A method and application for efficient synthesis of human lactoferrin through multi-copy integration

Abstract

This invention discloses a method and application for efficient synthesis of human lactoferrin through multi-copy integration, relating to the fields of genetic engineering and bioengineering. The invention provides a method for synthesizing human lactoferrin, including the steps of fermenting and culturing a recombinant Aspergillus niger strain, followed by isolation and purification to obtain human lactoferrin; the construction method of the recombinant Aspergillus niger strain includes the step of integrating the hLF gene into a gene locus in the host strain genome to construct the recombinant Aspergillus niger strain. This invention constructs a recombinant Aspergillus niger strain capable of recombinantly expressing human lactoferrin, initiating protein expression through a strongly inducible promoter, fusing endogenous high-secretion proteins, and optimizing the multi-copy integration method to integrate the lactoferrin expression cassette, achieving high-level synthesis of human lactoferrin, laying the foundation for the industrial production of lactoferrin or high-density fermentation of other food functional proteins using Aspergillus niger.

Description

Technical Field

[0001] This invention relates to the fields of genetic engineering and bioengineering, and in particular to a method and application for achieving efficient synthesis of human lactoferrin through multi-copy integration. Background Technology

[0002] Lactoferrin is an iron-binding glycoprotein and an important edible nutritional protein with a molecular weight of approximately 80 kDa. It is widely found in the milk, serum, tears, semen, and mucosal secretions of mammals. Lactoferrin possesses broad-spectrum antibacterial, antiviral, and immunomodulatory functions, and is used in various fields such as infant formula, nutritional supplements, and cosmetics. In breast milk, lactoferrin is a major whey protein, accounting for 10%-30% of the total whey protein content. Human colostrum is rich in lactoferrin, with an average concentration between 5-6 mg / mL. The lactoferrin concentrations in bovine colostrum and cow's milk are approximately 1 and 0.2 mg / mL, respectively, which are lower than the concentrations in human breast milk and its colostrum.

[0003] Lactoferrin's most significant biological characteristic is its high affinity for iron, which increases iron bioavailability in intestinal cells, stabilizes reduced iron ions, and reduces irritation to the intestines and stomach. Lactoferrin participates in many physiological functions, including regulating iron absorption and immune responses. It also possesses antioxidant, antibacterial, and antiviral activities, as well as anticancer and anti-inflammatory properties. The antibacterial activity of lactoferrin has been widely demonstrated in both Gram-positive and Gram-negative bacteria, particularly against common drug-resistant bacteria. More importantly, lactoferrin is a component of the human innate nonspecific immune system, constituting the initial immune defense system. Studies have found that lactoferrin's positive charge enables it to bind to negatively charged molecules on the surface of various immune system cells. This binding can trigger signaling pathways and lead to cellular responses such as activation, differentiation, and proliferation. In addition to inducing systemic immunity, lactoferrin can also promote skin immunity and inhibit allergic reactions.

[0004] Isolating and extracting lactoferrin from animal milk is currently the most widely used method, but it suffers from high extraction and purification costs and environmental unfriendliness. Due to the complexity of the extraction process and low yield, the price of lactoferrin remains high in the market. Producing lactoferrin through genetic engineering has become a research hotspot and development trend for the industrial production of lactoferrin while avoiding its side effects. Optimizing recombinant expression of lactoferrin using microbial hosts and scaling up fermentation processes aligns with the goals of green biomanufacturing. Compared to traditional animal and plant extraction methods, biosynthesis will significantly reduce production costs and time, potentially making the industrial production of lactoferrin more efficient. This aligns with the modern industrial pursuit of sustainable development and green production, and helps reduce the environmental and resource burden of the production process.

[0005] Aspergillus niger is generally considered a safe (GRAS) strain due to its superior protein secretion capabilities compared to other microbial species. Firstly, it possesses a natural ability to secrete a variety of proteins, exhibits efficient folding and post-translational modification capabilities, and is inexpensive to cultivate and easily induced. This inherently superior protein secretion capacity makes Aspergillus niger an ideal platform for the production of recombinant proteins. Researchers have conducted extensive work to develop efficient expression systems for Aspergillus niger to produce homologous and heterologous proteins. Furthermore, industrial fermentation systems have established a good foundation for several species. However, when heterologous proteins are expressed in filamentous fungi, the yield is significantly lower than that of endogenous proteins. This is because heterologous protein expression places considerable stress on the cellular secretory system, easily inducing changes in protein folding modifications within the filamentous fungus itself. Simultaneously, endogenous proteases cleave the heterologous protein, leading to its degradation and reduced protein yield.

