Method for determining chromosome copy number and specific gene carrying chain by using embryo culture solution

Abstract

The invention discloses a method for determining a chromosome copy number and a specific gene carrying chain by using an embryo culture solution. The method can be used for simultaneously detecting embryo chromosome abnormality and a specific gene carrying state. The method comprises the following steps: firstly, collecting blood sample DNA of two specific gene carriers, a pre-certified person or a last generation of relatives; constructing an STR haplotype, designing an STR site primer for amplification, and determining a family haplotype through electrophoretic analysis; the method comprises the following steps: carrying out whole genome amplification on a collected trace free DNA sample of a trace cell or embryo culture solution by using a Pi coPLEX method, respectively designing primers for amplification products aiming at monogenic disease types and mutation sites, and directly detecting pathogenic genes; performing second-generation sequencing, and comparing with a normal sequence to analyze and judge the copy number of chromosomes; primer amplification is designed according to the constructed family distinguishing type STR site, STR site haplotype information is obtained, whether a specific gene variation chain is inherited or not is judged, and therefore an euploid embryo which does not carry a specific gene is efficiently screened out.

Description

Technical Field

[0001] The invention relates to the fields of biomedicine and molecular cell biology, and in particular to a method for determining chromosome copy numbers and specific gene carrying chains using embryo culture fluid. Background Art

[0002] Preimplantation Genetic Test (PGT) is a genetic test conducted before implantation into the mother based on in vitro fertilization-embryo transfer technology, combined with micromanipulation technology and single-cell DNA molecular biology detection technology.

[0003] For example, Chinese patent CN105368936B discloses a method for detecting embryonic chromosomal abnormalities using blastocyst culture fluid. This method detects embryo-derived free DNA from early embryo in vitro culture fluid, i.e., blastocyst culture fluid, uniformly amplifies the whole genome of the trace DNA, and then uses methods such as second-generation sequencing to analyze the amplified DNA products, thereby determining the chromosomal status of the embryo. Chinese patent CN115678964B discloses a non-invasive screening method for preimplantation embryos based on embryo culture fluid. This method performs methylation detection on free DNA in the culture fluid of the preimplantation embryo to be tested, and selects embryos with normal chromosomes and normal DNA methylation levels from the preimplantation embryo to be tested as embryos to be implanted based on the obtained test results. It belongs to a method of preimplantation genetic testing.

[0004] At present, most reproductive centers adopt the method of blastocyst trophectoderm biopsy to obtain the cells required for preimplantation genetic testing. However, the operating equipment required for this technology is expensive, and the requirements for the operator's skills and time nodes are quite high, which limits the full development of this technology; invasive operation and repeated freezing and thawing of embryos not only increase the risk of reduced embryo scoring quality, embryo arrest, and even apoptosis, but also increase the possibility of abnormal epigenetic modification affecting the developmental potential and safety of offspring. For embryos that have not formed blastocysts or have low morphological scores but still have developmental potential, due to the increased difficulty of biopsy and the limitations of operating technology, these embryos may lose the opportunity for biopsy, testing, and transplantation, reducing the utilization rate of such embryos. In addition, in order to avoid risks, when performing blastocyst trophectoderm biopsy, only 5-10 cells of the trophectoderm are often collected for biopsy. These biopsied cells are inevitably interfered by chimera factors and cannot reflect the genetic material information of the entire embryo. There is still room for exploration and development on the accuracy of their test results. In addition, considering its invasiveness and technical complexity, the strict formulation of PGT indicators limits the needs of some couples where only one partner is a carrier and wants to screen to avoid the birth of a carrier fetus.

[0005] As some free genomic DNA and mitochondrial DNA can be detected in embryo culture medium, it has been confirmed that free DNA in the culture medium can provide the genetic material basis for non-invasive testing of embryos. By detecting the free DNA genetic material in the culture medium, the genetic information of the corresponding embryo can be indirectly reflected, making it possible to achieve non-invasive preimplantation genetic testing (ni-PGT). The amount of free DNA template based on the culture medium is small, and whole genome amplification (WGA) can achieve high-fidelity and effective amplification of trace or extremely trace DNA, which is an effective way to solve this problem.

[0006] At present, a variety of WGA methods have been developed, including SurePlex based on degenerate oligonucleotide primer PCR technology, multiple displacement amplification (MDA), multiple annealing and looping-based amplification cycles (MALBAC), etc. SurePlex uses oligonucleotide primers with partially degenerate sequences, which can randomly bind to genomic DNA to achieve amplification of the entire genome, with better gene coverage, less amplification deviation, and simpler and faster operation.

