Construction method and application of RagC mutant drosophila melanogaster
The construction of transgenic fruit flies with different mutant RagCs through transgenic binding to gene knockout has solved the problem that the existing technology is difficult to effectively construct and study RagC mutant fruit flies, and achieved the goal of providing effective tools and materials for studying the disease occurrence mechanism and drug screening caused by RagC gene mutations.
Patent Information
- Application Number
- CN202510086502.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-01-20
- Publication Date
- 2025-04-08
AI Technical Summary
The existing technology is difficult to effectively construct and study the RagC mutant fruit flies, which leads to difficulties in studying the disease occurrence mechanism and drug screening caused by RagC gene mutations.
Transgenic fruit flies with different mutant RagC types were constructed through transgenic binding knockout methods, including RagC gene deletion mutants and RagC transgenic fruit flies with different active forms.
The acquisition of stable inherited RagC gene deletion flies and different active forms of RagC transgenic fruit flies provides effective tools and materials for in-depth study of the disease occurrence mechanism and drug screening caused by RagC gene mutations.
Smart Images
Figure CN119776433A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the field of biotechnology, and in particular to a construction method and application of a RagC mutant fruit fly. Background Art
[0002] As a classic model organism, Drosophila has the advantages of simple genome and convenient genetic manipulation. Studies have shown that about 75% of human disease-related genes have homologous genes in Drosophila. Therefore, Drosophila plays an important role in gene function research, disease mechanism exploration, biomedicine development and other fields. Rag GTPases are highly conserved key complexes that sense intracellular amino acid levels and regulate cell growth and metabolism. In mammals, Rag GTPases mainly include four proteins: RagA, RagB, RagC, and RagD, among which RagA and RagB are homologous; RagC and RagD are homologous. Rag GTPase functions in the form of a dimer formed by RagA or RagB (RagA / B) and RagC or RagD (RagC / D). Therefore, there are four possible compositions of Rag GTPases in mammals, with gene redundancy, and the research is relatively complicated. When amino acids are sufficient, Rag GTPases are formed, in which RagA / B binds to GTP and RagC / D binds to GDP, which have the ability to promote mTORC1 activity and thus promote cellular anabolism; when amino acids are deficient, RagGTPases, in which RagA / B binds to GDP and RagC / D binds to GTP, inhibit mTORC1 activity and thereby activate cellular autophagy.
[0003] There are only two members of Rag GTPases in Drosophila: RagA and RagC. They have only one dimer RagGTPase composition form and have similar regulatory mechanisms and functions to those of mammals. Therefore, Drosophila has a unique advantage in studying the functions and regulatory mechanisms of RagGTPases. Although RagA and RagC have similar structures and form RagGTPases with different activities through different GDP / GTP combinations, their roles in regulating cell metabolism are quite different: RagA / B binds to GTP or GDP to affect cell growth, while RagC / D binds to GTP or GDP to affect the activity of transcription factors that regulate lysosomes. Studies have found that the occurrence of many human diseases is related to mutations in the Rag gene or upstream genes that regulate the activity of Rag GTPases. Clinically, there are few RagA / B mutation sites that are directly related to the disease, and only the Leu60 site has been found so far; while there are many RagC / D mutation sites, such as Ser75, Thr90, Tyr115, Asp116, Pro118, Gly119 and other sites. The establishment of transgenic fruit flies expressing RagC mutant protein can provide a basis for clarifying the disease mechanism caused by RagC mutant protein and provide ideas and tools for clinical intervention and drug target screening.
[0004] The preparation of gene deletion mutations or transgenic animals is an important method to explore the physiological function and mechanism of action of the target gene in animals. The gene deletion method can completely inactivate the function of the target gene, but may result in a lethal phenotype, making further research impossible; using transgenic methods to express a target protein with mutations at key sites in animals may result in the functional changes of the mutant protein not showing a corresponding phenotype due to the presence of endogenous wild-type protein. Summary of the invention
[0005] In view of the above-mentioned problems of only preparing gene deletion mutations or transgenic animals, the present invention provides a method for constructing a RagC mutant fruit fly and its application. By combining transgenic with gene knockout, transgenic fruit flies with different mutant types of RagC are obtained, providing materials for in-depth research on the disease mechanism caused by RagC gene mutation and drug screening.
