Method for detecting and evaluating rice yield based on KASP multiple sites

Abstract

The invention discloses a method for detecting and evaluating rice yield based on KASP multiple sites, and belongs to the technical field of rice breeding. The method comprises the following steps: (1) by taking a japonica rice Nipponbare genome IRGSP-1. 0 as a reference genome, determining SNP (Single Nucleotide Polymorphism) genotypes at a chromosome 8 26505387bp of a GW8 gene, a chromosome 3 36150781bp of a GNP1 gene, a chromosome 7 24714487bp of a GE gene, a chromosome 3 16733441bp of a GS3 gene and a chromosome 3 17340602bp of a GL3.2 gene of rice to be detected; (2) the counting number of homozygous mutation of the five SNP sites is 1, the counting number of heterozygous mutation of the five SNP sites is 0.5, and the counting number of non-mutation of the five SNP sites is 0; if the total mutation count of the five SNP sites is greater than or equal to 4.5, the material is speculated as a high-yield material. Technical support is provided for evaluating the yield of rice materials.

Description

Technical Field

[0001] The invention belongs to the technical field of rice breeding, and in particular relates to a method for evaluating rice yield based on KASP multi-site detection. Background Art

[0002] Rice is one of the most important food crops in the world. The annual global rice consumption has reached 700 million tons, and with the growth of population and economic development, the demand for rice will continue to increase. Increasing rice production can ensure global food security, promote the development of the agricultural industry, increase farmers' income and promote social and economic development.

[0003] In recent years, a number of high-yield new varieties have been bred using pedigree technology. However, conventional hybridization and backcross selection often rely on larger populations and more trait identification, which greatly increases the investment and cost of breeding. With the successful cloning of key rice genes, breeders have been able to develop molecular markers for gene functional sites, and then analyze the gene combination types of target traits in breeding materials, and then introduce excellent genes based on clear breeding optimization goals to achieve the breeding of new varieties. In addition, in breeding practice, many characteristics such as yield are often interfered by the external environment, making it difficult to accurately evaluate them. However, by analyzing the different allele combinations of key genes that control these characteristics, we can effectively identify them. This method breaks away from the direct observation of phenotypic traits and eliminates the interference of environmental factors, thereby improving the accuracy of breeding, optimizing the selection process, and accelerating the breeding process.

[0004] Rice yield is controlled by quantitative trait loci. At present, multiple yield-related genes, such as GW8, GNP1, GE, GS3, and GL3.2, have been cloned through genetic isolation populations. There is a wide range of natural variation in these gene sequences. For example, the base variation at position 16733441 in the GS3 coding region leads to amino acid changes. Based on this SNP, the core germplasm material GS3 can be divided into two haplotypes, and there is a certain difference in yield between the two. The 3bp deletion at 26501541-26501543 in the GW8 coding region causes amino acid translation frameshift, resulting in loss of gene function. Therefore, the development of markers using variable gene base sites and the identification of favorable alleles in breeding materials play an important role in the breeding of high-yield rice varieties. However, different genes have different pathways of action to increase rice yield, such as GNP1 mainly improves panicle type; GE mainly regulates grain weight; and GW8, GS3, and GL3.2 mainly regulate grain shape. Therefore, high-yield breeding can be carried out by improving multiple yield components at the same time. Therefore, by developing a set of functional markers of related genes, it is possible to use molecular marker-assisted selection (MAS) technology to make targeted improvements on certain traits for different breeding materials, or to carry out aggregate improvements on multiple traits.

[0005] KASP genotyping technology is a unique competitive allele-specific PCR technology that can perform high-precision biallelic typing of single nucleotide polymorphisms (SNPs) and Indels (insertion deletions) on various genomic nucleic acid samples. KASP technology is simple to operate, stable and accurate in analysis, and low in cost. Molecular markers developed using the above five gene functional sites can screen and optimize the combination of dominant alleles at yield-related gene loci in breeding materials, achieve effective transfer and accumulation of target favorable genes, and thus increase crop yields. This not only avoids the blindness in traditional breeding, greatly reduces the size of the required population, saves cost investment, but also greatly improves the accuracy and work efficiency of the selection process. Summary of the invention

[0006] The present invention discloses a method for KASP multi-site detection and evaluation of rice yield, which is as follows:

