A molecular marker related to rice grain width and application thereof

By analyzing the genotype of the 1048th nucleotide of the rice OsNF-YC10 gene, a four-primer ARMS-PCR molecular marker was developed, which solved the problem of negative effects of grain width gene mutation in existing technologies, and realized the precise selection and breeding guidance of rice grain width.

CN118957134BActive Publication Date: 2025-11-04ZHEJIANG UNIV +1
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202411209330.1
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-08-30
Publication Date
2025-11-04
Estimated Expiration
2044-08-30

AI Technical Summary

Technical Problem

In existing technologies, gene mutations affecting rice grain width have negative effects, which limits their application in breeding and makes it difficult to find grain width genes that have no negative effects on quality and yield.

Method used

By combining QTL-seq and known genes affecting grain shape analysis on the F2 populations of small-grained indica rice (DR610) and large-grained japonica rice (HG7), it was found that the genotype of nucleotide 1048 of the OsNF-YC10 gene has a significant impact on rice grain width. A four-primer ARMS-PCR molecular marker was developed to distinguish C/T variations and achieve marker-assisted selection of grain shape.

Benefits of technology

It provides an accurate molecular marker that enables the selection of varieties with larger or smaller grain widths in rice breeding, providing an important reference for the design breeding of rice grain width and improving the accuracy and efficiency of breeding.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN118957134B_ABST
    Figure CN118957134B_ABST
Patent Text Reader

Abstract

The application belongs to the field of plant molecular biology technology, and particularly relates to a rice grain width related molecular marker and application thereof. The molecular marker is located at 13789514bp on the first chromosome of rice, and a single base mutation T / C exists. Through QTL-seq and joint analysis of known grain type genes of F2 population of extreme grain weight individuals of small grain indica rice (DR610) and large grain japonica rice (Ha japonica rice No. 7, HG7), it is found that the genotype of the 1048th nucleotide of the rice OsNF-YC10 gene has a significant influence on the grain width of rice, and a molecular marker distinguishing the C→T variation of the site is developed by using four-primer ARMS-PCR, which can be used for molecular marker assisted selection of grain type, and provides an important reference for the design breeding of rice grain width.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The application belongs to the field of plant molecular biology technology, and particularly relates to a rice grain width related molecular marker and application thereof. BACKGROUND

[0002] Rice is one of the most important food crops, and its yield is mainly determined by the number of panicles per unit area, the number of grains per panicle and the weight of 1000 grains. Rice grain type is a typical quantitative trait controlled by multiple genes, which is determined by three elements of grain length, grain width and grain thickness. So far, a large number of genes affecting rice grain type have been found, which are involved in transcriptional regulation pathway, ubiquitination-proteasome pathway, G protein signaling pathway, MAPK signaling pathway and plant hormone signaling pathway, and affect cell proliferation, i.e. the number of cells and / or the size of cell volume, and then affect grain type. However, many genes have the phenomenon of "one cause multiple effects", which affect grain type and other traits such as plant height, thus limiting their application in breeding.

[0003] Rice grain width is an important determinant of grain type and grain weight, which can affect rice yield and rice appearance quality. So far, a large number of gene mutations have been found to affect grain width, but because of the existence of other significant negative effects of mutations, there are not many genes with breeding value, and it is of great significance to explore new grain width genes, especially natural variations without negative effects on quality and yield. SUMMARY

[0004] In view of the need for research on grain width gene variation in the prior art, the application provides a rice grain width related molecular marker and application thereof, and the specific technical solutions are as follows:

[0005] In a first aspect, the application provides a rice grain width related molecular marker, which is located at 13789514bp on chromosome 1, and has a single nucleotide mutation T / C.

[0006] Further, the sequence of the molecular marker is shown in SEQ ID NO. 1.