[0006] In order to achieve the above object, the present invention provides a method for constructing a RagC mutant fruit fly, which comprises the following steps: Construction of S1 and RagC gene deletion mutant Drosophila S1.1 Insert the expression sequences of the gRNA designed at both ends of the RagC gene coding region into the vector plasmid to obtain the ligation plasmid; S1.2 The ligated plasmid was introduced into Drosophila embryos expressing Cas9 protein, and then hybridized with Drosophila with SM6 balance chromosome on chromosome 2 to identify and screen RagC - / SM6 heterozygous fruit flies are RagC gene deletion mutant fruit flies; Construction of S2 and RagC transgenic flies The coding sequence of the RagC gene that binds GTP and GDP is inserted into the UASp expression plasmid, and the expression plasmid is introduced into the white-eyed fruit fly embryo that expresses the recombinase, and the fruit fly is hybridized and screened with the fruit fly with the balance chromosome to obtain the RagC transgenic fruit fly; Construction of S3 and RagC mutant flies The RagC gene deletion mutant fruit flies constructed in step S1 are crossed with the RagC transgenic fruit flies constructed in step S2 to obtain fruit flies that only express the mutant form of RagC protein.
[0007] Specifically, in step S1.1, a gRNA is designed at the 288th base and the 1533th base of the RagC gene.
[0008] Furthermore, in step S1.1, the construction method of the connection plasmid is: respectively annealing the forward and reverse primers at the 288th base and the 1533th base to form double strands, then connecting the annealed double strands to the vector respectively to obtain the vector plasmid, and finally connecting the two vector plasmids to obtain the connection plasmid; The forward and reverse primers at base 288 and base 1533 are as follows: RagC gRNA site 288-F:CTTCGACACGTTCCCCAAGGACTT RagC gRNA site 288-R:AAACAAGTCCTTGGGGAACGTGTC RagC gRNA site 1533-F: CTTCGAGCAGACCCTGATTCGCCA RagC gRNA site 1533-R: AAACTGGCGAATCAGGGTCTGCTC.
[0009] Preferably, the vector is a pBFv U6.2 vector.
[0010] Specifically, in step S1.2, the identification method is: after hybridizing the fruit flies collected by hybridization with sp / SM6 fruit flies, genomic DNA is extracted and PCR identification is performed. The identification primer sequences are as follows: RagC identification primer F: CCCACCCCCAAAACCAGAAT RagC identification primer R:TGTGAGAGTGGCGTCCTAAC The product of about 500 bp was screened and amplified, which was RagC - / SM6 heterozygous flies.
[0011] Specifically, in step S2, the threonine at position 69 of the RagC gene is mutated to asparagine so that it can bind to GDP; and the glutamine at position 99 of the RagC gene is mutated to leucine so that it can bind to GTP.
[0012] Further preferably, in step S2, the method of inserting the coding region sequences of the RagC gene binding to GTP and GDP into the UASp expression plasmid is: S2.1 Amplify the coding region of the RagC gene and insert the RagC coding region into the UASp-attB vector to obtain the UASp-RagC-wt plasmid. The primer sequences are as follows: RagC coding-F:ATTCGTTAACAGATCTGCGGCCGCatgagctacgatgatgatgac RagC coding-R: GCGGCCTCCACCGCGGGGTACctg attaattggctgcgctcgc; S2.2 The fragment was amplified by combining RagC coding-F and RagC-T69N-R as primers and using Drosophila cDNA as template; the fragment was amplified by combining RagC coding-R and RagC-T69N-F as primers and using Drosophila cDNA as template; the two DNA fragments were recovered by electrophoresis, mixed, and used as templates to amplify the coding region of RagC-T69N with A298T mutation using RagC coding-F and RagC coding-R as primers, and inserted into the UASp-attB vector to obtain the UASp-RagC-T69N plasmid; the UASp-RagC-Q99L plasmid was obtained by the same method; wherein RagC-T69N-Fgccgaacgagaacctcttcctgg RagC-T69N-Rccaggaagaggttctcgttcggc RagC-Q99L-Fttccccggcctgattgacttcttc RagC-Q99L-Rgaagaagtcaatcaggccggggaa; S2.3 Inject UASp-RagC-wt plasmid, UASp-RagC-T69N plasmid, and UASp-RagC-Q99L plasmid into the early embryos of attp2 fruit flies respectively. After they develop into adults, they are hybridized with fruit flies carrying the TM6 balance chromosome on chromosome 3. Red-eyed fruit flies are selected from the offspring, which are the corresponding transgenic fruit flies.
