Fluorescent quantitative PCR system based on aggregation-induced emission molecules, kit and application

Abstract

The invention relates to a fluorescent quantitative PCR system based on an aggregation-induced emission molecule, a kit and application, and relates to the technical field of molecular biology, the fluorescent quantitative PCR system comprises a molecular fluorescent probe, the molecular fluorescent probe is silole-R, and the molecular structure of the silole-R is as follows: # imgabs0 #. The fluorescent quantitative analysis of PCR is realized by utilizing the strong electrostatic adsorption effect between the fluorescent probe and a DNA phosphate group; compared with a traditional SYBR Green I (the signal-to-noise ratio is 759%) and TaqMan probe (the signal-to-noise ratio is 718.8%) detection method, the fluorescence quantitative PCR method based on the aggregation-induced emission molecules has the advantages that the ultrahigh signal-to-noise ratio of 1514% is obtained, the ultra-sensitive detection of the virus is realized, and the detection limit reaches 1pM.

Description

Technical Field

[0001] The present invention relates to the field of molecular biotechnology, and in particular to a fluorescence quantitative PCR system, a kit and applications based on aggregation-induced luminescence molecules. Background Art

[0002] African swine fever (ASF) is an acute infectious disease caused by African swine fever virus (ASFV), which can cause fever, bleeding, dyspnea and other symptoms in wild boars and all breeds of domestic pigs, and its mortality rate can reach 100%. The spread of ASFV has caused huge economic losses worldwide. At present, there is a lack of vaccines and effective treatments for ASFV; therefore, it is of vital importance to develop rapid and highly sensitive ASFV detection methods to prevent its spread.

[0003] At present, the methods used for virus detection on the market mainly include fluorescent quantitative polymerase chain reaction (fluorescent quantitative PCR), which is a method for quantitatively measuring the total amount of products after PCR cycles in a DNA amplification reaction using fluorescent substances. SYBR Green I and TaqMan probes are two commonly used fluorescent PCR detection probes. Among them, SYBR Green I is a dye with a green excitation wavelength that binds to the minor groove region of the double helix of double-stranded DNA. The dye is easy to use, but the method has low specificity and sensitivity; Taqman probe is a nucleic acid molecule probe with traditional fluorescent groups such as FAM and FITC labeled at the 5' end and a fluorescent quenching group labeled at the 3' end. Since Taq enzyme has 5' to 3' exonuclease activity, during the PCR reaction, the nucleic acid molecule is hydrolyzed and the fluorescent group is released, and the quantitative analysis of the target gene fragment can be achieved according to the change of the fluorescent signal. The Taqman probe detection method has the characteristics of high specificity and good repeatability, but when synthesizing the probe, it is necessary to simultaneously label the fluorescent group and the quenching group at both ends of the nucleic acid molecule, which increases the difficulty of probe design on the one hand and the cost on the other hand. In addition, the above-mentioned traditional fluorescent dyes such as SYBR Green and FAM generally suffer from aggregation-induced quenching (ACQ) phenomenon, which limits their wider application in detection fields such as imaging.