[0007] Further, the primer set for amplifying the molecular marker comprises a forward external primer, a reverse external primer, a forward internal primer and a reverse internal primer, the nucleotide sequence of the forward external primer is shown in SEQ ID NO. 2, the nucleotide sequence of the reverse external primer is shown in SEQ ID NO. 3, the nucleotide sequence of the forward internal primer is shown in SEQ ID NO. 4, and the nucleotide sequence of the reverse internal primer is shown in SEQ ID NO. 5.

[0008] The present application is based on QTL-seq of F2 population of small-grain indica rice (DR610) and large-grain japonica rice (Ha japonica 7, HG7) and joint analysis of known grain type genes, and finds that the genotype of nucleotide 1048 of OsNF-YC10 gene has a significant effect on grain width of rice, and the grain width of rice variety with genotype C at the site is significantly larger than that of variety with genotype T. Furthermore, the present application develops a molecular marker for distinguishing C / T variation using four-primer ARMS-PCR, which can be used for molecular marker assisted selection of grain type.

[0009] In the second aspect, the present application provides a primer set for detecting the above-mentioned grain width related molecular marker of rice, which comprises a forward external primer, a reverse external primer, a forward internal primer and a reverse internal primer, the nucleotide sequence of the forward external primer is shown as SEQ ID NO. 2, the nucleotide sequence of the reverse external primer is shown as SEQ ID NO. 3, the nucleotide sequence of the forward internal primer is shown as SEQ ID NO. 4, and the nucleotide sequence of the reverse internal primer is shown as SEQ ID NO. 5.

[0010] In the third aspect, the present application provides the above-mentioned molecular marker or the above-mentioned primer pair for use in molecular marker assisted breeding of rice.

[0011] In the fourth aspect, the present application provides the above-mentioned molecular marker or the above-mentioned primer pair for use in screening of rice germplasm resources with different grain width.

[0012] Further, the application approach is that the genomic DNA of the rice sample to be tested is used as a template, and PCR amplification is performed using the primer set to detect the genotype of the gene at position 13789514 bp on chromosome 1 of the genomic DNA of the rice sample to be tested as T genotype or C genotype.

[0013] Further, if the rice sample to be tested is of C genotype, it indicates that the rice to be tested is of large-grain genotype, and if the rice sample to be tested is of T genotype, it indicates that the rice to be tested is of small-grain genotype.

[0014] Further, the rice is japonica rice or indica rice.

[0015] Further, the rice is DR610 or HG7.

[0016] Compared with the prior art, the present application has the following beneficial effects:

[0017] The application has significant influence on rice grain width by genotypes of nucleotide at 1048th position of rice OsNF-YC10 gene through QTL-seq of extreme grain weight individuals of F2 population of small-grain indica rice (DR610) and large-grain japonica rice (Ha japonica 7, HG7) and joint analysis of known grain type genes, and a molecular marker distinguishing C→T variation is developed by using four-primer ARMS-PCR, which can be used for molecular marker assisted selection of grain type and provides important reference for breeding design of rice grain width. BRIEF DESCRIPTION OF DRAWINGS

[0018] Figure 1 Figure 1 is a grain appearance map and a thousand-grain weight statistical map; wherein, a and b are grain appearance pictures, the scale is 1 cm; c~f are grain length, grain width, length-width ratio and thousand-grain weight statistical maps (mean ± standard deviation, n = 3), single factor variance and Bonferroni multiple comparison test analysis, different letters represent P < 0.05, F1 represents F1 seeds.

[0019] Figure 2 Figure 2 is a distribution frequency map of different thousand-grain weights of DR610 x HG7 hybrid F2 single plants.

[0020] Figure 3 Figure 3 is a diagram of QTL-seq and candidate gene identification results of rice grain weight; wherein, a is a SNP-index map of QTL-seq analysis, b is an InDel-index map of QTL-seq analysis, the red arrow represents the candidate region, c is the annotated genes reported to affect grain type on chromosome 1 and 3, the red color represents the genes with differences in CDS between parents, and the yellow background gene is the gene with intersection between the grain weight QTL region and the known grain type gene on chromosome 1.