[0013] The second aspect of the present invention provides the use of the RagC mutant fruit fly constructed by the above construction method in screening drugs for treating diseases caused by RagC gene mutation.
[0014] Through the above technical solution, the present invention achieves the following beneficial effects: The present invention introduces guide RNA targeting the RagC gene into fruit fly embryos, and screens and obtains RagC gene-deficient fruit flies that can be stably inherited by hybridization with fruit flies with balanced chromosomes; introduces plasmids expressing RagC proteins with different activities into fruit fly embryos, and obtains RagC transgenic fruit flies with different active forms by hybridization screening; and hybridizes RagC transgenic fruit flies with RagC gene-deficient fruit flies to obtain transgenic fruit flies expressing only mutant RagC but no wild-type RagC protein, thereby providing a basis for clarifying the disease mechanism caused by RagC mutant protein and providing ideas and tools for clinical intervention and drug target screening. BRIEF DESCRIPTION OF THE DRAWINGS
[0015] Figure 1 is the result of PCR identification of Drosophila in Example 1 of the present invention; Figure 2 This is the nuclear entry status of Mitf in Example 3 of the present invention. DETAILED DESCRIPTION
[0016] The specific embodiments of the present invention are described in detail below. It should be understood that the specific embodiments described herein are only used to illustrate and explain the present invention, and are not used to limit the present invention.
[0017] Example 1: Construction of Drosophila with RagC gene deletion A gRNA was designed at the 288th and 1533rd bases of the RagC gene. Based on the gRNA sequence, a pair of complementary primers were synthesized, and the BbsⅠ restriction end sequence was added to the 5' end of the primer. The primer sequence is as follows: RagC gRNA site 288-F: CTTC GACACGTTCCCCAAGGACTT RagC gRNA site 288-R:AAAC AAGTCCTTGGGGAACGTGTC RagC gRNA site 1533-F: CTTC GAGCAGACCCTGATTCGCCA RagC gRNA site 1533-R:AAAC TGGCGAATCAGGGTCTGCTC.
[0018] Anneal the forward and reverse primers at the 288th base: 10 μL forward primer (10 μM), 10 μL reverse primer (10 μM), 80 μL deionized water, react at 80°C for 5 minutes, then slowly lower the temperature to 20°C to allow the forward and reverse primers to renature to form double strands.
[0019] 1 μg of pBFv U6.2 vector was digested with endonuclease BbsⅠ, and the product was subjected to agarose electrophoresis, cut, and recovered using a gel recovery kit. The product was then eluted with 30 μL of deionized water to recover the product.
[0020] Take 4 μL of pBFv U6.2 vector recovered after restriction digestion, 4 μL of double-stranded DNA, 1 μL of T4 DNA ligase, and 1 μL of reaction buffer, mix well, and incubate at 16°C overnight. Transform the ligated plasmid into DH5α competent Escherichia coli, culture it in a plate medium containing ampicillin for 16 hours, pick a single clone for sequencing, and obtain the pBFv U6.2 RagC-288 plasmid.
[0021] Using similar methods and steps, the gRNA expression sequence at base 1533 was inserted into the pBFv U6.2B vector to obtain the pBFv U6.2B RagC-1533 plasmid.