[0006] This invention aims to develop a method for efficient synthesis of human lactoferrin through multi-copy integration, with the goal of achieving efficient microbial expression of human lactoferrin. Summary of the Invention

[0007] The purpose of this invention is to provide a method and application for efficient synthesis of human lactoferrin through multi-copy integration, thereby addressing the problems existing in the prior art. This invention constructs a recombinant Aspergillus niger strain capable of recombinantly expressing human lactoferrin, initiates protein expression through a strongly inducible promoter, fuses endogenous high-secretion proteins, and optimizes the multi-copy integration method to integrate the lactoferrin expression cassette, achieving high-level synthesis of human lactoferrin.

[0008] To achieve the above objectives, the present invention provides the following solution:

[0009] This invention provides a method for constructing a recombinant Aspergillus niger strain expressing lactoferrin, comprising the step of integrating the hLF gene into a gene locus in the host strain genome to construct the recombinant Aspergillus niger strain;

[0010] The nucleotide sequence of the hLF gene is shown in SEQ ID NO.1;

[0011] The gene locus is at least one of the following: glaA locus, amyA locus, ammA locus, pepA locus, and pepB locus;

[0012] The host strain is Aspergillus niger AG11-PK.

[0013] Furthermore, the 5' end of the hLF gene is linked to the glaA fragment and then integrated into the gene locus of the host strain genome;

[0014] The nucleotide sequence of the glaA fragment is shown in SEQ ID NO.4.

[0015] Furthermore, the method for integrating the hLF gene into the gene locus of the host strain genome includes the following steps:

[0016] After linking the 5' end of the hLF gene to the glaA fragment, it was ligated into the pAN7-1 vector to obtain the recombinant plasmid pAN7-1-hLF;

[0017] Using the genome of Aspergillus niger AG11-PK as a template, the upstream and downstream homologous arms of the gene locus were amplified respectively;

[0018] The recombinant plasmid pAN7-1-hLF was amplified by PCR to obtain the open reading frame fragment FhLF containing a promoter and a terminator;

[0019] The upstream homologous arm, the FhLF, the downstream homologous arm, and the pAN7-1 vector were recombined using the Gibson assembly method to obtain a recombinant vector;

[0020] The recombinant vector was linearized and then transferred into the host strain.

[0021] Furthermore, the construction method also includes the step of knocking out the pepA and pepB genes of the host strain.

[0022] Furthermore, the construction method also includes the step of knocking out the glaA gene, amyA gene, ammA gene, and albA gene of the host strain.

[0023] Furthermore, gene knockout was performed using a CRISPR gene editing system; the C segment of the Cas9 protein of the CRISPR gene editing system was fused with Brex27; the nucleotide sequence of the gene encoding Brex27 is shown in SEQ ID NO.7.

[0024] The present invention also provides a recombinant Aspergillus niger strain expressing lactoferrin constructed according to the above-described construction method.

[0025] The present invention also provides the application of the above-mentioned recombinant Aspergillus niger strain in the preparation of lactoferrin.

[0026] The present invention also provides a method for preparing lactoferrin, comprising the steps of fermenting and culturing the above-mentioned recombinant Aspergillus niger strain, and then separating and purifying the lactoferrin.

[0027] The present invention also provides lactoferrin prepared according to the above preparation method.

[0028] The present invention discloses the following technical effects:

[0029] This invention constructed a recombinant Aspergillus niger strain capable of recombinantly expressing human lactoferrin. Protein expression was initiated using a strongly inducible promoter, fused with an endogenous high-secretion protein, and an optimized multi-copy integration method was employed to integrate the lactoferrin expression cassette, achieving high-level extracellular synthesis of human lactoferrin. Based on this, process optimization was performed in a 5L fermenter, enabling high-density fermentation of Aspergillus niger with efficient synthesis of human lactoferrin. After 144 hours of fermentation, the cell dry weight reached 87.76±2.34 g, and the lactoferrin yield reached 335.78±2.71 mg / L. This invention lays the foundation for the industrial production of lactoferrin or the high-density fermentation of other food functional proteins using Aspergillus niger. Attached Figure Description

[0030] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0031] Figure 1 Fermentation curve for the production of human lactoferrin by engineered Aspergillus niger hLF26 in a 5L tank. Detailed Implementation

[0032] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0033] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0034] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.

