The third object of the present invention is to provide a recombinant engineered bacterium.

[0010] A fourth object of the present invention is to provide a method for increasing the length of cotton fibers.

[0011] The fifth object of the present invention is to provide a method for cultivating long-fiber cotton

[0012] In order to achieve the above object, the present invention is implemented by the following scheme:

[0013] In the first aspect, the present invention provides an application of a sodium-calcium exchanger encoding gene GhNCX19 in improving cotton fiber length or in cultivating new germplasm with significantly improved cotton fiber quality; the nucleotide sequence of the sodium-calcium exchanger encoding gene GhNCX19 is shown in SEQ ID NO: 1, and the amino acid sequence of the encoded protein is shown in SEQ ID NO: 2.

[0014] The number of epidermal cell protrusions in ovules of GhNCX19 knockout cotton lines was significantly or extremely significantly higher than that in wild-type WT, indicating that GhNCX19 gene negatively regulates the initiation of cotton fiber development. The length of mature fibers in GhNCX19 knockout cotton lines was significantly longer than that in WT, indicating that GhNCX19 gene also negatively regulates the elongation of cotton fibers.

[0015] In a second aspect, the present invention provides a recombinant vector comprising sgRNA editing sites sgRNA1 and sgRNA2;

[0016] The nucleotide sequence of the sgRNA1 is shown in SEQ ID NO: 3;

[0017] The nucleotide sequence of the sgRNA2 is shown in SEQ ID NO:4.

[0018] In a specific embodiment of the present invention, the recombinant vector contains a tRNA-sgRNA1 fusion and a gRNAscaffold-tRNA-sgRNA2 fusion;

[0019] The tRNA-sgRNA1 fusion is connected to sgRNA1, and the nucleotide sequence of the tRNA-sgRNA1 fusion is shown in SEQ ID NO: 6;

[0020] The gRNA scaffold-tRNA-sgRNA2 fusion is connected to sgRNA2, and the nucleotide sequence of the gRNA scaffold-tRNA-sgRNA2 fusion is shown in SEQ ID NO: 8.

[0021] Furthermore, the 3' end of the tRNA-sgRNA1 fusion is connected to the 5' end of the gRNA scaffold-tRNA-sgRNA2 fusion.

[0022] Furthermore, the recombinant vector uses pRGEB32-GhU6.9-NPTII vector as a backbone vector.

[0023] In a specific embodiment of the present invention, the tRNA-sgRNA1 fusion and the gRNA scaffold-tRNA-sgRNA2 fusion are connected between the BsaI site of the pRGEB32-GhU6.9-NPTII vector to obtain the pRGEB32-GhNCX19 knockout plasmid. The bases in the coding region of the sodium calcium exchanger protein encoding gene GhNCX19 can be inserted or deleted to achieve the knockout of the sodium calcium exchanger protein encoding gene GhNCX19 and reduce the expression level of the sodium calcium exchanger protein encoding gene GhNCX19.

[0024] In a third aspect, the present invention provides a recombinant engineered bacterium, wherein the recombinant engineered bacterium expresses the recombinant vector.

[0025] In a specific embodiment of the present invention, the pRGEB32-GhNCX19 knockout plasmid is transformed into Escherichia coli and / or Agrobacterium.

[0026] Furthermore, the pRGEB32-GhNCX19 knockout plasmid can be transformed into Escherichia coli by a heat shock method, or the pRGEB32-GhNCX19 knockout plasmid can be transformed into Agrobacterium by a liquid nitrogen freezing method.

[0027] In a specific embodiment of the present invention, the Escherichia coli is Escherichia coli DH5α, and the Agrobacterium is Agrobacterium GV3101.

[0028] In a fourth aspect, the present invention provides a method for increasing the length of cotton fibers, which reduces the expression level of a sodium-calcium exchanger encoding gene GhNCX19 in cotton, thereby lengthening the length of cotton fibers.

[0029] In a specific embodiment of the present invention, the recombinant vector or the recombinant engineered bacteria is used to reduce the expression level of the sodium-calcium exchange protein encoding gene GhNCX19 in cotton.