[0022] The pBFv U6.2 RagC-288 plasmid was digested with EcoRⅠ and NotⅠ and then electrophoresed. A fragment of about 600 bp was taken for gel recovery and the product was washed off with 30 μL deionized water. The pBFvU6.2B RagC-1533 plasmid was digested with EcoRⅠ and NotⅠ and then electrophoresed. A fragment of about 5000 bp was taken for gel recovery and the product was washed off with 30 μL deionized water. Take 4 μL of pBFv U6.2 RagC-288 fragment recovered by digestion, 4 μL of pBFvU6.2B RagC-1533 fragment recovered by digestion, 1 μL T4 DNA ligase, and 1 μL reaction buffer, mix well, and incubate at 16℃ overnight. The ligated plasmid was transformed into DH5α competent E. coli and cultured in a plate medium containing ampicillin for 16 hours. A single clone was selected for sequencing to obtain the pBFv U6.2 RagC-288-U6.2B-RagC-1533 plasmid. Purify the pBFv U6.2 RagC-288-U6.2B-RagC-1533 plasmid using an endotoxin-free kit, and use a microinjector to inject the plasmid into the early embryos of nos-Cas9 fruit flies (within 2 hours of egg laying). Wait for about 10 days for the fruit fly embryos to develop into adults, then hybridize with fruit flies with SM6 balance chromosomes on chromosome 2, collect offspring fruit flies with curled wing phenotypes (from SM6 balance chromosomes), hybridize the collected fruit flies with sp / SM6 fruit flies, extract genomic DNA, and perform PCR identification. The identification primer sequences are as follows: RagC identification primer F: CCCACCCCCAAAACCAGAAT RagC identification primer R:TGTGAGAGTGGCGTCCTAAC Using this primer, a product of 1620 bp will be amplified in the wild-type RagC gene; if gene editing occurs to form a RagC gene deletion, a product of about 500 bp will be amplified (e.g. Figure 1 In this step, RagC - / SM6 heterozygous flies.
[0023] Example 2: Construction of transgenic fruit flies with different RagC activities First, the coding region of the RagC gene was amplified, and the recombinant sequence corresponding to the vector insertion position was added to the end of the primer 5. The primer sequence is as follows: RagC coding-F:ATTCGTTAACAGATCTGCGGCCGCatgagctacgatgatgatgac RagC coding-R: GCGGCCTCCACCGCGGGGTACctg attaattggctgcgctcgc The RagC coding region was amplified using Drosophila cDNA as a template. According to the plasmid construction method similar to the above, the RagC coding region was inserted into the UASp-attB vector to obtain the UASp-RagC-wt plasmid.
[0024] Mutating the threonine at position 69 of RagC in Drosophila to asparagine (T69N) allows RagC to bind to GDP, and mutating the glutamine at position 99 to leucine (Q99L) allows RagC to bind to GTP. Design the following primers: RagC-T69N-Fgccgaacgagaacctcttcctgg RagC-T69N-Rccaggaagaggttctcgttcggc RagC-Q99L-Fttccccggcctgattgacttcttc RagC-Q99L-Rgaagaagtcaatcaggccggggaa.
[0025] The fragment was amplified by combining RagC coding-F and RagC-T69N-R as primers and Drosophila cDNA as template; the fragment was amplified by combining RagC coding-R and RagC-T69N-F as primers and Drosophila cDNA as template; the two DNA fragments were recovered by electrophoresis, mixed, and used as templates to amplify the coding region of RagC-T69N with A298T (encoded amino acid T69N) mutation using RagC coding-F and RagC coding-R as primers, and inserted into the UASp-attB vector to obtain the UASp-RagC-T69N plasmid. The UASp-RagC-Q99L plasmid was obtained by a similar method.
[0026] Purify UASp-RagC-wt, UASp-RagC-T69N, and UASp-RagC-Q99L plasmids using an endotoxin-free kit, and inject the plasmids into early embryos of attp2 fruit flies (within 2 hours of egg laying) using a microinjector. After waiting for about 10 days for the fruit fly embryos to develop into adults, cross them with fruit flies with a TM6 balance chromosome on chromosome 3, and select red-eyed fruit flies from the offspring, which are the corresponding transgenic fruit flies.