[0004] In 2001, Tang et al. first discovered and reported that some helical organic molecules have aggregation-induced emission (AIE) phenomenon. Researchers have also proposed various AIE molecular luminescence mechanisms. The most accepted mechanism is that the molecular aggregation emits fluorescent signals due to the obstruction of intramolecular rotation or vibration. AIE molecules have luminescence properties that are completely opposite to ACQ molecules, and ultimately solve the above ACQ problems (such as Figure 1Therefore, it has shown great superiority in practical applications. In recent years, different types of AIE molecules have come into being, including hydrophobic, hydrophilic, positively charged and negatively charged AIE molecules [Freemantle, M.; Milestone in history of ETH. Chem. Eng. News, 2001, 79(52): 29-33. Wang, M.; Zhang, G.; Zhang, D.; et al. Fluorescent bio / chemosensors based on silole and tetraphenyletheneluminogens with aggregation-induced emission feature. J. Mater. Chem., 2010, 20(10): 1858-1867. Li, J.; Wang, J.; Li, H.; et al. Supramolecular materials based on AIE luminogens (AIEgens): Construction and applications, Chem. Soc. Rev., 2020, 49: 1144-1172.]. The research and synthesis of different types of AIE molecules provide ideas for the design of new biosensors. For example, Ou et al. [Ou, X.; Hong, F.; Zhang, Z.; et al. A highly sensitive and facile graphene oxide-based nucleic acid probe: Label-free detection of telomerase activity incancer patient's urine using AIEgens. Biosen. Bioelectro., 2017, 89: 417-4.] used the AIE phenomenon to design and synthesize water-soluble positively charged AIE molecules, and used the interaction between AIE molecules and DNA to construct a label-free nucleic acid probe based on AIE molecules and used it in the telomerase detection platform.Recently, Yu et al. [Yu, K.; Li, K.; He, H.; et al. A label-free fluorescent probe for accurate mitochondrial G-quadruplex structures tracking via assembly hindered rotation induce demission. Sensor. Actuat. B-Chem., 2020, 321: 128479.] reported a label-free fluorescent probe based on hindered rotation induced emission for accurate tracking of mitochondrial G-quadruplex structures. Tang et al. [Gao, Y.; He, Z.; He, X.; et al. Dual-Color emissive AIEgen for specific and Label-Free Double-Stranded DNA recognition and Single-Nucleotide polymorphisms detection. J. Am. Chem. Soc., 2019, 141(51): 20097-20106.] designed a label-free biosensor for double-stranded DNA recognition and single-nucleotide polymorphism detection by synthesizing a dual-color emission AIEgen. However, there is no report on the use of AIE molecules to implement fluorescence quantitative PCR for the detection of African swine fever virus. In view of this, the present invention provides a fluorescence quantitative PCR system, a kit and an application based on aggregation-induced emission molecules. Summary of the invention

[0005] The technical problem to be solved by the present invention is to provide a fluorescence quantitative PCR system, a kit and an application based on aggregation-induced emission molecules. The purpose is to utilize the large amount of aggregation of AIE molecules (silole-R) on the nucleic acid molecular skeleton and emit a strong fluorescence signal to complete the fluorescence quantitative analysis of PCR and achieve high sensitivity and high specificity analysis of African swine fever virus.

[0006] The technical solution of the present invention to solve the above technical problems is as follows:

[0007] In the first aspect, a fluorescence quantitative PCR system based on aggregation-induced emission molecules, the fluorescence quantitative PCR system includes a molecular fluorescent probe, the molecular fluorescent probe is silole-R, and the molecular structure of silole-R is as follows:

[0008]

[0009] Based on the above technical solution, the present invention can also be improved as follows.

[0010] Furthermore, the concentration of the silole-R is 2 μM to 40 μM.

[0011] Furthermore, the concentration of the silole-R is 20 μM.

[0012] Furthermore, the fluorescent quantitative PCR system also includes a primer pair, which includes a forward primer and a reverse primer. The sequence of the forward primer is shown in SEQ ID NO: 1, and the sequence of the reverse primer is shown in SEQ ID NO: 2.

[0013] Furthermore, the concentrations of the forward primer and the reverse primer are both 0.05 nM to 0.2 nM, preferably 0.1 nM.

[0014] Furthermore, the fluorescent quantitative PCR system also includes the following components: the reaction buffer is 10× TaqPCR buffer, the concentration of Mg is 5mM 2+ , dNTPs at a concentration of 2.5 mM.

[0015] In a second aspect, a kit for fluorescence quantitative PCR based on aggregation-induced emission molecules is provided, wherein the kit comprises the components of the fluorescence quantitative PCR system based on aggregation-induced emission molecules.

[0016] In the third aspect, the application of the fluorescence quantitative PCR system based on aggregation-induced emission molecules is to use the fluorescence quantitative PCR system based on aggregation-induced emission molecules to prepare detection reagents for detecting African swine fever virus.

[0017] Furthermore, the silole-R molecules in the detection reagent detect African swine fever virus by emitting fluorescent signals by aggregating on PCR products.

[0018] Furthermore, the wavelength of the fluorescent signal is 478 nm.