[0007] a. KASP primer design and specificity test

[0008] From the sites on the rice "Core No. 1" liquid breeding chip of Boredy Biotechnology Co., Ltd. (Shijiazhuang), five key SNP sites with positive effects on yield were obtained based on gene function and associated secondary yield traits. For these sites, KASP primers (including 2 upstream primers and 1 downstream primer) were designed, and the primers were obtained from the website Primer3 (https: / / bioinfo.ut.ee / primer3-0.4.0 / ). The specificity of KASP primers was tested using the website Primer-BLAST (https: / / www.ncbi.nlm.nih.gov / tools / primer-blast / index.cgi). For primer pairs with strong specificity, FAM (SEQ ID NO.18: 5'-GAAGGTGACCAAGTTCATGCT-3') and HEX (SEQ ID NO.19: 5'-GAAGGTCGGAGTCAACGGATT-3') fluorescent sequences were added to the 5' ends of the two upstream primers (represented by F and H, respectively, and the common downstream primer was represented by C) to obtain the final KASP primers. KASP primers were synthesized, and PCR amplification was performed using F+C and H+C as upstream and downstream primer combinations, and "Nipponbare" rice leaf DNA as an amplification template. The target band was detected by agarose gel electrophoresis. The amplified band size was required to meet expectations and had strong specificity (single band, no diffusion, no tailing) before it could be used for subsequent KASP detection.

[0009] b. Select test materials based on phenotypic and genotypic data

[0010] According to the phenotypic data of the "three elements of yield" of rice population materials (number of effective panicles per plant, number of grains per panicle, and thousand-grain weight), the single-plant simulated yield of all materials was calculated by the formula "single-plant simulated yield = number of effective panicles per plant × number of grains per panicle × thousand-grain weight ÷ 1000", among which the number of effective panicles per plant, number of grains per panicle, and thousand-grain weight were obtained through reported data or calculations of small-scale planting. According to the order of single-plant simulated yield from high to low, 8 high-yield, medium-yield, and low-yield materials were selected from the first 1 / 3, the middle 1 / 3, and the last 1 / 3, respectively, to form "high-yield group", "middle-yield group", and "low-yield group" respectively; the selection criteria were that the single-plant simulated yield of each group of 8 materials should not be too close, the sources should be as different as possible, and the material types should include both local materials (landrace) and breeding materials (breeding line) as much as possible, so as to ensure the representativeness of the selected materials for the rice population materials. The above 24 materials were used as test materials for subsequent verification of the accuracy of the designed KASP.

[0011] c. KASP primer typing effect verification

[0012] The five loci selected in "a. KASP primer design and specificity test" have a certain positive effect on rice yield. Therefore, the yield of the material can be estimated by counting the number of mutation sites in the material. The rules are as follows: Count the number of mutation sites in the material. If a homozygous mutation occurs at a site, the count is 1, the count of a heterozygous mutation is 0.5, and the count of no mutation is 0; if the number of mutation sites in a material among the five sites is ≥4.5, it is estimated to be a high-yield material, >3 and <4.5, it is estimated to be a medium-yield material, and ≤3, it is estimated to be a low-yield material.

[0013] The amplification system and amplification conditions of the KASP are as follows:

[0014] A 2×Master Mix for ASPCR kit (Chengdu Hanchen Guangyi Technology Co., Ltd.) was used to prepare a 10 μL PCR system (5 μL Max, 0.1 μL for both F and H, 0.3 μL for C, 3.5 μL DEPC water; 1 μL for 50 ng / μL sample DNA), and the PCR program was as follows: pre-denaturation at 95°C for 10 min; cycle 2 (denaturation at 95°C for 20 s, annealing / extension at 61°C-55°C (-0.6°C / cycle) for 40 s) for 10 times; cycle 3 (denaturation at 95°C for 20 s, annealing / extension at 55°C for 40 s) for 27 times (if the clustering is not obvious enough, 1-3 times can be added); fluorescence scanning at 30°C for 30 s.

[0015] Take the leaves of 24 materials in "b. Determination of field yield of representative materials" and extract gDNA by TPS method (Wang et al., 2020). The concentration of extracted gDNA was adjusted to 50 ng / μL, and KASP-PCR was performed on the gDNA of 24 materials using 2×Master Mix forASPCR kit (Chengdu Hanchen Guangyi Technology Co., Ltd., Cat. No. HC-1011) and KASP primers designed for 5 sites in "a. KASP primer design and specificity test". The typing results of the control materials were analyzed using KASP microplate reader (POLARstar Omega fully automatic multifunctional microplate reader) and KlusterCaller software. If the material group boundary is obvious, the pair of KASP primers is preliminarily identified as being useful for detection.