[0027] Embodiment 3 RagC - / SM6 fruit flies were crossed with FRT42D fruit flies, and the offspring were screened for FRT42D, RagC - / SM6 strain of fruit flies. - / SM6 flies were crossed with double balancer flies to obtain FRT42D, RagC - / SM6;MKRS / TM6;UASp-RagC-wt / TM6 flies were crossed with double balancer flies to obtain sp / SM6;UASp-RagC-wt / TM6. - / SM6;MKRS / TM6 and sp / SM6; UASp-RagC-wt / TM6 were hybridized and FRT42D, RagC - UASp-RagC-wt / TM6 fruit flies were crossed with nos-flp;FRT42D,tub-RFP fruit flies to obtain the genotype nos-flp;FRT42D,RagC - / FRT42D, tub-RFP; UASp-RagC-wt female fruit flies. A similar method was used to obtain nos-flp; FRT42D, RagC - / FRT42D, tub-RFP; UASp-RagC-T69N and nos-flp; FRT42D, RagC - / FRT42D, tub-RFP; UASp-RagC-Q99L fruit flies. Female fruit fly ovaries were dissected in PBS, fixed in 4% paraformaldehyde for 20 minutes, and rinsed three times with PBST (0.5% Triton X-100 in PBS) for 15 minutes each time; the ovaries were incubated in a PBST dilution of mouse Mitf antibody (1:1000) at 4°C for 12 hours, and rinsed three times with PBST for 15 minutes each time; the fruit fly ovaries were incubated in a PBST dilution of green fluorescent-labeled goat anti-mouse secondary antibody (1:1000) at 4°C for 4 hours; rinsed three times with PBST for 15 minutes each time; the ovaries were separated into ovarioles under a microscope and sealed with a blocking solution containing DAPI. Observed under a fluorescence microscope. Because the recombinase FLP expressed in germ cells can drive FRT42D in some germ cells to recombine and form RagC - / RagC - , tub-RFP is lost in these cells, thus forming cells that do not express RagC (no red fluorescent marker). Mitf is a downstream protein of RagC. Studies have shown that the loss of RagC causes Mitf to enter the cell nucleus and function as a transcription factor. Figure 2 As shown, in the Drosophila follicle cells lacking RagC (indicated by the arrow), Mitf enters the cell nucleus, and overexpression of T69N mutant (GDP-bound) RagC can rescue the nuclear entry of Mitf; however, overexpression of Q99L mutant (GTP-bound) RagC cannot rescue the nuclear entry of Mitf.
[0028] Embodiment 4 In RagC - RagC is absent in the offspring of / SM6 flies - The appearance of homozygous fruit flies (as shown in Table 1) indicates that the homozygous mutation of RagC is lethal. - / SM6 fruit flies, Tub-Gal4 / TM6 fruit flies, and UASp-RagC-wt / TM6 fruit flies were hybridized with double balancer fruit flies in two steps to obtain RagC - / SM6; Tub-Gal4 / TM6 Drosophila and RagC - / SM6;UASp-RagC-wt / TM6 fruit flies. These two fruit flies were crossed and the offspring were counted. - / RagC - The ratio of genotypes was used to determine whether overexpression of RagC-wt could rescue the survival of RagC mutations. In a similar way, it was found that overexpression of RagC-wt and RagC-GDP could rescue the survival of RagC-T69N mutations, while overexpression of RagC-Q99L could not. This indicates that the binding state of GDP / GTP affects the physiological function of RagC.
[0029] Table 1
[0030] The preferred embodiments of the present invention are described in detail above. However, the present invention is not limited to the specific details in the above embodiments. Within the technical concept of the present invention, a variety of simple modifications can be made to the technical solution of the present invention, and these simple modifications all belong to the protection scope of the present invention.
[0031] It should also be noted that the various specific technical features described in the above specific embodiments can be combined in any suitable manner without contradiction. In order to avoid unnecessary repetition, the present invention will not further describe various possible combinations.
[0032] In addition, various embodiments of the present invention may be arbitrarily combined, and as long as they do not violate the concept of the present invention, they should also be regarded as the contents disclosed by the present invention.
Claims
1. A method for constructing a RagC mutant fruit fly, characterized in that: The steps include: Construction of S1 and RagC gene deletion mutant Drosophila S1.1 Insert the expression sequences of the gRNA designed at both ends of the RagC gene coding region into the vector plasmid to obtain the ligation plasmid; S1.2 The ligated plasmid was introduced into Drosophila embryos expressing Cas9 protein, and then hybridized with Drosophila with SM6 balance chromosome on chromosome 2 to identify and screen RagC - / SM6 heterozygous fruit flies are RagC gene deletion mutant fruit flies; Construction of S2 and RagC transgenic flies The coding sequence of the RagC gene that binds GTP and GDP is inserted into the UASp expression plasmid, and the expression plasmid is introduced into the white-eyed fruit fly embryo that expresses the recombinase, and the fruit fly is hybridized and screened with the fruit fly with the balance chromosome to obtain the RagC transgenic fruit fly; Construction of S3 and RagC mutant flies The RagC gene deletion mutant fruit flies constructed in step S1 are crossed with the RagC transgenic fruit flies constructed in step S2 to obtain fruit flies that only express the mutant form of RagC protein.