[0030] The recombinant vector or the recombinant engineered bacteria can insert or delete bases in the coding region of the sodium-calcium exchanger protein encoding gene GhNCX19 to achieve knockout of the sodium-calcium exchanger protein encoding gene GhNCX19 and reduce the expression level of the sodium-calcium exchanger protein encoding gene GhNCX19.

[0031] Furthermore, the pRGEB32-GhNCX19 knockout plasmid can be transformed into Agrobacterium by liquid nitrogen freezing, and the positive Agrobacterium single bacterial liquid can be transferred into cotton recipients by hypocotyl-mediated transformation to screen and obtain GhNCX19 gene knockout cotton, thereby increasing cotton fiber length.

[0032] In a specific embodiment of the present invention, the Escherichia coli is Escherichia coli DH5α, the Agrobacterium is Agrobacterium GV3101, and the cotton receptor may be Jin668.

[0033] In a fifth aspect, the present invention provides a method for cultivating long-fiber cotton, which reduces the expression level of the sodium-calcium exchange protein encoding gene GhNCX19 in cotton, thereby lengthening the cotton fiber length.

[0034] In a specific embodiment of the present invention, the recombinant vector or the recombinant engineered bacteria is used to reduce the expression level of the sodium-calcium exchange protein encoding gene GhNCX19 in cotton.

[0035] Furthermore, the pRGEB32-GhNCX19 knockout plasmid can be transformed into Agrobacterium by liquid nitrogen freezing, and the positive Agrobacterium single bacterial liquid can be transferred into cotton recipients by hypocotyl-mediated transformation to screen and obtain GhNCX19 gene knockout cotton, thereby increasing cotton fiber length.

[0036] In a specific embodiment of the present invention, the Escherichia coli is Escherichia coli DH5α, the Agrobacterium is Agrobacterium GV3101, and the cotton receptor may be Jin668.

[0037] Compared with the prior art, the present invention has the following beneficial effects:

[0038] The present invention reports for the first time the function of the sodium-calcium exchanger gene GhNCX19 in cotton fiber development. The GhNCX19 gene was overexpressed in cotton by transgenic technology and knocked out by CRISPR / Cas9, and it was found that the 0DPA ovule epidermal cell protrusion number density of the overexpression strain was significantly reduced compared with the wild type (WT), while the number of ovule epidermal protrusions in the knockout strain was significantly increased; the mature fiber length in the overexpression cotton strain was significantly shorter than that of the WT, while the fiber length of the knockout strain was significantly longer than that of the WT. The above results show that GhNCX19 can negatively regulate the initiation and elongation of cotton fiber development, and long-fiber cotton can be constructed by knocking out the expression of the GhNCX19 gene, increasing the length of cotton fibers, and providing important gene resources and new breeding materials for cultivating high-quality cotton. BRIEF DESCRIPTION OF THE DRAWINGS

[0039] Figure 1 Analysis of the expression pattern of GhNCX19 gene. a is the transcriptome expression pattern of GhNCX19 gene in various tissues and organs and cotton fiber stages; b is the qRT-PCR identification result.

[0040] Figure 2 The amplification and overexpression vector construction of GhNCX19 gene. In which, a is the amplification of GhNCX19 gene; the molecular weight standard of Figure a is DNAmarker III, and the length of the target gene amplification fragment is 1779bp; b is the schematic diagram of the construction of the GhNCX19 gene overexpression vector.

[0041] Figure 3 Identification of positive individual plants of cotton materials with overexpression of GhNCX19 gene. Among them, a is the identification of NPTII gene of each individual plant, WT is used as control (specific primer extension 795bp); b is the identification of target gene overexpression of each individual plant (specific primer extension 519bp). D2000 marker, numbers represent the number of each individual plant; CK: overexpression positive plasmid; WT: transgenic cotton receptor wild type Jin668.

[0042] Figure 4 Schematic diagram of GhNCX19 gene editing target design and vector construction. Among them, a is a schematic diagram of the dual sgRNA target designed for the target gene GhNCX19; b is a schematic diagram of the construction of the pRGEB32-GhU6.9-NPTII gene editing vector.