[0035] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be apparent to those skilled in the art. This specification and embodiments are merely exemplary.

[0036] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.

[0037] The culture medium formulations involved in the following examples are as follows:

[0038] LB medium (1L): 5g yeast extract, 10g tryptone and 10g sodium chloride.

[0039] Seed culture medium (1L): 30g corn steep liquor, 20g soybean flour, 20g corn starch and 5g glucose, pH 6.0.

[0040] Fermentation medium (1L): 50g glucose, 7.5g sodium nitrate, 3g potassium dihydrogen phosphate, 1.7g sodium dihydrogen phosphate, 1g magnesium sulfate heptahydrate, 0.5g EDTA, 0.3g ferrous sulfate heptahydrate, 0.076g anhydrous calcium chloride, 0.04g zinc sulfate heptahydrate, 0.04g manganese sulfate monohydrate, 0.016g copper sulfate pentahydrate, 0.016g cobalt chloride hexahydrate, and 1mL defoamer, pH 6.0.

[0041] Feeding medium (1L): 400g glucose, 7.5g sodium nitrate, 3g potassium dihydrogen phosphate, 1.7g sodium dihydrogen phosphate, 1g magnesium sulfate heptahydrate, 0.5g ethylenediaminetetraacetic acid (EDTA), 0.3g ferrous sulfate heptahydrate, 0.076g anhydrous calcium chloride, 0.04g zinc sulfate heptahydrate, 0.04g manganese sulfate monohydrate, 0.016g copper sulfate pentahydrate, 0.016g cobalt chloride hexahydrate, and 1mL defoamer, pH 6.0.

[0042] The detection method for lactoferrin is as follows: Samples fermented for different durations were centrifuged at 12,000×g and 4℃ for 15 min, and the supernatant was diluted for detection. The lactoferrin content was determined using a human lactoferrin / LF ELISA kit (Sangon Biotech (Shanghai) Co., Ltd.). For specific steps, please refer to the instruction manual.

[0043] The host strain used in this invention is Aspergillus niger AG11-PK, which has been disclosed in the literature "Heterologous expression of a highly thermostable L-asparaginase from Thermococcus zilligiiin Aspergillus niger for efficient reduction of acrylamide in French fries". This invention promises to release it to the public for 20 years from the date of application of this invention.

[0044] Example 1: Construction of a recombinant Aspergillus niger strain expressing lactoferrin

[0045] The highly expressed site glaA in Aspergillus niger AG11-PK was selected as the integration site for the lactoferrin-encoding gene. Using the synthesized hLF sequence (nucleotide sequence shown in SEQ ID NO.1) as a template, the hLF fragment was amplified by primer pair F1 / F2 PCR. Using vector pAN7-1 (published in the paper "Transformation of Aspergillus based on the hygromycin B resistance marker from Escherichia coli") as a template, PCR amplification was performed by primer pair FP1 / FP2, and the product was purified. The hLF fragment and vector pAN7-1 were assembled using the Gibson assembly method to obtain the recombinant plasmid. The recombinant plasmid was transformed into Escherichia coli JM109, the plasmid was extracted, and sequence verification was performed to obtain the correct recombinant plasmid pAN7-1-hLF.

[0046] Primers F3 / R3 and F4 / R4 were designed to amplify the upstream and downstream homologous arms UPglaA and DWglaA of the glaA site using the genome of *Aspergillus niger* AG11-PK as a template. PCR amplification of the recombinant plasmid pAN7-1-hLF was performed using primer F5 / R5, yielding the open reading frame fragment FhLF containing a promoter and terminator. The fragments UPglaA, DWglaA, FhLF, and the pAN7-1 vector backbone were recombined using Gibson assembly to obtain the correct recombinant vector pAN7-1-UPglaA-FhLF-DWglaA. PCR amplification of pAN7-1-UPglaA-FhLF-DWglaA was performed using primer F3 / R4, and the PCR product was purified to obtain a linearized fragment. The obtained linearized pAN7-1-UPglaA-FhLF-DWglaA fragment was transformed into *Aspergillus niger* AG11-PK to obtain the recombinant strain hLF01.