2. The construction method according to claim 1, characterized in that: In step S1.1, a gRNA was designed at the 288th base and the 1533th base of the RagC gene.
3. The construction method according to claim 2, characterized in that: In step S1.1, the method for constructing the connection plasmid is: annealing the forward and reverse primers at the 288th base and the 1533th base to form double strands, respectively, and then connecting the annealed double strands to the vector to obtain the vector plasmid, and finally connecting the two vector plasmids to obtain the connection plasmid; The forward and reverse primers at base 288 and base 1533 are as follows: RagC gRNA site 288-F:CTTCGACACGTTCCCCAAGGACTT RagC gRNA site 288-R:AAACAAGTCCTTGGGGAACGTGTC RagC gRNA site 1533-F: CTTCGAGCAGACCCTGATTCGCCA RagC gRNA site 1533-R: AAACTGGCGAATCAGGGTCTGCTC.
4. The construction method according to claim 3, characterized in that: The vector is pBFv U6.2 vector.
5. The construction method according to claim 1, characterized in that: In step S1.2, the identification method is: after hybridizing the fruit flies collected by hybridization with sp / SM6 fruit flies, genomic DNA is extracted and PCR identification is performed. The identification primer sequences are as follows: RagC identification primer F: CCCACCCCCAAAACCAGAAT RagC identification primer R:TGTGAGAGTGGCGTCCTAAC The product of about 500 bp was screened and amplified, which was RagC - / SM6 heterozygous flies.
6. The construction method according to claim 1, characterized in that: In step S2, the threonine at position 69 of the RagC gene is mutated to asparagine so that it can bind to GDP; and the glutamine at position 99 of the RagC gene is mutated to leucine so that it can bind to GTP.
7. The construction method according to claim 6, characterized in that: In step S2, the coding sequence of the RagC gene binding to GTP and GDP is respectively inserted into the UASp expression plasmid as follows: S2.1 Amplify the coding region of the RagC gene and insert the RagC coding region into the UASp-attB vector to obtain the UASp-RagC-wt plasmid. The primer sequences are as follows: RagC coding-F:ATTCGTTAACAGATCTGCGGCCGCatgagctacgatgatgatgac RagC coding-R: GCGGCCTCCACCGCGGGGTACctg attaattggctgcgctcgc; S2.2 The fragment was amplified by combining RagC coding-F and RagC-T69N-R as primers and using Drosophila cDNA as template; the fragment was amplified by combining RagC coding-R and RagC-T69N-F as primers and using Drosophila cDNA as template; the two DNA fragments were recovered by electrophoresis, mixed, and used as templates to amplify the coding region of RagC-T69N with A298T mutation using RagC coding-F and RagC coding-R as primers, and inserted into the UASp-attB vector to obtain the UASp-RagC-T69N plasmid; the UASp-RagC-Q99L plasmid was obtained in the same way; in RagC-T69N-F:gccgaacgagaacctcttcctgg RagC-T69N-R:ccaggaagaggttctcgttcggc RagC-Q99L-F:ttccccggcctgattgacttcttc RagC-Q99L-R: gaagaagtcaatcaggccggggaa; S2.3 Inject UASp-RagC-wt plasmid, UASp-RagC-T69N plasmid, and UASp-RagC-Q99L plasmid into the early embryos of attp2 fruit flies respectively. After they develop into adults, they are hybridized with fruit flies carrying the TM6 balance chromosome on chromosome 3. Red-eyed fruit flies are selected from the offspring, which are the corresponding transgenic fruit flies.
8. Use of the RagC mutant fruit fly constructed by the construction method according to any one of claims 1 to 7 in screening drugs for treating diseases caused by RagC gene mutation.