[0021] Figure 4 Figure 4 is a genotype quantity statistical map of OsNF-YC10 13789514 SNP of DR610 x HG7 and a grain width statistical map of different genotypes; wherein, a is a genotype and single plant number statistical map in the large-grain pool, b is a genotype and single plant number statistical map in the small-grain pool, c is the grain width of single plants of different OsNF-YC10 genotypes, genotype represents genotype, including CC, TT, CT, L01, L10, L17 represent No. 1, 10, 17 plants in the large-grain pool, S01, S06, S10 represent No. 1, 6, 10 plants in the small-grain pool.

[0022] Figure 5 Figure 5 is a correlation analysis diagram of OsNF-YC10 natural variation genotypes and grain width in Example 3, p < 0.01.

[0023] Figure 6Figure 2 is a gel electrophoresis analysis diagram of SNP genotyping of the 1048th nucleotide of the OsNF-YC10 gene based on four-primer ARMS-PCR; wherein genotype represents genotype, including CC, TT, CT, F1 represents F1 seed, L01 and L04 represent No. 1 and No. 4 plants in the large-grain pool, and S01 represents No. 1 plant in the small-grain pool. DETAILED DESCRIPTION

[0024] In order for those skilled in the art to better understand the present application, the technical solutions of the present application will be described in detail below in combination with specific examples. It should be pointed out that the following detailed description is exemplary and only a part of the embodiments of the present application, but not all the embodiments.

[0025] Based on the embodiments in the present application, all other embodiments obtained by those skilled in the art without making creative efforts shall fall within the scope of protection of the present application.

[0026] Unless otherwise specified, all technical and scientific terms used herein have the same meanings as generally understood by those skilled in the art to which the present application belongs. The experimental materials used in the embodiments of the present application are all conventional experimental materials in the art and can be purchased through commercial channels. The experimental methods without detailed conditions are performed according to conventional experimental methods or according to the operation instructions recommended by the suppliers.

[0027] In the following examples, rice materials DR610 and HG7 are used. DR610 is a indica type wide compatibility restorer line, which is jointly bred by Wuxi Habo Biological Seed Industry Technology Research Institute Co., Ltd. and Zhejiang University, and belongs to small-grain type material. Harbin japonica rice No. 7 (HG7) is a large-grain japonica rice variety bred by Harbin Academy of Agricultural Sciences, with wide and long grains.

[0028] In the following examples, all PCR primers are synthesized by Beijing Chengke Biological Technology Co., Ltd.; and the sequencing of PCR products is completed by Shenzhen Huada Gene Technology Co., Ltd. Microsoft Excel 2019 is used to statistically analyze the segregation ratio of OsNF-YC10 in F2 large-grain and small-grain pools, and SPSS is used to analyze the correlation between OsNF-YC10 haplotype and grain width.

[0029] In the following examples, the nucleotide sequence of OsNF-YC10 is shown in SEQ ID NO. 1.

[0030] SEQ ID NO. 1:

[0031] ATGAAGCAAACTTTGGATGTACATAGATCGTTGAGGCCACCAATGCCAATGGCTCAACAACAAATGGATGAATTTTGGAGGGACCGACAAAAGGAGATTGAGATGACAAAGGACTTCAGTGAGCACATGATCCCTATGGCCCGCTTGAAGAAGATCGTATCTTCTCAAAAGGGTAACATGATGATGACCTTTGACATGCCAGCGTTCTTATCAAAGATGTGTGAGCTCTTTGTACAAGAACTTGCTGCGCGTGCATGGGCATGTGCCCAATCTCATAACCGATGCATCATACTAGACATGGATATTGCTGAAGCCGTAGCCTCTACTGAGTCTTATGACTTTCTTGTTGATATCCTCCACAATCACAGTGTGAAGCAAAAATCCACTCCTTGTTCTTCCACCAAGCGTTGTAGGTTAGTTGATCAACCTTCTACATCTCACATTCCCCACCAACATCTGCTGCCACAGTTTGCTCCTACATATACTTTGGCCATCCCTATTACTCCTAGTTTAATGCCATTAATTTCTCAATGCACACCATCCTCTTTTCCATCCTTGCCACAAGAAAAGTTCCCATTGATGGCACCCACACCCATTGTGAATAGATCAATGTTGTTTATCAATAATATAGCAAGGGGTCTGGGCTTACAAGGAAACAATATCAATGCAGTTGCCAACAATAATATCCTAGACAATATTGTTGGTTGTAGTAGCCCTGCGGTTCTTGCAAGTATGATGAATCCTGCTTTACTTGGGCCTTCAGGGGCACCACTAAATCCTCCAAACTCCCAATCCTACAACTGCACAATGGATATAATTAACTCCAATGATGCTTGTGGTTCCAATAATAGTAGCGTAATTGTTGCAAATCAAGCAAATATTGCTCCCT.

[0032] Example 1: Obtaining Rice Materials

[0033] Using DR610 as the female parent, it was crossed with Hajingdao 7 (HG7) to obtain F1 seeds. After sowing the F1 seeds, F2 seeds were harvested. In the F2 population, seeds from 203 F2 plants were harvested per plant and numbered.

[0034] Complete and plump seeds from DR610, HG7, and F1 varieties were selected. Seed length and width were measured, and the length-to-width ratio was calculated. The measurement was repeated three times, with 10 seeds per unit. Additionally, 1000 complete and plump seeds were weighed, and the weight of 1000 seeds was calculated, with three replicates. Results are as follows: Figure 1 As shown, by Figure 1 a and Figure 1 b shows that HG7 kernels are thick and long, composed of... Figure 1 As can be seen from c to f, the grain length, grain width, length-to-width ratio, and thousand-grain weight of HG7 are significantly greater than those of DR610, being 1.5, 1.1, 1.3, and 1.9 times that of DR610, respectively. The F1 hybrid seeds of the two are intermediate between the two parents and show significant differences from both parents.

[0035] F2 seeds, 1000 full and plump seeds were weighed, 3 replicates, and the thousand kernel weight was calculated. The results are shown in Table 1. In the F2 population, different thousand kernel weight single plants appeared, and the thousand kernel weight of most single plants was lower than that of DR610, and the single plants with higher thousand kernel weight than HG7 were very few, and the overall showed a pattern similar to normal distribution. Figure 2

[0036] Example 2 Sequencing of rice genotypes and screening of gene sites

[0037] Before harvesting, according to the single plant number of F2 plants, leaf blades were taken and stored in a -80°C freezer for standby. According to the thousand kernel weight test results, 20 plants with extremely large thousand kernel weight were selected, and their leaf genomic DNA was extracted using the CTAB method, mixed in equal amounts to form a large grain mixing pool (numbered L01-L20). The parent and large grain mixing pool samples were sequenced in depth (20x) based on the Illumina HiSeq 2500 platform (Beijing Baimaikesi Biological Technology Co., Ltd.).

[0038] The raw reads obtained by sequencing were subjected to quality control to obtain clean reads.

[0039] The clean reads and reference genome (IRGSP-1.0) were aligned using BWA software (https: / / bio-bwa.sourceforge.net / ), and the alignment rate, genome coverage, and sequencing depth of each sample were calculated. The recommended algorithm of GATK was used to detect SNP and InDel (insertion and deletion) sites.

[0040] The sequencing results of HG7, DR610 and their F2 large grain mixing pool (LGMP) composed of 20 single plants with thousand kernel weight greater than 29 grams are shown in Table 1. The average sequencing depth of the three was 30x, 43x and 37x, respectively, and more than 90.7% of the clean reads could be aligned to the Nipponbare reference genome, and the genome coverage was more than 92.73%.