[0043] Figure 5 The results of sequencing and alignment of two sgRNA target sites of the GhNCX19 gene in the transformed cotton recipient material Jin668.

[0044] Figure 6This is the identification of positive plants and detection of mutation sites in T0 generation GhNCX19 gene knockout cotton. Among them, a is the identification of NPTII gene of each plant, WT is used as control (specific primer extension 795bp); b is the identification of Cas9 gene of some plants (specific primer extension 827bp); c is the detection of mutation sites of gene editing of positive Cas9 plants, where lowercase letter n indicates no mutation site, + indicates insertion of base, and - indicates deletion of base. D2000 marker, numbers represent the number of each plant; CK: pRGEB32 empty plasmid; WT: wild-type cotton material Jin668.

[0045] Figure 7 Phenotypic identification of GhNCX19 transgenic lines. Among them, a is the electron microscopic observation of epidermal cell protrusions of 0DPA ovules in T3 generation (in a, upper bar = 500μm, lower bar = 200μm); b is the comparison of mature fiber lengths of GhNCX19 transgenic lines in T3 generation (bar = 1cm); c is the statistical analysis of the number of epidermal cell protrusions of 0DPA ovules in T3 generation (at least 15 ovules were observed for each line); d is the comparison of mature fiber length measurements of GhNCX19 transgenic lines in T3 generation (at least 30 seed fibers were measured for each line). The significance of the differences was analyzed by two-tailed t-test, and the data lines represent mean ± SD, *P < 0.05, **P < 0.01. DETAILED DESCRIPTION

[0046] The present invention is further described in detail below in conjunction with the accompanying drawings and specific examples of the specification. The examples are only used to explain the present invention and are not used to limit the scope of the present invention. The test methods used in the following examples are conventional methods unless otherwise specified; the materials and reagents used are reagents and materials that can be obtained from commercial channels unless otherwise specified.

[0047] Example 1 Analysis of GhNCX19 gene expression pattern

[0048] RNA-seq data of various tissues and fiber development stages of cotton were downloaded from the NCBI (https: / / www.ncbi.nlm.nih.gov / ) website (accession number: PRJNA248163), and data including roots, stems, leaves, bracts, petals, stamens, pistils, calyx, and ovules at -3, -1, 0, 1, and 3 DPA (day post anthesis) and fiber data at 5 to 30 DPA were extracted. The FPKM value (fragments per kilobase of transcript per million mapped reads) of the target gene GhNCX19 in various tissues, organs and fiber development stages was extracted.

[0049] Transcriptome analysis showed that this gene was highly expressed during the -3 to 1 DPA period of fiber development ( Figure 1 a).

[0050] The nucleotide sequence of the GhNCX19 gene is shown in SEQ ID NO: 1, with a total length of 1737 bp; the amino acid sequence of the protein encoded by the GhNCX19 gene is shown in SEQ ID NO: 2, with a total length of 579 aa.

[0051] Using the upland cotton genetic standard line TM-1 as the material, the flowers were marked on the day of flowering (0 DPA), and the ovules at -3, -1, 0, 1, 3 and 5 DPA and the fibers at 7, 10, 15, 20 and 30 DPA were collected in sequence; in addition, cotton tissue samples at different developmental stages, including roots, stems and true leaves at the seedling stage (two leaves and one heart stage), and petals, stamens, pistils, sepals and bracts at the mature stage were sampled as test samples. All samples to be tested were immediately frozen in liquid nitrogen and stored in a -80°C refrigerator for later use. RNA was extracted from all the above samples to be tested, and then reversed into cDNA for qRT-PCR analysis. Using GhUBQ7 as the internal reference gene, the qRT-PCR method was used to further identify the expression pattern of the GhNCX19 gene in different tissues and fiber development stages. The cDNA of each sample to be tested was diluted 5 times and used as a template. The qRT-PCR detection was performed using TaKaRa's TB Premix Ex Taq TM The PCR was performed using the Tli RNaseH Plus kit on an Applied Biosystems QuantStudio 5 Real-Time PCR System.

[0052] The primer sequences used for qRT-PCR in Example 1 are shown in Table 1, and the qRT-PCR reaction system is as described in Table 2 (20 μL).