[0016] In the KASP result graph, the materials are clustered into the red dot area (on the y-axis), the green dot area (the bisector of the xy-axis), and the blue dot area (on the x-axis). For the sites selected in "a. KASP primer design and specificity test", 200bp base fragments upstream and downstream of these sites on the genome are obtained, and a total of 401bp base fragments are obtained together with the SNP site. The sequencing primers of the 401bp fragment are designed through the website Primer3. A representative material is selected from the red dot area, green dot area, and blue dot area of ​​each SNP site KASP result graph, and the gDNA of these three materials and the aforementioned 401bp sequencing primer are used to amplify the corresponding fragments, and sent to the biological company for Sanger sequencing (Guangzhou Ruibo Biotechnology Co., Ltd.) to determine the genotypes represented by the materials in the red dot area, green dot area, and blue dot area, respectively.

[0017] According to this method, the number of mutation sites of 24 materials can be calculated from the KASP results to determine whether the number of mutation sites of each material is consistent with the yield group (low-yield group, medium-yield group and high-yield group) to which the material belongs, so as to determine the overall effect of the primer combination.

[0018] Compared with the prior art, the present invention has the following beneficial effects:

[0019] The invention has clear technical indicators, strong operability and certain technical innovation, and provides a technical system support for developing KASP primer combinations for rice yield-related gene loci and for rapidly detecting and evaluating the yield of rice materials. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 The KASP detection results of the five sites in Example 1 are shown.

[0021] Figure 2 The KASP test results of 5 sites of 27 materials in Example 3 are shown in Figure 3. From top to bottom and from left to right, the 5 figures are typing effect diagrams of 27 representative materials at the five sites of GW8, GNP1, GE, GS3 and GL3.2, where the red dot area represents the material with mutation at the site, the blue dot area represents the material without mutation at the site, and the green dot area represents the material with heterozygous mutation at the site.

[0022] Figure 3 This is the Sanger sequencing peak diagram of the GS3 site of the three materials in Example 3. DETAILED DESCRIPTION

[0023] Example 1 KASP primer design and specificity test

[0024] This embodiment provides a method for developing a KASP primer combination for a rice yield-related gene locus, and the specific steps are as follows:

[0025] From the loci on the rice "Core No. 1" liquid-phase breeding chip, one locus each on the yield-related genes GW8 (RAP-DB number Os08g0531600, the same below), GNP1 (Os03g0856700), GE (Os07g0603700), GS3 (Os03g0407400), and GL3.2 (Os03g0417700) were selected, for a total of 5 loci, and KASP primers were designed to form a set of "rice yield detection KASP primer combination" consisting of 5 pairs of rice yield-related genes. The 5 genes are involved in a variety of secondary yield traits, among which GW8 is related to grain width, GNP1 is related to the number of panicles, GE is related to grain weight, and GS3 and GL3.2 are related to grain length. The KASP primers are as follows:

[0026] (1) Primer 1: Design a pair of KASP primers for the GW8 gene and verify the specificity and typing effect

[0027] The japonica rice genome IRGSP-1.0 of Nipponbare was used as the reference genome, and the SNP at 26505387bp on chromosome 8 was the site for designing primers (C for wild type / A for mutant).

[0028] The primer sequences are as follows:

[0029] Specific primer F1 (SEQ ID NO.1):

[0030] GAAGGTGACCAAGTTCATGCTGCGAGATCAGCTTCGGCA C ;

[0031] Specific primer H1 (SEQ ID NO.2):

[0032] GAAGGTCGGAGTCAACGGATTCGAGATCAGCTTCGGCA A ;

[0033] Universal primer C1 (SEQ ID NO.3):

[0034] GAGGAGCTACCGTCTTCAGAAGTG.

[0035] (2) Primer 2: Design a pair of KASP primers for the GNP1 gene and verify the specificity and typing effect

[0036] The japonica rice "Nipponbare" genome IRGSP-1.0 was used as the reference genome, and the 36150781bp position on chromosome 3 was the SNP location for designed primers (G for wild type / A for mutant).

[0037] The primer sequences are as follows:

[0038] Specific primer F2 (SEQ ID NO.4):

[0039] GAAGGTGACCAAGTTCATGCTCCAGCTGCTGGGGATGA G ;

[0040] Specific primer H2 (SEQ ID NO.5):

[0041] GAAGGTCGGAGTCAACGGATTCCAGCTGCTGGGGATGA A ;

[0042] Universal primer C2 (SEQ ID NO.6):

[0043] CCGATGGAGATATGATAGATGCAA.