[0041] Table 1 Sequencing data and statistics of DR610, HG7 and their F2 large grain mixing pool

[0042]

[0043] ​At the National Rice Data Center (https: / / www.ric-edata.cn / ), according to the term name such as grain length (accession number TO:0000734), grain width (accession number TO:0000402), and grain thickness (accession number TO:0000399), the grain type genes regulating rice were screened out. According to the Locus number of the grain type genes, TBtools was used to map them to the corresponding positions of the chromosomes.

[0044] At EnsemblPlants (https: / / plants.ensembl.org / in-fo / data / ftp / index.html), three files containing information of the reference genome, transcriptome, and gene annotation of rice, respectively, were downloaded; the resequencing data of DR610 and HG7 were aligned to the Nipponbare reference genome by using BWA software, SNP and Indel variations were mined by using GATK software, and annotation was performed by using ANNOVAR software, and the SNP-index and InDel-index of the high-quality SNP sites of the large-grain pool were calculated, respectively, and the corresponding distribution graphs (the SNP-index distribution graph is shown in Fig. Figure 3 a, and the InDel-index distribution graph is shown in Fig. Figure 3 b) were drawn, and at a 99% confidence level, a total of 4 grain weight QTL regions were identified on chromosomes 1 and 3, with a total length of 1.84 Mb (as shown in Table 2). In the coding sequence (CDS) in the parents, a total of 122 annotated genes were included in the grain weight QTL region, of which 66 genes had functional differences between the parents, including frameshift mutations and premature termination mutations.

[0045] Table 2 Four grain weight QTL genomic intervals determined by QTL-seq of the large-grain pool of DR610 x HG7 F2 and the number of annotated genes included therein

[0046]

[0047] On chromosomes 1 and 3, 75 genes that can regulate the grain type of rice have been previously reported, of which 36 genes have sequence differences in the coding regions between DR610 and HG7 (as shown in Fig. Figure 3 c), and further analysis found that only OsNF-YC10 located on chromosome 1 was included in the intersection of the 36 gene set and the 66 grain weight QTL candidate gene set.

[0048] Primers were designed by using Snapgene software (as shown in Table 3), and OsNF-YC10 full-length parts were amplified by PCR, and the peak graph was viewed by using Snapgene software to obtain the site of sequence difference of OsNF-YC10 in the parents.

[0049] Table 3

[0050]

[0051] Genome sequencing and PCR amplification product sequencing results showed that there were 15 nucleotide differences between DR610 and HG7, including 5 synonymous variations, 9 non-synonymous variations and 1 nonsense variation. Sequence alignment found that the genotype of HG7 was completely consistent with that of Nipponbare, while the 1048th nucleotide of DR610 was mutated from C to T, resulting in the appearance of a stop codon in advance.

[0052] The single plants in LGMP and F2 small grain mixing pool (SGMP, numbered S01-S20) were genotyped for 13789514 SNP site (1048th nucleotide of OsNF-YC10), and the results are shown in Figure 4 .

[0053] As can be seen from Figure 4 a, in LGMP, the frequency of genotype CC (wild type) was as high as 60%, and the frequency of genotype TT was only 10%, and the ratio of CC:CT:TT single plants significantly deviated from random segregation (χ2=13.2, P=0.00136). As can be seen from Figure 4 b, in SGMP, the frequency of TT type single plants was as high as 60%, and the ratio of CC:CT:TT single plants also significantly deviated from random segregation (χ2=13.1, P=0.00143).

[0054] Statistical analysis of grain width of single plants in LGMP and SGMP is shown in Figure 4 c, and the grain width of single plants with the same OsNF-YC10 genotype showed no significant difference, while the grain width of single plants with different genotypes showed significant difference, the grain of CC type was wider than that of CT type, and the grain of CT type was wider than that of TT type, and the difference reached a significant level. The above results showed that the genotyping of the 1048th nucleotide of OsNF-YC10 gene was an important determinant of the difference in grain width of DR610 and HG7 and their F2 plants, and it could be used as a molecular marker related to rice grain width.