[0019] The beneficial effects of the present invention are as follows: the present invention realizes fluorescent quantitative analysis of PCR by using the hydrophilic, positively charged aggregation-induced emission molecule silole-R and the strong electrostatic adsorption between the silole-R and the DNA phosphate group; and is applied to the detection of African swine fever virus. Compared with the traditional SYBR Green I (signal-to-noise ratio of 759%) and TaqMan probe (signal-to-noise ratio of 718.8%) detection methods, the fluorescent quantitative PCR method based on the aggregation-induced emission molecule of the present invention obtains an ultra-high signal-to-noise ratio of 15.14%, realizes ultra-sensitive detection of the virus, and the detection limit reaches 1pM. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 This is a comparison chart of ACQ and AIE luminescence phenomena;

[0021] Figure 2 Schematic diagram of SYBR Green I, TaqMan probe and AIE molecule used for fluorescence quantitative PCR detection;

[0022] Figure 3 The fluorescence emission spectra of different probes in the PCR system; (a) the fluorescence emission spectrum of SYBR Green I in the PCR system; (b) the fluorescence emission spectrum of TaqMan probe in the PCR system; (c) the fluorescence emission spectrum of Silole-R in the PCR system;

[0023] Figure 4 The gel electrophoresis and fluorescence emission spectra of the PCR system with multiple controls; (a) polyacrylamide gel electrophoresis of the PCR system with multiple controls; band 1 is the experimental group; (b) fluorescence emission spectra of the PCR system with multiple controls; (c) fluorescence emission spectra of the PCR system after the introduction of DNase I; (d) fluorescence emission spectra corresponding to different concentrations of Silole-R molecules; fluorescence intensity curves obtained with the change of Silole-R molecule concentration;

[0024] Figure 5 The sensitivity and specificity results of the detection of the present invention are shown in Figure 1. (a) The fluorescence intensity curve obtained with different template concentrations as the number of PCR cycles increases; (b) The fluorescence intensity curve obtained with the change of viral nucleic acid template concentration; (c) The fluorescence response of the system to different primers; (d) The selective detection of viral nucleic acid by the system among different types of nucleic acids. DETAILED DESCRIPTION

[0025] The principles and features of the present invention are described below, and the examples are only used to explain the present invention and are not used to limit the scope of the present invention. If no specific technology or conditions are specified in the embodiments, the technology or conditions described in the literature in this field or the product instructions are used. If the manufacturer of the reagents or instruments used is not specified, they are all conventional products that can be purchased through regular channels.

[0026] The molecular synthesis steps of silole-R used in the examples refer to the following documents:

[0027] 1.Hu,R.,Leung,NL,Tang,BZ,2014.Chem.Soc.Rev.43,4494-4562.

[0028] 2. Zhuang Y, Zhang M, Chen B, et al. Quencher group induced high specificity detection of telomerase in clear and bloody urines by AIEgens[J]. Analytical chemistry, 2015, 87(18):9487-9493.

[0029] Example

[0030] 1. Detection method.

[0031] The conservative fragment of the CP530R gene sequence of African swine fever virus (purchased from Shanghai Shenggong Bioengineering Co., Ltd.) was selected as the PCR template molecule, and the corresponding upstream primers and downstream primers were designed and synthesized. Under the action of Taq DNA polymerase, the reaction conditions such as the buffer solution system, magnesium ion concentration, and dNTP concentration were optimized to achieve a large number of replications of the conservative fragment of the CP530R gene sequence of African swine fever virus.

[0032] The forward and reverse sequences of the conservative fragment of the African swine fever virus CP530R gene sequence are shown in SEQ ID NOs: 3-4:

[0033] ACTGGTGTAGTGTCAATAATCCCTATCTTGCCAAATCAGTTTCCTTGCTGTCTTT

[0034] CTTGTCGCTCAACCATCCCACCGAGTTTATTAAGGTACTGCCGCTTATAGAC (SEQ ID NO: 3);

[0035] GTCTATAAGCGGCAGTACCTTAATAAACTCGGTGGGATGGTTGAGCGACAAGA

[0036] AAGACAGCAAGGAAACTGATTTGGCAAGATAGGGATTATTGACACTACACCA GT (SEQ ID NO: 4).