[0047] To increase lactoferrin production, an endogenous hypersecreting protein saccharifying enzyme from *Aspergillus niger* was fused into the N-segment of lactoferrin to promote its expression and secretion. Different amino acid lengths of the glaA fragment (glaA125, glaA264, and glaA498, with nucleotide sequences shown in SEQ ID NO. 2-4) were amplified from the genome of *Aspergillus niger* AG11-PK using primers F6 / R6-8. PCR amplification was performed using primers FP3 / FP4 with the recombinant vector pAN7-1-UPglaA-FhLF-DWglaA as a template, and the products were purified. The fragments glaA125, glaA264, and glaA498 were recombined with the vector pAN7-1-UPglaA-FhLF-DWglaA using the Gibson assembly method to obtain the correct recombinant vectors pAN7-1-UPglaA-125glaA-FhLF-DWglaA, pAN7-1-UPglaA-264glaA-FhLF-DWglaA, and pAN7-1-UPglaA-498glaA-FhLF-DWglaA.

[0048] Using F3 / R4 primers, PCR amplification was performed on pAN7-1-UPglaA-125glaA-FhLF-DWglaA, pAN7-1-UPglaA-264glaA-FhLF-DWglaA, and pAN7-1-UPglaA-498glaA-FhLF-DWglaA, respectively. The PCR products were purified to obtain linearized fragments. These linearized fragments were transformed into *Aspergillus niger* AG11-PK to obtain strains hLF125, hLF264, and hLF498, respectively. The engineered strains were cultured in seed culture medium for 16 h to obtain seed liquid, which was then inoculated into fermentation medium and fermented at 30℃ and 220 rpm for 96 h. The production of lactoferrin by the engineered strains was verified using an ELISA specific detection kit. The hLF498 fermentation broth showed the highest lactoferrin yield, with a content of 2.38 ± 0.07 mg / L.

[0049] Primer sequences are shown in Table 1.

[0050] Table 1 Primers used to construct the truncated human lactoferrin hLF expression vector.

[0051]

[0052]

[0053] Example 2: Construction of a strain that synthesizes lactoferrin at a high level

[0054] Based on the engineered bacterium hLF498 constructed in Example 1, the expression of lactoferrin was further enhanced by knocking out the endogenous protease genes pepA (nucleotide sequence as shown in SEQ ID NO.5) and pepB (nucleotide sequence as shown in SEQ ID NO.6).

[0055] Primers F9 / R9 and F10 / R10 were designed to amplify the upstream and downstream homologous arms UPPepA and DWPPepA of the pepA site using the genome of Aspergillus niger AG11-PK as a template. Furthermore, primer F9 / R10 was designed to amplify the fusion fragment UDPepA of the upstream and downstream homologous arms using UPPepA and DWPPA as templates.

[0056] Primers F11 / R11 and F12 / R12 were designed to amplify the upstream and downstream homologous arms UPPepB and DWPPepB of the pepB site using the genome of Aspergillus niger AG11-PK as a template. Furthermore, primers F11 / R12 were designed to amplify the fusion fragment UDPepB of the upstream and downstream homologous arms using UPPepB and DWPPepB as templates.

[0057] By designing primers F13 / R13, the Aspergillus niger U3 promoter was amplified using the Aspergillus niger AG11-PK genome as a template.

[0058] The in situ proximity motifs of the pepA and pepB genes were predicted using an online tool (http: / / crispor.tefor.net / ) for the localization of gene editing sites. Their nucleotide sequences are shown in Table 3.

[0059] The sgRNA scaffold was amplified using primers F14 / R14 and plasmid pLCs1 as a template. Plasmid pLCs1 has been disclosed in the literature "Visualized Multigene Editing System for Aspergillus niger".

[0060] Using the pFC332 vector as a template, the fragments were double-digested with BglI I and Pac I, and the resulting linearized fragments were recovered for later use.

[0061] Recombinant plasmids were assembled using the Gibson assembly method, consisting of the U3 promoter, protospacers, sgRNA scaffold, and linearized vector pFC332. The recombinant plasmids were transformed into *E. coli* JM109, and the plasmids were extracted and sequenced to verify sequence correctness, yielding the correct recombinant plasmids pCas-pepA-sgRNA and pCas-pepB-sgRNA.

[0062] Finally, the pepA and pepB gene knockout strains were constructed. Using hLF498 as the host bacterium, co-transformation with pCas-pepA-sgRNA and UDpepA and pCas-pepB-sgRNA and UDpepB was performed sequentially to achieve scarless knockout of the pepA and pepB genes, resulting in strain hLF14.

[0063] This invention prepares Aspergillus niger protease-deficient strains using a CRISPR knockout system, which can optimize the expression and secretion of heterologous proteins (especially heterologous proteins sensitive to Aspergillus niger endogenous proteases).