[0055] Example 3 Correlation between OsNF-YC10 haplotype and grain width

[0056] In the 3k rice germplasm collections (3k RGC; snp-seek.irri.org / index.zul) library, the "grain width" phenotype data were downloaded, and 1905 germplasms with homozygous genotypes of grain width data were selected. According to the genotypes of nucleotide 1048 of OsNF-YC10, they were divided into two haplotypes, Hap T and Hap C . The encoded proteins of Hap T exhibited truncation, and the encoded proteins of Hap C existed amino acid differences, but had no significant effect on protein conformation.

[0057] Statistical analysis of grain width of the two types of haplotype varieties was performed, and the results are shown in Figure 5 . The grain width of Hap C (3.036 mm, n = 1596) was significantly greater than that of Hap T (2.938 mm, n = 309). This result further indicated that the variation of the site significantly affected the grain width of rice.

[0058] Example 4 Development of molecular markers and detection primers

[0059] OsNF-YC10 Tetra-primer ARMS-PCR allele-specific and universal primers were designed using Snapgene (as shown in Table 4). The volume of ARMS-PCR was 30 μl, the template DNA was 0.1 μg, the forward external primer and the reverse external primer were 0.5 pmol each, the forward internal primer and the reverse internal primer were 0.8 pmol and 1.3 pmol respectively, 15 μL Taq DNA polymerase (Nanjing Novoprotein Biotech Co., Ltd.), and ddH2O was added to 30 μL. The PCR program was as follows: 95℃ for 5 min; 95℃ for 1 min, 60℃ for 1 min, 72℃ for 1 min, for a total of 35 cycles; 72℃ for 10 min. The PCR products were analyzed by 1% agarose gel electrophoresis in TBE 1X buffer containing ethidium bromide. The gel electrophoresis maps of different genotypes are shown in Figure 6 .

[0060] Table 4 Tetra-primer ARMS-PCR

[0061]

[0062] Note: The lowercase bases in the primer sequence are the mismatched bases in the allele-specific primer and the DNA template.

[0063] As shown in Figure 6As can be seen, using the primers in Table 3 for ARMS-PCR on rice, the genotype of the 1048th nucleotide of OsNF-YC10 of the rice can be accurately determined by gel electrophoresis analysis.

Claims

1. Use of a molecular marker associated with grain width in rice in marker-assisted breeding of rice, characterized in that, The sequence of the molecular marker is shown as SEQ ID NO. 1, and the base at position 1048 is T or C; The assisted breeding trait is rice grain width; the CC type grain is wider than the CT type grain, and the CT type grain is wider than the TT type grain; The rice is DR610 or HG7 and the hybrid offspring of the two.

2. The use of the primer set for detecting the SNP site related to the grain width of rice in screening rice germplasm resources with different grain width, characterized in that, The SNP site is located at 13789514bp on the first chromosome of the rice, and there is a single base mutation T / C of nucleotide; the reference genome is IRGSP-1.0; The CC type grain is wider than the CT type grain, and the CT type grain is wider than the TT type grain; The rice is DR610 or HG7 and the hybrid offspring of the two.

3. Use according to claim 2, characterized in that, The primer set comprises a forward external primer, a reverse external primer, a forward internal primer and a reverse internal primer; the nucleotide sequence of the forward external primer is shown as SEQ ID NO. 2, the nucleotide sequence of the reverse external primer is shown as SEQ ID NO. 3, the nucleotide sequence of the forward internal primer is shown as SEQ ID NO. 4, and the nucleotide sequence of the reverse internal primer is shown as SEQ ID NO.

5.

4. Use according to claim 3, characterized in that, The application approach is that the genomic DNA of the rice sample to be tested is used as a template, the primer set is used for PCR amplification, and the genotype at 13789514bp on the first chromosome in the genomic DNA of the rice sample to be tested is detected.