[0037] Among them, the upstream primer (SEQ ID NO: 1): GTCTATAAGCGGCAGTACCT;

[0038] Downstream primer (SEQ ID NO: 2): ACTGGTGTAGTGTCAATAAT.

[0039] In order to verify the superiority of the AIE system of the present invention, this embodiment designed both SYBR Green I and TaqMan probe methods. Figure 2 As shown, the fluorescence quantitative analysis of PCR products is achieved by SYBR Green I, TaqMan probe sequence as shown in SEQ ID NO: 5 (SEQID NO: 5: 5'-FAM-TCCTTGCTGTCTTTCTTGTC-BHQ1-3') and silole-R molecule (AIE PCR). Among them, in SYBR Green IPCR, the quantitative analysis of PCR is achieved by the dye binding to the minor groove of the DNA double helix without binding to the single-stranded DNA molecule; in TaqMan PCR, since the Taq enzyme has 5' to 3' exonuclease activity, during the PCR reaction, the TaqMan probe is hydrolyzed and the fluorescent group is released, and the quantitative analysis of the target gene fragment can be achieved according to the change of the fluorescent signal; in AIE PCR, the positively charged silole-R molecules are gathered on the PCR product in large quantities, and the aggregation emits a strong fluorescent signal. It can be seen that in principle, the above three fluorescent quantitative PCR methods can be used for the efficient analysis of African swine fever virus.

[0040] Fluorescence quantitative analysis of PCR products using SYBR Green I, TaqMan probe and silole-R molecules were all detected using a fluorescence spectrophotometer, where the SYBR Green I excitation wavelength was 497 nm and the emission wavelength was 520 nm; the TaqMan probe excitation wavelength was 490 nm and the emission wavelength was 520 nm; the silole-R molecule excitation wavelength was 365 nm and the emission wavelength was 478 nm.

[0041] 2. Experimental results and discussion.

[0042] 2.1 Performance analysis of fluorescence quantitative PCR based on SYBR Green I, TaqMan probe and AIE molecules for ASFV virus detection.

[0043] In order to verify the detection performance of the above three systems, this embodiment tested the changes in the fluorescence signals of ASFV virus fragments.

[0044] The conservative fragment sequence of the African swine fever virus CP530R gene sequence was purchased from Shanghai Shenggong Biotechnology Co., Ltd. The forward and reverse sequences are shown in SEQ ID NO: 6-7:

[0045] ACTGGTGTAGTGTCAATAATCCCTATCTTGCCAAATCAGTTTCCTTGCTGTCTT

[0046] TCTTGTCGCTCAACCATCCCACCGAGTTTATTAAGGTACTGCCGCTTATAGAC (SEQ ID NO: 6);

[0047] GTCTATAAGCGGCAGTACCTTAATAAACTCGGTGGGATGGTTGAGCGACAAG

[0048] AAAGACAGCAAGGAAACTGATTTGGCAAGATAGGGATTATTGACACTACACC AGT (SEQ ID NO: 7).

[0049] The experimental results are as follows Figure 3 As shown in (a)-(c), before and after the addition of ASFV virus fragments, the experimental signal-to-noise ratio based on the SYBR Green IPCR method is 759%; the experimental signal-to-noise ratio based on TaqMan PCR is 718.8%; and the signal-to-noise ratio of the sensor based on AIE PCR can reach 1514%; the signal-to-noise ratio calculation method is: (I max -I0) / I0,I max I0 is the system response signal after adding ASFV virus fragments, and I1 is the control fluorescence signal without adding ASFV virus fragments.

[0050] By analyzing the experimental data, we can see that the SYBR Green IPCR method has a low background signal, but the experimental signal is also low; TaqMan PCR has an ultra-high experimental signal, but its background signal is also high; AIE PCR has a low background signal and a high experimental signal, and a high signal-to-noise ratio can be obtained by calculating the signal-to-noise ratio. The experimental results confirm that the fluorescence quantitative PCR based on AIE has good detection performance and can be used for ultra-sensitive detection of ASFV virus.

[0051] 2.2 Performance analysis of AIE-based fluorescence quantitative PCR system.