[0064] In this embodiment, the engineered bacterium hLF14, whose pepA and pepB genes were knocked out, was cultured in seed culture medium for 16 h to obtain seed liquid. The seed liquid was then inoculated into fermentation culture medium and fermented at 30°C and 220 rpm for 96 h. The lactoferrin yield of the engineered bacterium was increased to 3.63 ± 0.05 mg / L, as verified by an ELISA specific detection kit.

[0065] Primer sequences are shown in Table 2.

[0066] Table 2 Primers used to construct pepA and pepB gene knockout strains

[0067]

[0068] Table 3. Protospacers used to construct pepA and pepB gene knockout vectors

[0069]

[0070] SEQ ID NO.5:

[0071]

[0072] SEQ ID NO.6:

[0073] ATGAAGTTCTCTACCATCCTTACCGGCTCCCTCTTCGCCACTGCCGCTCTGGCTGCTCCTCTCACTGAGAAGCGCCGTGCTCGCAAGGAGGCCCGCGCCGCTGGCAAGCGCCACAGCAACCCTCCCTACATCCCTGGTTCCGACAAGGAGATCCTCAAGCTGAACGGCACCTCCAACGAGGATTACAGCTCCAACTGGGCTGGTGCCGTCCTGATCGGCGACGGCTACACCAAGGTCACTGGCGAGTTCACTGTCCCCAGTGTCTCTGCTGGATCTAGCAGCTCCAGTGGCTACGGCGGTGGCTACGGCTACTACAAGAACAAGAGACAATCCGAGGAGTACTGCGCCTCCGCTTGGGTTGGTATCGACGGTGACACCTGCGAGACCGCTATTCTCCAGACTGGTGTCGACTTCTGCTACGAGGATGGCCAGACTTCCTACGATGCCTGGTACGAGTGGTACCCCGACTACGCCTACGACTTCAACGACATCACCATCTCCGAGGGTGACACCATCAAGGTCACTGTCGAGGCCACCAGCAAGAGCAGCGGTAGCGCCACCGTTGAGAACCTGACCACTGGCCAGTCCGTCACCCACACCTTCAGCGGCAACGTCGAGGGTGACCTTTGCGAGACCAACGCCGAGTGGATCGTCGAGGACTTCGAGTCTGGTGACTCTCTTGTGGCTTTCGCTGACTTCGGCTCCGTTACCTTCACCAATGCTGAGGCTACCAGCGACGGTTCCACTGTCGGCCCCTCTGACGCTACCGTTATGGACATTGAGCAGGATGGCACCGTCCTCACCGAGACCTCCGTCTCTGGCGACAGCGTCACTGTCACCTACGTTTAA。

[0074] Construction of the multi-copy integration tool in Aspergillus niger in Example 3

[0075] Low-level expression of heterologous lactoferrin expression cassettes limits lactoferrin synthesis. To improve lactoferrin synthesis efficiency, a CRISPR multi-gene editing system was constructed to further integrate the lactoferrin expression cassette into the amyA, ammA, pepA, and pepB sites on the genome of the engineered strain hLF14. However, the multi-gene editing efficiency of *Aspergillus niger* is extremely low, necessitating the development of efficient multi-copy integration tools to achieve multi-copy integration of lactoferrin. The promoter of the sgRNA, the connection mode between multiple gRNA arrays, and the homologous recombination efficiency of the host strain are crucial to the integration efficiency. Knockout of the polyketide synthase gene (albA) causes *Aspergillus niger* spores to appear white. When using a single multi-gRNA expression cassette to simultaneously edit the albA gene and the target integration site, the probability of simultaneous integration at multiple sites in colonies with altered spore color increases, significantly reducing the workload of screening for positive strains by selecting white spores.

[0076] In this embodiment, the inventors designed a tRNA-gRNA array containing albA gene gRNA to improve the selection efficiency of multi-gene editing positive transformants in AG11-PK on primary transformation plates. Secondly, by optimizing the promoter in the visual gene editing initiation gRNA expression cassette and combining it with Cas9 protein modification, the host homologous recombination efficiency was improved, and a visual tRNA-gRNA array was designed for editing multiple target genes.

[0077] In this embodiment, six major genes from Aspergillus niger—glaA, amyA, ammA, pepA, pepB, and albA—were selected as target genes for verification.