[0044] (3) Primer 3: Design a pair of KASP primers for the GE gene and verify the specificity and typing effect

[0045] The japonica rice genome IRGSP-1.0 of Nipponbare was used as the reference genome, and the SNP at 24714487bp on chromosome 7 was the SNP site for designed primers (A for wild type / C for mutant).

[0046] The primer sequences are as follows:

[0047] Specific primer F3 (SEQ ID NO.7):

[0048] GAAGGTGACCAAGTTCATGCTAGCGGCACGGCGAC A ;

[0049] Specific primer H3 (SEQ ID NO.8):

[0050] GAAGGTCGGAGTCAACGGATTAGCGGCACGGCGAC C ;

[0051] Universal primer C3 (SEQ ID NO.9):

[0052] GAGGTCGTACCCTTCGGTGAC.

[0053] (4) Primer 4: Design a pair of KASP primers for the GS3 gene and verify the specificity and typing effect

[0054] The japonica rice "Nipponbare" genome IRGSP-1.0 was used as the reference genome, and the 16733441bp position on chromosome 3 was the SNP location for designed primers (G for wild type / T for mutant).

[0055] The primer sequences are as follows:

[0056] Specific primer F4 (SEQ ID NO.10):

[0057] GAAGGTGACCAAGTTCATGCTCAGCAGGCTGGCTTACTCTCT G ;

[0058] Specific primer H4 (SEQ ID NO.11):

[0059] GAAGGTCGGAGTCAACGGATTCAGCAGGCTGGCTTACTCTCT T ;

[0060] Universal primer C4 (SEQ ID NO.12):

[0061] AGGGTGAAATAAATTCAATCGAAGG.

[0062] (5) Primer 5: Design a pair of KASP primers for the GL3.2 gene and verify the specificity and typing effect

[0063] The japonica rice genome IRGSP-1.0 of Nipponbare was used as the reference genome, and the SNP at 17340602bp on chromosome 3 was the SNP site for designed primers (T for wild type / C for mutant).

[0064] The primer sequences are as follows:

[0065] Specific primer F5 (SEQ ID NO.13):

[0066] GAAGGTGACCAAGTTCATGCTACAGCCCCATACTCCTTGATCA T ;

[0067] Specific primer H5 (SEQ ID NO.14):

[0068] GAAGGTCGGAGTCAACGGATTACAGCCCCATACTCCTTGATCA C ;

[0069] Universal primer C5 (SEQ ID NO.15):

[0070] CCTGAACATGTCGCTGGAGAT.

[0071] Agarose electrophoresis showed that the band sizes of the KASP primers designed for the above five sites were in line with expectations and had strong specificity (single band, no diffusion, no tailing), and could be used for subsequent KASP detection ( Figure 1 ).

[0072] Example 2 Selecting test materials based on simulated yield per plant

[0073] 593 natural rice germplasms collected by the National Engineering Research Center for Plant Space Breeding were used as population materials. According to the phenotypic data of the "three elements of yield" (number of effective panicles per plant, number of grains per panicle, and 1000-grain weight) of the population materials collected in the late season of 2019, the "simulated yield per plant" of each material was calculated, and 10 materials each for the high-yield group, the medium-yield group, and the low-yield group were selected according to "b. Select test materials based on phenotypic and genotypic data", for a total of 24 materials (Table 1). The materials in Table 1 are recorded in Xie H, Lin C, Lu W, et al. OsBLS6.2: Arice bacterial leaf streak resistance gene identified by GWAS and RNA-seq. The Crop Journal 11.6 (2023): 1862-1871. Appendix S1.

[0074] Table 1 Three yield factors and single plant simulated yield data of 24 representative test materials

[0075] serial number Origin type Simulated yield per plant (g) Yuenanheinuo Vietnam Local Materials 203.24 Suinongjiahong6 China Local Materials 199.17 Dongnuo2 China Local Materials 179.04 Zhanjiangnongkeheimi China Local Materials 166.97 Hongnian2 China Local Materials 155.24 Wuchuanhuangpoheimi China Local Materials 128.06 Jinnuo6hao China Breeding material 126.31 Heinuo1 China Local Materials 108.76 Yuetaiyouzhan China Breeding material 77.58 Xinyinchanglizhong China Local Materials 76.37 NsicRc11 the Philippines Local Materials 72.29 Om6073 Vietnam Local Materials 59.20 646-K2001 China Local Materials 54.82 Biaojidao China Breeding material 53.22 Cimelati Indonesia Local Materials 48.30 Nigeria5 Nigeria Local Materials 40.45 Tianhongtian China Local Materials 28.89 Basmati370 Pakistan Breeding material 28.45 Meghi India Local Materials 25.71 Om66 Vietnam Local Materials 24.79 S562 China Local Materials 22.88 Chuan7hao China Breeding material 21.70 Meijianglixian China Local Materials 18.05 Yuehesimiao China Breeding material 12.59