[0052] Silole-R is a typical AIE molecule, which has two positive charges and good water solubility. In the absence of nucleic acid molecules, Silole-R molecules are dispersed in the solution and show weak fluorescence signals. When the Silole-R molecules are configured into a PCR system with African swine fever virus CP530R gene template DNA, specific primers, Taq enzyme and other experimental materials and the reaction is completed, the ammonium cation on Silole-R and the phosphate anion backbone on DNA will be electrostatically bonded, and the fluorescence intensity of the Silole-R molecules will increase sharply, such as Figure 4 As shown in (a) and (b), a large number of AIE molecules aggregate on the amplified product.

[0053] In order to further verify the working principle, this example introduces deoxyribonuclease (DNase I, purchased from NEB Biotechnology Co., Ltd.) to destroy the PCR system. This nuclease can arbitrarily degrade double-stranded DNA and single-stranded DNA into small fragments, such as Figure 4 As shown in (c), the above experimental results indicate that the change in the reaction signal of the Silole-R molecule is indeed derived from a large amount of amplified dsDNA products.

[0054] In order to obtain the best reaction signal-to-noise ratio, this example conducted a series of optimization experiments on the reaction conditions of PCR. This example conducted an optimization experiment on the concentration of Silole-R molecules (2μM-40μM). The results are as follows: Figure 4 As shown in (d), as the concentration of Silole-R molecules increases, the fluorescence intensity gradually increases, and reaches saturation when the concentration reaches 20 μM. Therefore, the concentration of Silole-R molecules used in this system is 20 μM.

[0055] 2.3 Analysis of the sensitivity and specificity of AIE-based fluorescence quantitative PCR for ASFV virus fragment detection.

[0056] Within a certain template concentration range, as the number of cycles increases, more amplification products are obtained and the collected fluorescence signals are stronger. Figure 5 As shown in (a), when the cycle number reaches 35, the raw materials in the reaction system are completely consumed and no amplification product is synthesized. In order to allow each reaction to be completed thoroughly, the PCR cycle number of 35 is selected in this embodiment.

[0057] In order to verify the detection performance of Silole-R molecules, this example records the fluorescence response curves of the PCR system with different concentrations of viral nucleic acid. Figure 5 As shown in (b), as the template DNA concentration increases from 1pM to 100nM, the fluorescence intensity gradually increases. This is mainly because as the content of template DNA increases, more products are amplified, AIE molecules aggregate, and emit fluorescence. The fluorescence intensity of the aggregated AIE molecules increases exponentially between 1pM and 100nM. This means that Silole-R molecules can quantitatively analyze low-concentration viral DNA in the PCR system. And the Silole-R molecules are not modified by quenching groups, which means that this method has certain practicality.

[0058] As an effective sensing system, the ability to specifically identify the target product is very important. In order to verify the importance of this system, this example was tested from two aspects. First, in order to examine the importance of primers in this detection system, this example introduced 5 different primer fragments and randomly designed primers by primer3. The results are shown in Figure 2. Figure 5 As shown in (c), compared with the primer system used in this example, the fluorescence intensity obtained by the experiments guided by the other five primer systems is very low. The results illustrate the specificity of the primers in this detection system. In addition, this example also examines the importance of specific detection of template DNA in the system. This example introduces different types of DNA fragments, and the extracted nucleic acids are obtained by using a viral nucleic acid purification kit purchased from SIMGEN. The nucleic acid extraction kit is used to extract from different tissue samples, including DNA from pig, sheep, chicken, and cattle tissues sold on the market, and the concentrations of these DNAs are higher than the concentration of the viral template DNA used in this example. The results are shown in FIG. Figure 5 As shown in (d), except for the system configured with viral template DNA, the response signals of other DNA systems are very low, indicating that this method has the ability to specifically detect African swine fever virus nucleic acid.

[0059] 2.4 ASFV virus fragment spike recovery experiment.

[0060] In order to verify the applicability and reliability of the Silole-R molecule in detecting viral nucleic acids, this example collected pork nucleic acids sold on the market for detection by the system. First, in this example, the samples were directly used for the detection of African swine fever virus nucleic acid. In addition, in this example, different concentrations of viral nucleic acid templates were doped into the original samples, and then they were detected according to the previous steps. The results are shown in Table 1. No African swine fever virus nucleic acid was detected in all actual samples. 1 and 10 nM of viral nucleic acid templates were doped into the actual samples, respectively, and this example obtained spiked recoveries of 97.5% and 103%. This result shows that the detection design based on the Silole-R molecule can be effectively used for the tracking and analysis of African swine fever virus nucleic acid in actual samples.