[0053] Table 1

[0054] Primer name Primer sequence (5' to 3') GhNCX19-qF CCTTACCTCCTCCTTAAACCTC GhNCX19-qR GAACAATCCTCCAACAATACCG Q7 GACCTACACCAAGCCCAAGAAG Q7 TGAGCCCACACTTACCACAATAGT

[0055] Table 2

[0056] Components volume TB Green Premix Ex Taq(Tli RNaseH Plus)(2X) 10μL Primer ±0.5μL ROX Reference Dye II (50X) 0.4μL cDNA (5-fold dilution) 5μL Sterilized water 3.6μL

[0057] In Table 2, except for the cDNA template which was added separately, the other reaction systems were pre-prepared into mixed solutions and then added to the qPCR tubes to reduce experimental errors.

[0058] Reaction procedure: pre-denaturation at 95°C for 30 s; 95°C for 5 s, 60°C for 30 s, 40 cycles. Each sample was repeated three times biologically and three times technically. -ΔΔCT Methods Relative gene expression levels were calculated.

[0059] The results showed that the GhNCX19 gene was dominantly expressed in -3 and -0 DPA ovules, which was basically consistent with the transcriptome results ( Figure 1 b).

[0060] The above results indicate that the GhNCX19 gene may play an important role in cotton fiber development.

[0061] Example 2 GhNCX19 gene amplification and overexpression vector construction

[0062] 1. Double digest the PRI101-AN overexpression empty vector with Sal I and EcoR I endonucleases, recover and purify to obtain the linearized PRI101 overexpression vector for later use.

[0063] 2. Using the cDNA of the 0DPA ovule of the upland cotton genetic standard line TM-1 as a template, the GhNCX19 gene was amplified using Takara's GXL high-fidelity enzyme system by designing gene-specific primers (as shown in Table 3) to obtain an amplified product. The amplification system is shown in Table 4, and the amplification program is: 98°C, 5min; 98°C, 10s, 56°C, 15s, 68°C, 30s, 35 cycles; 68°C, 10min; 4°C, ∞.

[0064] Table 3

[0065]

[0066] Table 4

[0067] composition Volume / μL template 1 Forward primer (10 μM) 1.5 Reverse primer (10 μM) 1.5 5×Buffer 10 2.5 mM deoxyribonucleoside triphosphates (dNTPs) 4 GXL High Fidelity Enzyme 1 <![CDATA[ddH2O]]> 31 Total volume 50

[0068] 3. After the amplified fragment meets the expected target size through electrophoresis detection ( Figure 2 a), all the amplified products were excised and purified, and the linearized PRI101-AN overexpression vector was connected according to the ClonExpress MultiS One Step Cloning Kit (non-ligase-dependent multi-fragment one-step cloning technology) (C113) of Nanjing Novogene Biotech Co., Ltd. to obtain the PRI101-GhNCX19 overexpression recombinant plasmid ( Figure 2 b).

[0069] 4. The PRI101-GhNCX19 overexpression recombinant plasmid was heat-shock transformed into Escherichia coli DH5α to obtain Escherichia coli DH5α transformed with the PRI101-GhNCX19 overexpression recombinant plasmid, which was spread on 50 μg / mL kanamycin resistance LB (Luria-Bertani) plate culture medium, inverted and cultured at 37°C overnight, and the recombinant monoclonal strain was picked and incubated in LB liquid culture medium containing 50 μg / mL kanamycin resistance at 200 rpm at 37°C for more than 12 h. The bacterial liquid was collected and PCR amplified (the primers used are shown in Table 5), and the target band was detected by electrophoresis and then sequenced.

[0070] The bacterial solution PCR amplification system is shown in Table 6 below, and the reaction procedure is: 94°C, 5min; 94°C, 30s, 55°C, 30s, 72°C, 1min, 35 cycles; 72°C, 10min; 4°C, ∞. The bacterial solution with correct sequencing was selected for amplification and plasmid extraction, and then further transferred into Agrobacterium GV3101 by liquid nitrogen freeze-thaw method to obtain Agrobacterium GV3101 containing PRI101-GhNCX19 overexpression recombinant plasmid for standby use.