[0078] First, for the assembly of the six gRNAs, paired primers with complementary sequences were designed, and the corresponding primers are listed in Table 4. Specifically, using pU3_fwd and pU3_rev as primers and the Aspergillus niger AG11 genome as a template, the Aspergillus niger PU3 promoter was amplified; using tRNA_fwd and tRNA_rev as primers and the Aspergillus niger AG11 genome as a template, six corresponding tRNAs were amplified; using gRNA_fwd and gRNA_rev as primers and plasmid pLCs1 as a template, sgRNA scaffolds at six sites were amplified; using Tu3_fwd and Tu3_rev as primers and the Aspergillus niger AG11 genome as a template, the Aspergillus niger TU3 terminator was amplified; and using pFC332_fwd and pFC332_rev as primers and the pFC332 vector as a template, the linearized pFC332 fragment was amplified. The process involved designing PCR primers to create double-stranded DNA with BsmB I restriction sites at both ends. This DNA was then assembled with the pFC332 vector using a Golden Gate technique, resulting in the pFC332-sgRNA array expression vector containing sgRNAs targeting glaA, amyA, ammA, pepA, pepB, and albA. Specific details of the Golden Gate procedure are disclosed in the paper "Golden Gate Shuffling: A One-Pot DNA Shuffling Method Based on Type IIs Restriction Enzymes," which can be used as a reference.

[0079] Furthermore, using the AG11-PK strain genome as a template, six gene homologous arms were cloned, and knockout frames for these six genes were obtained through fusion PCR and assembled into the vector pAN7-1, resulting in plasmid pAN7-1-UD6. Plasmid pAN7-1-UD6 and pFC332-sgRNAs were transformed into AG11-PK, and the target length was verified to be correct by colony PCR. The genomic target sequence was then amplified and sequenced for verification. The editing efficiency of the above process was only 5%. Further, by modifying the Cas9 protein and fusing a Brex27 sequence (nucleotide sequence shown in SEQ ID NO.7) in its C segment to recruit homologous recombinant proteins, the efficiency of simultaneous editing of the above six genes was increased to 30%.

[0080] Furthermore, after the necessary editing is completed, plasmid elimination can be performed using the following method: the verified positive strain is transferred to a seed culture medium and cultured with shaking for 24 hours, streaked onto an antibiotic-free PDA plate, and the transfer is repeated 3 times. After single colonies grow, the plasmid-eliminated strain is obtained by screening by colony PCR.

[0081] SEQ ID NO.7:

[0082] GCCCTCGACTTCCTGTCCCGCCTCCCTCTGCCTCCCCCCGTCTCCCCCATCTGCACC TTCGTCTCCCCCGCCGCTCAGAAGGCCTTTCAGCCCCCCCGCTCCTGCGGC.

[0083] Table 4 Primers used to construct the pFC332-sgRNAs vector.

[0084]

[0085] Example 4: High-level synthetic lactoferrin with multiple copies integrated

[0086] First, primers F15 / R15 and F16 / R16 were designed to amplify the upstream and downstream homologous arms UPamyA and DWamyA of the amyA site using the genome of Aspergillus niger AG11-PK as a template.

[0087] Primers F17 / R17 and F18 / R18 were designed to amplify the upstream and downstream homologous arms UPammA and DWammA of the ammA site using the genome of Aspergillus niger AG11-PK as a template.

[0088] Primers F19 / R19 and F20 / R20 were designed to amplify the upstream and downstream homologous arms UPpepA and DWpepA of the pepA site using the genome of Aspergillus niger AG11-PK as a template.

[0089] Primers F21 / R21 and F22 / R22 were designed to amplify the upstream and downstream homologous arms UPpepB and DWpepB of the pepB site using the genome of Aspergillus niger AG11-PK as a template.

[0090] By designing primers F23 / R23 and using plasmid pAN7-1-UPglaA-498glaA-FhLF-DWglaA as a template, the lactoferrin expression cassette PglaA-498glaA-FhLF1, which is used for ammA site integration, was amplified.

[0091] By designing primers F24 / R24 and using plasmid pAN7-1-UPglaA-498glaA-FhLF-DWglaA as a template, the lactoferrin expression cassette PglaA-498glaA-FhLF2, which is used for amyA site integration, was amplified.

[0092] By designing primers F25 / R25 and using plasmid pAN7-1-UPglaA-498glaA-FhLF-DWglaA as a template, the lactoferrin expression cassette PglaA-498glaA-FhLF3, which is used for pepA site integration, was amplified.