[0076] Example 3: Selecting test materials based on simulated yield per plant

[0077] Take the 24 samples of leaf gDNA from Example 2 and perform KASP detection on 5 sites. The results are as follows: Figure 2 .

[0078] According to the method in "c.KASP primer typing effect verification", primers for Sanger sequencing of 5 loci were designed. The primer sequences are as follows, taking the primers designed for GS3 and GW8 loci as examples. Figure 2 The KASP results of GS3 in the PCR were used to select three materials, namely, Biaojidao in the blue dot area, Tianhongtian in the green dot area, and Nsic Rc 11 in the red dot area. The genotypes of the three materials were detected using GS3 sequencing primers (see below). Figure 3 ) to determine the genotypes represented by different colors.

[0079] GS3 sequencing upstream primer (SEQ ID NO.16):

[0080] TATTTTATTGAAGTTGCTTAAAAAGATAACG;

[0081] GS3 sequencing downstream primer (SEQ ID NO.17):

[0082] TCCCTCAGACATCACCTGAAAAG.

[0083] The results of Sanger sequencing confirmed Figure 2 In the KASP result diagram, the red dot area represents the material with mutation at the site, the blue dot area represents the material without mutation at the site, and the green dot area represents the material with heterozygous mutation at the site. Based on the mutation distribution of 24 materials at 5 sites, the detection effect of this primer combination was scored and evaluated (Table 2), and the detection effect was good.

[0084] Table 2 Evaluation table of genotyping effect of “KASP primer combination for rice yield-related loci”

[0085]

[0086]

[0087] Table Notes: Above the names of the five loci are the relevant phenotypes of the genes at the loci, and below are the mutations of the loci on 24 representative materials. "1" indicates that a locus is a mutant genotype on a material, and the number of mutation sites is recorded as 1. "0.5" indicates a heterozygous mutation, and the number of mutation sites is recorded as 0.5. "0" indicates that no mutation has occurred, and the number of mutation sites is recorded as 0. "Total test score" is the total number of mutation sites at the five loci of a material. "Group score standard" is the standard of the total test score that a material group should theoretically achieve. The "Conformity" column determines whether the "Total test score" meets the "Group score standard".

[0088] Rice yield is a very important comprehensive trait in rice breeding, involving many secondary phenotypes, such as grain phenotype, panicle phenotype, tillering phenotype, etc. In breeding practice, it is difficult to qualitatively detect material yield through a single KASP marker. The present invention detects and infers the yield performance of materials through a group of gene loci closely related to rice yield, thereby realizing yield prediction and eliminating low-yield materials at the seedling stage, thereby shortening the breeding cycle and reducing breeding costs.

[0089] The present invention takes into account that there are many secondary phenotypes involved in yield. When selecting representative sites, the range of secondary phenotypes covered by the sites is as wide as possible, so that multiple secondary phenotypes can be judged in one test, thereby making the evaluation of yield by the primer combination more accurate. This combination involves four secondary phenotypes, namely, grain width (GW8), number of grains per ear (GNP1), grain weight (GE) and grain length (GS3 and GL3.2). These secondary phenotypes are designed for both grain phenotypes and ear phenotypes, which conforms to the current trend of selecting materials with large ears, long grains and good yield in rice breeding.

[0090] When developing KASP primers, the method of the present invention combines the two methods of "theoretical verification" and "experimental verification" to conduct a more rigorous verification of the specificity and detection accuracy of the primers, so as to better retain primers with good detection effects. In addition to using the Primer-BLAST website, from the perspective of bioinformatics analysis, the theoretical specificity of the site is confirmed on the rice genome (theoretical verification), the site is also tested by agarose electrophoresis and Sanger sequencing, and the detection accuracy (overall coincidence rate) of the primer pair is evaluated according to the KASP result graph (experimental verification). Multi-dimensional and multi-method verification ensures that the KASP primers developed by the present invention have high detection specificity and accuracy.