[0071] Table 5

[0072] Primer name Primer sequence (5' to 3') PR101-35SF ACTGACGTAAGGGATGACGC PR101-35SR AGCTCGGTAGCAATTCCCGA

[0073] Table 6

[0074]

[0075] Example 3 Identification of positive strains of GhNCX19 overexpressing cotton materials

[0076] The bacterial liquid of Agrobacterium GV3101 containing the PRI101-GhNCX19 overexpression recombinant plasmid in Example 2 was transferred into the cotton recipient material Jin668 by the hypocotyl-mediated transformation method, and the T0 generation cotton transformant single plant was obtained. DNA was extracted, and the kanamycin gene (NPTII) and the overexpressed GhNCX19 gene were identified to obtain the GhNCX19 gene overexpressing cotton. The primers are shown in Table 7, and the PCR amplification reaction system is shown in Table 6.

[0077] Among the 13 transformant plants, 12 positive plants containing the NPTII gene were identified ( Figure 3 a), 8 positive strains containing GhNCX19 gene overexpression ( Figure 3 b).

[0078] The seeds of the T0 generation individual plants of the GhNCX19 gene overexpressing cotton were collected after self-pollination, and then preserved through self-pollination year by year to harvest the seeds of the T3 generation homozygous plant lines of the GhNCX19 gene overexpressing cotton.

[0079] Table 7

[0080]

[0081] Example 4 GhNCX19 gene editing sgRNA target design and CRISPR / Cas9 gene editing vector construction

[0082] To further study the function of the GhNCX19 gene in cotton fiber development, the CRISPR / Cas9 gene editing system was used to mutate the GhNCX19 gene to obtain GhNCX19 gene knockout mutant cotton plants.

[0083] 1. First, two sgRNA target sequences were designed in the exon region of the GhNCX19 gene, both of which were the reverse complementary sequences of the GhNCX19 gene and were located in the seventh exon region of the GhNCX19 gene ( Figure 4 a), wherein the sgRNA1 sequence is: 5'-CCTCTGCTTATCGGTTTTCT-3' (SEQ ID NO: 3); the sgRNA2 sequence is: 5'-TTCTCGTTGGGGCTCGTATA-3' (SEQ ID NO: 4).

[0084] Secondly, the sgRNA target was designed based on the publicly released genome sequence of the upland cotton genetic standard line material TM-1. It is necessary to further perform target sgRNA target sequence consistency detection in the upland cotton recipient material Jin668 to be transformed.

[0085] Using wild-type Jin668 material DNA as a template, Takara's GXL high-fidelity enzyme and target gene fragment specific primers were used to amplify the gene fragment DNA including the sgRNA target sequence (primers used are shown in Table 7) to obtain PCR products. The PCR product was purified and recovered after the band was detected correctly by electrophoresis, connected to the TA cloning vector with pEASY-Blunt Cloning Vector (CB101, Beijing Quanshijin Biotechnology Co., Ltd.), and heat-shocked into Escherichia coli DH5α to obtain Escherichia coli DH5α transformed with sgRNA sequence, which was smeared on 50μg / mL kanamycin-resistant LB plate medium, inverted and cultured at 37°C overnight, and recombinant monoclonal colonies were picked and shaken at 37°C and 200rpm in a shaker in a LB liquid medium containing 50μg / mL kanamycin resistance for more than 12h, and the bacterial solution was collected for PCR amplification (primers are shown in Table 8, and the PCR amplification reaction system is shown in Table 6). After detecting the target band, the bacterial solution was sequenced.

[0086] The sequencing results were compared with the reference sequence, and the results showed that the target sgRNA sequence in the genetic transformation recipient material Jin668 was consistent with the target sequence designed based on the genome reference sequence of the upland cotton genetic standard line TM-1 ( Figure 5 ), indicating that the sgRNA target site designed in the present invention is suitable for the construction of subsequent gene editing vectors and cotton genetic transformation.