[0093] By designing primers F26 / R26 and using plasmid pAN7-1-UPglaA-498glaA-FhLF-DWglaA as a template, the lactoferrin expression cassette PglaA-498glaA-FhLF4, which is used for pepB site integration, was amplified.

[0094] Since AG11-PK-PK is a pyrG-deficient strain, the pyrG expression cassette can be integrated into the albA site to increase the positive selection rate. Simultaneously, a 200bp downstream homologous arm of albA is added to the 5' end of the pyrG expression cassette for loop-out pyrG expression, enabling the reuse of the pyrG tag. Primers F27 / R27 and F28 / R28 were designed to amplify the upstream and downstream homologous arms UPalbA and DWalbA of the albA site using the genome of *Aspergillus niger* AG11-PK as a template. Primers F29 / R29 were designed to amplify the pyrG expression cassette PpyrG-pyrG-TpyrG for albA site integration using plasmid pYTU as a template.

[0095] Using the vector pAN7-1 as a template, PCR amplification was performed with primer pair F30 / F30, and the product was purified.

[0096] The recombinant plasmid pAN7-1-UPammA-FhLF-DWammA was obtained by assembling PglaA-498glaA-FhLF1, UPammA, DWammA and vector pAN7-1 using the Gibson assembly method.

[0097] The recombinant plasmid pAN7-1-UPamyA-FhLF-DWamyA was obtained by assembling PglaA-498glaA-FhLF2, UPamyA, DWamyA and vector pAN7-1 using the Gibson assembly method.

[0098] The recombinant plasmid pAN7-1-UPpepA-FhLF-DWpepA was obtained by assembling PglaA-498glaA-FhLF3, UPPepA, DWpepA and vector pAN7-1 using the Gibson assembly method.

[0099] The recombinant plasmid pAN7-1-UPpepB-FhLF-DWpepB was obtained by assembling PglaA-498glaA-FhLF4, UPPepB, DWpepB and vector pAN7-1 using the Gibson assembly method.

[0100] The recombinant plasmid pAN7-1-UPalbA-FhLF-DWalbA was obtained by assembling PpyrG-pyrG-TpyrG, UPalbA, DWalbA and vector pAN7-1 using the Gibson assembly method.

[0101] The recombinant plasmids were transformed into E. coli JM109, and the plasmids were extracted and sequenced to verify the correctness of the sequences. The correct recombinant plasmids pAN7-1-UPamyA-FhLF-DWamyA, pAN7-1-UPammA-FhLF-DWammA, pAN7-1-UPpepA-FhLF-DWpepA, pAN7-1-UPpepB-FhLF-DWpepB, and pAN7-1-UPalbA-reDWalbA-pyrG-DWalbA were obtained respectively.

[0102] Furthermore, a multi-site synchronous integration plasmid pFC332-sgRNAs was constructed. Online tools (http: / / crispor.tefor.net / ) were used to predict the in situ neighboring motifs (protospacers) of the amyA, ammA, glaA, and albA genes. These, along with the protospacers of pepA and pepB from Example 2, were used to locate the lactoferrin integration site. Using primers F31 / R31 and plasmid pLCs1 as a template, an sgRNA scaffold was amplified, and different sgRNAs were linked by tRNA. Using vector pFC332 as a template, the fragments were double-digested with Bgl II and Pac I, and then recovered for later use. The U3 promoter, six protospacers, six sgRNA scaffolds, and the linearized vector pFC332 were assembled using the Golden Gate method to obtain the recombinant plasmid. The recombinant plasmid was transformed into *E. coli* JM109, and the plasmid was extracted and sequenced to verify sequence correctness, yielding the correct recombinant plasmid pFC332-sgRNAs. pFC332-sgRNAs and pAN7-1-UPglaA-FhLF-DWglaA, pAN7-1-UPamyA-FhLF-DWamyA, pAN7-1-UPammA-FhLF-DWammA, pAN7-1-UPpepA-FhLF-DWpepA, pAN7-1-UPpepB-FhLF-DWpepB, and pAN7-1-UPalbA-reDWalbA-pyrG-DWalbA were linearized and introduced into engineered strain hLF14. The multi-copy strain hLF26 was obtained through genome verification.

[0103] The engineered strain hLF26 was cultured in seed culture medium for 16 h to obtain seed liquid, which was then inoculated into fermentation medium at a 5% inoculum and fermented at 30℃ and 220 rpm for 96 h. The results showed that the engineered strain hLF26 could produce 12.1 ± 0.04 mg / L lactoferrin.

[0104] Primer sequences are shown in Table 5.