[0091] The present invention also provides a method for selecting suitable representative materials from rice population materials and for verifying the detection effect of yield-related KASP primers. The method can select materials with strong representativeness and gradient differences in yield, and the detection effect of the primers is relatively ideal. When selecting representative materials, the present invention divides the materials into high-yield group, medium-yield group and low-yield group, and verifies the accuracy of the primers by group rather than by individual, so that the detection effect is more objective; when selecting the materials included in each group, various characteristics of the materials are considered as much as possible, such as the origin, type and yield similarity, so that the representative materials obtained have a large degree of distinction, and to a certain extent simulate the real situation of large differences between various breeding materials in the real breeding process, so that the primers can have a detection effect closer to the actual.

[0092]

References

[0093] Xie H, Lin C, Lu W, et al. OsBLS6.2: Arice bacterial leafstreakresistancegene identified by GWAS and RNA-seq. The Crop Journal 11.6(2023):1862-1871.

[0094] Wang W,Wang J,WuY,et al.Genome-wide analysis ofcoding and non-codingRNAreveals a conserved miR164-NAC regulatory pathway for fruit ripening[J].New Phytologist,2020,225(4):1618-1634.

[0095] The embodiments described above are only descriptions of the preferred modes of the present invention, and are not intended to limit the scope of the present invention. Without departing from the design spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by ordinary technicians in this field should all fall within the protection scope determined by the claims of the present invention.

Claims

1. A method for evaluating rice yield based on KASP multi-site detection, characterized in that: The method comprises the following steps: (1) Using the japonica rice "Nipponbare" genome IRGSP-1.0 as the reference genome, the SNP genotypes of the tested rice GW8 gene at 26505387 bp on chromosome 8, the GNP1 gene at 36150781 bp on chromosome 3, the GE gene at 24714487 bp on chromosome 7, the GS3 gene at 16733441 bp on chromosome 3, and the GL3.2 gene at 17340602 bp on chromosome 3 were determined; the GW8 gene SNP site CC was a wild type The SNP site of the GNP1 gene is wild type, AA is a homozygous mutant type, AC is a heterozygous mutant type, the SNP site of the GNP1 gene is GG is wild type, AA is a homozygous mutant type, AG is a heterozygous mutant type, the SNP site of the GE gene is AA is wild type, CC is a homozygous mutant type, AC is a heterozygous mutant type, the SNP site of the GS3 gene is GG is wild type, TT is a homozygous mutant type, GT is a heterozygous mutant type, the SNP site of the GL3.2 gene is TT is wild type, CC is a homozygous mutant type, and TC is a heterozygous mutant type; (2) The homozygous mutation count of the above five SNP sites is 1, the heterozygous mutation count is 0.5, and the no mutation count is 0; if the sum of the mutation counts of the five SNP sites is ≥4.5, it is inferred to be a high-yield material.

2. The method according to claim 1, characterized in that: The rice to be tested is indica rice.

3. The method according to claim 2, characterized in that In the step (1), the genotypes of the rice GW8 gene, GNP1 gene, GE gene, GS3 gene and GL3.2 gene to be tested are determined by KASP.

4. The method according to claim 3, characterized in that: The KASP primers for detecting the rice GW8 gene, GNP1 gene, GE gene, GS3 gene and GL3.2 gene to be tested in the step (1) are SEQ ID NO.1-3, SEQ ID NO.4-6, SEQ ID NO.7-9, SEQ ID NO.10-12, and SEQ ID NO.13-15, respectively; wherein SEQ ID NO.1-2, 4-5, 7-8, 10-11, and 13-14 are specific primers, and SEQ ID NO.3, 6, 9, 12, and 15 are universal primers.

5. The method according to claim 4, characterized in that The amplification system of the KASP is: The 10 μL amplification system is: 5 μL Max, 0.1 μL of each of the two specific primers, 0.3 μL of the universal primer, 3.5 μL DEPC water, and 1 μL of sample DNA.

6. The method according to claim 5, characterized in that The concentration of the sample DNA was 50 ng / μL.

7. The method according to claim 6, characterized in that The amplification program of KASP is as follows: pre-denaturation at 95°C for 10 min; denaturation at 95°C for 20 s, annealing / extension at 61°C-55°C, -0.6°C / cycle, 40 s, 10 times; denaturation at 95°C for 20 s, annealing / extension at 55°C for 40 s, 27 times.

8. Use of the method according to any one of claims 1 to 7 in identifying whether rice is high-yielding.

9. The use according to claim 8, characterized in that: The rice is indica rice.

Images