[0087] Table 8

[0088] Primer name Primer sequence (5' to 3') sgNCX19-PF GTTCGTTTCGTGTTACTCCAC sgNCX19-PR GTCCCTCTGATATGCAATGTCT

[0089] 2. Based on the above sequence consistency test, the pGTR4 plasmid containing tRNA and gRNA Scaffold sequences was further used as a template to amplify fragments such as tRNA-sgRNA1 and gRNA scaffold-tRNA-sgRNA2. The primers used are shown in Table 9.

[0090] The nucleotide sequence of the tRNA is:

[0091] 5'-AACAAAGCACCAGTGGTCTAGTGGTAGAATAGTACCCTGCCACGGTACAGACCCGGGTTCGATTCCCGGCTGGTGCA-3' (SEQ ID NO: 5);

[0092] The nucleotide sequence of the tRNA-sgRNA1 is:

[0093] 5'-AACAAAGCACCAGTGGTCTAGTGGTAGAATAGTACCCTGCCACGGT ACAGACCCGGGTTCGATTCCCGGCTGGTGCACCAAGAAAACCGATAAGCA G-3' (SEQ ID NO: 6)

[0094] The nucleotide sequence of the gRNA scaffold is: 5'-GTTTTAGAGCTAGAAATAGCAA GTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGG TGC-3' (SEQ ID NO: 7).

[0095] The nucleotide sequence of the gRNA scaffold-tRNA-sgRNA2 is:

[0096] 5'-GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATC AACTTGAAAAAGTGGCACCGAGTCGGTGCAACAAAGCACCAGTGGTCTAG TGGTAGAATAGTACCCTGCCACGGTACAGACCCGGGTTCGATTCCCGGCTG GTGCATATACGAGCCCCAACGAGAA-3' (SEQ ID NO: 8)

[0097] tRNA-sgRNA1 is composed of tRNA and sgRNA1 connected, with tRNA and sgRNA1 in order from the 5' end to the 3' end.

[0098] gRNA scaffold-tRNA-sgRNA2 is composed of gRNA scaffold, tRNA and sgRNA1 connected together, with gRNA scaffold, tRNA and sgRNA1 from the 5' end to the 3' end.

[0099] Table 9

[0100]

[0101] A dual-target CRISPR / Cas9 gene editing vector was constructed based on the pRGEB32-GhU6.9-NPTII vector.

[0102] The pRGEB32-GhU6.9-NPTII vector was linearized by double restriction digestion with Bsa I endonuclease, and the linearized pRGEB32-GhU6.9-NPTII vector was obtained after recovery and purification for later use.

[0103] According to the ClonExpress MultiS One Step Cloning Kit (non-ligase-dependent multi-fragment one-step cloning technology) (C113) of Nanjing Novogene Biotechnology Co., Ltd., RNA-sgRNA1 and gRNAscaffold-tRNA-sgRNA2 fragments were concatenated and inserted into the BsaI site of the linearized pRGEB32-GhU6.9-NPTII vector ( Figure 4 b), and obtain the pRGEB32-GhNCX19 knockout plasmid.

[0104] The constructed pRGEB32-GhNCX19 knockout plasmid was heat-activated and transformed into competent Escherichia coli DH5α to obtain Escherichia coli DH5α transformed with the pRGEB32-GhNCX19 knockout plasmid, and spread on an LB plate medium containing 50 μg / mL kanamycin resistance, inverted and cultured at 37°C overnight, picked the recombinant monoclonal colony, and incubated in an LB liquid medium containing 50 μg / mL kanamycin resistance at 37°C and 200 rpm for more than 12 hours, collected the bacterial liquid, and performed PCR amplification (primers used are shown in Table 10, and PCR amplification reaction system is shown in Table 6), and sequenced after electrophoresis detection of the target band.

[0105] After correct sequencing, the plasmid was extracted, and the pRGEB32-GhNCX19 knockout plasmid was transformed into Agrobacterium GV3101 by liquid nitrogen freezing method, and the positive Agrobacterium single bacterial liquid was transferred into cotton recipient material Jin668 by hypocotyl-mediated transformation method to screen and obtain GhNCX19 gene knockout cotton.