[0061] Table 1 Tracking analysis of viral nucleic acids in actual samples using this strategy

[0062]

[0063] 3. Conclusion

[0064] In this embodiment, the conservative fragment of the CP530R gene sequence of the African swine fever virus is selected as the PCR template molecule, and the corresponding upstream and downstream primers are designed and synthesized, and a large number of replications of the CP530R gene sequence of the African swine fever virus are completed by PCR. Water-soluble, positively charged AIE molecules (silole-R) are selected, and the AIE molecules are adsorbed on the DNA phosphate backbone, resulting in the emission of fluorescent signals, realizing fluorescent quantitative analysis, and completing the detection of viral nucleic acids with high sensitivity and high selectivity. Compared with the traditional SYBRGreen I and TaqMan probe fluorescent quantitative PCR methods, the AIE-based fluorescent quantitative PCR has a higher signal-to-noise ratio (1514% Vs 759% and 718.8%). In addition, by AIE fluorescent quantitative PCR, this embodiment directly detects pork samples in the market and performs spike recovery experiments, and obtains reliable experimental results and spike recovery rates. It proves the reliability of this method in practical application, and provides new ideas and methods for the detection and analysis of African swine fever virus nucleic acids.

[0065] Although the embodiments of the present invention have been shown and described above, it is to be understood that the above embodiments are exemplary and are not to be construed as limitations of the present invention. A person skilled in the art may change, modify, replace and vary the above embodiments within the scope of the present invention.

Claims

1. A fluorescence quantitative PCR system based on aggregation-induced emission molecules, characterized in that: The fluorescent quantitative PCR system includes a molecular fluorescent probe, and the molecular fluorescent probe is silole-R. The molecular structure of silole-R is as follows:

2. The fluorescence quantitative PCR system based on aggregation-induced emission molecules according to claim 1, characterized in that: The concentration of the silole-R is 2 μM to 40 μM.

3. The fluorescence quantitative PCR system based on aggregation-induced emission molecules according to claim 1, characterized in that: The concentration of silole-R was 20 μM.

4. The fluorescence quantitative PCR system based on aggregation-induced emission molecules according to claim 1, characterized in that: The fluorescent quantitative PCR system further comprises a primer pair, wherein the primer pair comprises a forward primer and a reverse primer. The sequence of the forward primer is shown in SEQ ID NO: 1, and the sequence of the reverse primer is shown in SEQ ID NO:

2.

5. The fluorescence quantitative PCR system based on aggregation-induced emission molecules according to claim 4, characterized in that: The concentrations of the forward primer and the reverse primer are both 0.05 nM to 0.2 nM.

6. The fluorescence quantitative PCR system based on aggregation-induced emission molecules according to claim 1, characterized in that: The fluorescent quantitative PCR system also includes the following components: the reaction buffer is 10× Taq PCR buffer, the concentration of Mg is 5mM 2+ , dNTPs at a concentration of 2.5 mM.

7. A kit for fluorescence quantitative PCR based on aggregation-induced luminescence molecules, characterized in that: The kit comprises the components of the fluorescence quantitative PCR system based on aggregation-induced emission molecules according to any one of claims 1 to 6.

8. Application of a fluorescence quantitative PCR system based on aggregation-induced emission molecules, characterized in that: The fluorescence quantitative PCR system based on aggregation-induced emission molecules described in any one of claims 1 to 6 is used to prepare a detection reagent for detecting African swine fever virus.

9. The use of the fluorescence quantitative PCR system based on aggregation-induced emission molecules according to claim 8, characterized in that: The silole-R molecules in the detection reagent detect African swine fever virus by emitting fluorescent signals by aggregating on the PCR product.

10. The use of the fluorescence quantitative PCR system based on aggregation-induced emission molecules according to claim 9, characterized in that: The emission wavelength of the fluorescent signal is 478 nm.

Images