[0105] Table 5 Primers used to construct the lactoferrin multicopy integration vector.

[0106]

[0107]

[0108] Table 6. Protospacers used to construct multi-gene locus integration

[0109]

[0110] Example 55: Horizontal fermentation production of lactoferrin in a 5L fermenter

[0111] The engineered Aspergillus niger strain hLF26 constructed in Example 3 was spread and cultured on PDA solid medium plates and incubated at 30°C for 5 days to obtain an activated engineered strain. The spores of the activated strain were washed and inoculated into 50mL / 250mL seed medium for primary seed culture. The culture was carried out at 220rpm and 30°C in shake flasks for 16 hours with the pH set to natural, to obtain the primary seed solution.

[0112] The primary seed culture was inoculated at a rate of 5% into a 1L shake flask containing 200mL of fermentation medium for secondary seed culture at 30℃ and 220rpm for 24h to obtain the secondary seed culture at natural pH.

[0113] The secondary seed culture was inoculated into a 5L fermenter with a fermentation medium volume of 2.5L at a 10% inoculation rate. The initial aeration rate was 3L / min, the initial stirring was 375rpm, and the culture temperature was 30℃. The pH was controlled at 5.5 with 50% ammonia water to start the culture. When the initial dissolved oxygen dropped to 20%, the dissolved oxygen was maintained at 20% by controlling the stirring (400-900rpm) and the air flow rate (3-10L / min). When the glucose dropped to 5g / L-10g / L, fed fermentation medium was added, and the glucose concentration in the fermentation broth was controlled at 1g / L-5g / L. Lactoferrin was sampled and tested periodically.

[0114] like Figure 1As shown, from hour 1 to 24, the cell growth was in the lag phase, with slow cell growth. From hour 24 to 120, the cell growth was in the logarithmic growth phase, during which the cell growth was rapid. From hour 120 to 168, the cell growth slowed down. Finally, after 168 hours of fermentation, the cell dry weight reached 87.76 ± 2.34 g, and the lactoferrin yield reached 335.78 ± 2.71 mg / L.

[0115] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. A method for constructing a recombinant Aspergillus niger strain expressing lactoferrin, characterized in that, The process includes the step of integrating the hLF gene into a gene locus in the host strain genome to construct the recombinant Aspergillus niger strain; The nucleotide sequence of the hLF gene is shown in SEQ ID NO.1; The gene locus is at least one of the following: glaA locus, amyA locus, ammA locus, pepA locus, and pepB locus; The host strain is Aspergillus niger AG11-PK; The 5' end of the hLF gene is linked to the glaA fragment and then integrated into the gene locus of the host strain genome; The nucleotide sequence of the glaA fragment is shown in SEQ ID NO.4; The method for integrating the hLF gene into the gene locus of the host strain genome includes the following steps: After linking the 5' end of the hLF gene to the glaA fragment, it was ligated into the pAN7-1 vector to obtain the recombinant plasmid pAN7-1-hLF; Using the genome of Aspergillus niger AG11-PK as a template, the upstream and downstream homologous arms of the gene locus were amplified respectively; The recombinant plasmid pAN7-1-hLF was amplified by PCR to obtain the open reading frame fragment FhLF containing a promoter and a terminator; The upstream homologous arm, the FhLF, the downstream homologous arm, and the pAN7-1 vector were recombined using the Gibson assembly method to obtain a recombinant vector; The recombinant vector was linearized and then transferred into the host strain.

2. The construction method according to claim 1, characterized in that, The construction method further includes the step of knocking out the pepA and pepB genes of the host strain.

3. The construction method according to claim 2, characterized in that, The construction method further includes the step of knocking out the glaA gene, amyA gene, ammA gene, and albA gene of the host strain.

4. The construction method according to claim 3, characterized in that, Gene knockout was performed using a CRISPR gene editing system; the C segment of the Cas9 protein of the CRISPR gene editing system was fused with Brex27; the nucleotide sequence of the gene encoding Brex27 is shown in SEQ ID NO.

7.

5. A recombinant Aspergillus niger strain expressing lactoferrin, constructed according to any one of claims 1-4.

6. The use of the recombinant Aspergillus niger strain as described in claim 5 in the preparation of lactoferrin.

7. A method for preparing lactoferrin, characterized in that, The method includes the step of fermenting and culturing the recombinant Aspergillus niger strain according to claim 5, and then isolating and purifying the lactoferrin.

8. Lactoferrin prepared by the method according to claim 7.

Images