[0106] Table 10

[0107] Primer name Primer sequence (5' to 3') pG32-U6-9F CTTCGGGGACATACTTCAGG pG32-Ubi2R TGTTGGTCGCCGTTAGGACC

[0108] Example 5 Identification of target site mutation types in GhNCX19 gene knockout cotton plants

[0109] 1. Experimental Methods

[0110] DNA of 23 T0 generation GhNCX19 knockout cotton plants obtained in Example 4 was extracted, and specific primers were used to identify NPTII and Cas9 genes (NPTII gene primers are shown in Table 7, Cas9 gene primers are shown in Table 10, and PCR amplification reaction system is shown in Table 6). 21 positive strains containing NPTII gene were identified, with a positive strain rate of 91.3%, of which 7 positive strains contained Cas9 gene ( Figure 6 a and Figure 6 b).

[0111] Table 10

[0112] Primer name Primer sequence (5' to 3') Cas9-787F AATCTGATCGCCCAGCTGCCC Cas9-1550R GAAGTTCCAGGGGGTGATGGT

[0113] In order to further identify whether the target site in the transgenic cotton plants with GhNCX19 gene knockout was edited, PCR amplification and sequencing were used to detect the changes in the nucleotide sequence including the target site.

[0114] The single strains in which both NPTII gene and Cas9 gene were positive were selected for further PCR amplification of the target gene mutation site region using Takara's GXL high-fidelity enzyme. The amplification system is shown in Table 4, and the amplification program is: 98°C, 5min; 98°C, 10s, 56°C, 15s, 68°C, 30s, 35 cycles; 68°C, 10min; 4°C, ∞. After the obtained PCR product was detected by electrophoresis with the correct band, it was purified and recovered, connected to the TA cloning vector with pEASY-Blunt Cloning Vector (CB101, Beijing Quanshijin Biotechnology Co., Ltd.), heat-activated and transformed into Escherichia coli DH5α, and spread on LB plate culture medium containing 50 μg / mL kanamycin resistance, inverted and cultured at 37°C overnight, and the recombinant monoclonal colony was picked and incubated in LB liquid culture medium containing 50 μg / mL kanamycin resistance at 37°C and 200 rpm for more than 12 hours. The bacterial liquid was collected and PCR amplified (PCR amplification reaction system is shown in Table 6). After electrophoresis detection of the target band, the single colony was sequenced, and the sequencing results were compared with the reference sequence to identify the mutation type of the target target site.

[0115] 2. Experimental Results

[0116] The results showed that there were 4 strains with gene editing mutation sites (m5, m11, m14 and m18), and the mutation types included base insertion, deletion and large fragment duplication insertion ( Figure 6 c).

[0117] Among them, the mutation of the m5 strain occurred in the At subgroup of the GhNCX19 gene, with a deletion of one base in the sgRNA1 target region, while no base mutation occurred in the sgRNA2 target site region (-1 / nbp).

[0118] The mutation of the m11 strain occurred in the Dt subgroup. No base mutation occurred in the sgRNA1 target site region, while there was an insertion of 1 base (n / +1bp) in the sgRNA2 target site region.

[0119] The mutation of strain m14 occurred in the Dt subgroup. The mutation type of this strain was relatively special, with a large insertion of 204 bp. The sequencing results showed that the inserted fragment was a repeated fragment between the sgRNA1 target region and the sgRNA2 target region.

[0120] The mutation of the m18 strain occurred simultaneously in the At and Dt subgroups of the gene, with a one-base insertion in the sgRNA1 target region and a two-base deletion (+1 / -2bp) in the sgRNA2 target region.

[0121] The above materials were self-pollinated and planted continuously year by year, and the mutation sites of target genes were identified in each gene knockout strain generation by generation.

[0122] Example 6 Phenotypic observation and identification of GhNCX19 transgenic cotton materials

[0123] 1. Experimental Methods

[0124] Further, the ovules of the T3 generation GhNCX19 gene overexpression cotton of Example 3 and the T3 generation GhNCX19 gene knockout cotton of Example 5 were sampled at the 0DPA period, and the wild-type WT cotton material was used as the control. After fixation and dehydration, the ovules of each cotton material were observed by scanning electron microscopy, and the number of ovule epidermal protrusions per unit area was counted and analyzed. In addition, the mature fiber length of each material was further sampled, and the fiber length was measured and statistically analyzed.

[0125] 2. Experimental Results

[0126] like Figure 7 a and Figure 7 As shown in c, the number of epidermal cell protrusions in the ovules of GhNCX19 gene overexpressing cotton lines was significantly lower than that in the WT type, while the number of epidermal cell protrusions in the ovules of GhNCX19 gene knockout cotton lines was significantly or extremely significantly higher than that in the WT type. The results indicated that the GhNCX19 gene played a negative regulatory role in the initiation of cotton fiber development.

[0127] like Figure 7 b and Figure 7 As shown in Figure d, the mature fiber length of each cotton line with GhNCX19 gene overexpression was significantly shorter than that of WT material, while the mature fiber length of each cotton line with GhNCX19 gene knockout was significantly longer than that of WT. The results indicate that the GhNCX19 gene also negatively regulates the elongation of cotton fibers.

[0128] In summary, the GhNCX19 gene plays a negative regulatory role in cotton fiber development.

[0129] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention rather than to limit the protection scope of the present invention. For ordinary technicians in this field, other different forms of changes or modifications can be made based on the above descriptions and ideas. It is not necessary and impossible to list all the implementation methods here. Any modifications, equivalent substitutions and improvements made within the spirit and principles of the present invention should be included in the protection scope of the claims of the present invention.

Claims

1. An application of a sodium-calcium exchanger encoding gene GhNCX19 in improving cotton fiber length or cultivating new germplasm with significantly improved cotton fiber quality; the nucleotide sequence of the sodium-calcium exchanger encoding gene GhNCX19 is shown in SEQ ID NO: 1, and the amino acid sequence of the encoded protein is shown in SEQ ID NO:

2.

2. A recombinant vector, characterized in that: The recombinant vector contains sgRNA editing sites sgRNA1 and sgRNA2; The nucleotide sequence of the sgRNA1 is shown in SEQ ID NO: 3; The nucleotide sequence of the sgRNA2 is shown in SEQ ID NO:

4.

3. The recombinant vector according to claim 2, characterized in that The recombinant vector contains a tRNA-sgRNA1 fusion and a gRNA scaffold-tRNA-sgRNA2 fusion; The tRNA-sgRNA1 fusion is connected to sgRNA1, and the nucleotide sequence of the tRNA-sgRNA1 fusion is shown in SEQ ID NO: 6; The gRNA scaffold-tRNA-sgRNA2 fusion is connected to sgRNA2, and the nucleotide sequence of the gRNA scaffold-tRNA-sgRNA2 fusion is shown in SEQ ID NO:

8.

4. The recombinant vector according to claim 3, characterized in that The 3' end of the tRNA-sgRNA1 fusion is connected to the 5' end of the gRNA scaffold-tRNA-sgRNA2 fusion.

5. The recombinant vector according to any one of claims 2 to 4, characterized in that The recombinant vector uses pRGEB32-GhU6.9-NPTII vector as a backbone vector.

6. The recombinant vector according to claim 5, characterized in that The tRNA-sgRNA1 fusion and gRNAscaffold-tRNA-sgRNA2 fusion were ligated between the BsaI sites of the pRGEB32-GhU6.9-NPTII vector.

7. A recombinant engineered bacterium, characterized in that: The recombinant engineered bacteria express the recombinant vector according to any one of claims 2 to 6.

8. A method for increasing the length of cotton fibers, characterized in that: Reducing the expression level of the sodium-calcium exchanger encoding gene GhNCX19 in cotton can increase the length of cotton fibers.

9. The method according to claim 8, characterized in that The recombinant vector according to any one of claims 2 to 6 or the recombinant engineered bacteria according to claim 7 is used to reduce the expression level of the sodium-calcium exchange protein encoding gene GhNCX19 in cotton.

10. A method for cultivating long-fiber cotton, characterized in that: Reducing the expression level of the sodium-calcium exchanger encoding gene GhNCX19 in cotton can increase the length of cotton fibers.

Images