[0007] There are many types of single-gene genetic diseases with a high overall incidence rate, which has posed a great threat to human health. Some single-gene genetic diseases are often lethal, disabling or teratogenic, and there is a lack of effective treatment methods. Reducing the birth of such children through genetic counseling and preimplantation diagnosis is the focus of prevention and control of genetic birth defects. In addition, studies have shown that abnormal chromosome number and structural abnormalities are the main causes of implantation failure and miscarriage. Therefore, for patients with single-gene diseases, in order to avoid unclear diagnosis caused by factors such as failure to amplify pathogenic genes and allele drop-out (ADO). In clinical diagnosis of single-gene diseases, single nucleotide polymorphisms (SNPs) or short tandem repeats (STR) sites are often used as genetic markers for linkage analysis. STR has the advantages of easy operation and short time. Since the amount of free DNA template in the blastocyst culture medium is small, the DNA is fragmented, the concentration is diluted by the culture medium, there are other interfering factors such as culture medium contamination, and monogenic diseases have higher template requirements for downstream genetic testing and analysis, non-invasive preimplantation testing based on trace free DNA in the culture medium of monogenic disease carriers has always faced greater challenges. Summary of the invention

[0008] In order to solve the above technical problems, the present invention provides a method for simultaneously detecting embryonic chromosomal abnormalities and the carrier status of pathogenic genes for single gene diseases. Through non-diagnostic and non-therapeutic detection methods, the previous technical barriers and difficulties are overcome. Based on embryo culture medium, after SurePlex amplification, second-generation sequencing combined with STR family linkage analysis is used to achieve simultaneous determination of chromosome copy number and specific gene carrier chain.

[0009] By using blastocyst culture medium and blood amplification to construct STR haplotypes and perform comparisons, a non-invasive preimplantation diagnosis system for single-gene diseases was established to assist doctors in simultaneously determining embryonic chromosomal abnormalities and single-gene disease pathogenic gene carrier status for assisted reproduction and pregnancy.

[0010] The specific technical solutions are as follows:

[0011] A method for determining chromosome copy number and specific gene carrying chain using embryo culture medium. The method simultaneously detects chromosome euploidy and pathogenic gene carrying status of free DNA in the culture medium of the pre-implantation embryo to be tested, and screens out embryos with normal chromosomes and not carrying known specific genes from the pre-implantation embryos to be tested as embryos to be implanted based on the obtained test results.

[0012] The method specifically comprises the following steps:

[0013] S1: Sample collection:

[0014] S101: Extract DNA samples from the blood samples of both carriers of a specific gene (single gene disease-causing gene) and the proband or the previous generation relative; wherein the DNA of both carriers of the specific gene is the first sample, and the DNA of the proband or the previous generation relative is the first sample.

[0015] The DNA of the parents of the specific gene carriers is the second sample;

[0016] S102: The gametes of both specific gene carriers are injected into the oocytes to obtain fertilized eggs, which are cultured to blastocysts, and the biopsy tissues of the formed blastocysts and the arrested embryos, as well as the remaining culture medium of the corresponding embryos, are collected;

[0017] The blastocyst biopsy tissue and the arrested embryo, as well as a trace amount of DNA in the remaining culture medium corresponding to the embryo are the third sample.

[0018] S2: Construction of STR haplotypes:

[0019] S201: Design primers for STR loci and perform PCR amplification;

[0020] S202: The amplified product of S201 is subjected to capillary electrophoresis to analyze the result data and determine the STR haplotype; STR locus sequences that effectively distinguish haplotypes are screened from the STR information of the father and the mother, and the target gene haplotypes of the father and the mother are determined by combining the sequencing information of the STR loci with the STR information of the second sample, where the second sample is derived from the proband, or the DNA of the parents of the previous generation of the specific gene carrier);

[0021] S3: The third sample collected in S1 is amplified by the PicoPLEX method to obtain a whole genome amplification product. The PicoPLEX method uses 3 ， The six bases ATGTGG at the end of the genome, which are highly distributed in the human body, are used as guides, and the six bases are used as random sequences to determine the specific amplification start site, and amplification is performed to obtain the whole genome amplification product.

[0022] S4: The whole genome amplification product of S3 is directly tested for pathogenic sites, that is, primers are designed for the whole genome amplification product of S3 according to the type of monogenic disease and mutation site, and Sanger sequencing is performed. The third sample collected in S1 is used as the sample to be tested, and the third sample is directly tested to see if it carries the abnormal gene at the corresponding site of the monogenic disease family;

[0023] S5: Perform next generation sequencing on the whole genome amplification product of S3; filter the obtained data and compare it with the reference gene. After analyzing the comparison results, the chromosome copy number of the sample to be tested is obtained to determine whether the chromosome number is abnormal;

[0024] S6: STR locus linkage analysis of the third sample:

[0025] S601: The whole genome amplification products of S3 were amplified by PCR using primers designed based on the distinguishing STR loci screened from the corresponding specific gene loci of the family of patients with monogenic diseases in S201, and the amplified products were subjected to capillary electrophoresis to obtain the STR locus haplotype information;

[0026] S602: Based on the paternal and maternal haplotype chains constructed in S202, determine whether the sample to be tested has inherited the variant chain.

[0027] Furthermore, the STR loci in step S201 are designed and obtained based on the corresponding pathogenic gene loci of the family of patients with monogenic diseases.

[0028] Furthermore, the primer design and molecular biology techniques in the method for directly detecting the single gene pathogenicity site in S4 are designed based on the pathogenicity site genes of patients with single gene diseases.

[0029] Furthermore, the establishment of the haplotype of a family with a single gene disease in S2 requires a first sample (DNA of both carrier spouses) and a second sample (DNA sample of the proband's blood, or DNA samples of the parents of the previous generation who were carriers of the specific gene); when there are no samples of the proband and the parents of the previous generation who are carriers of the gene, reverse reasoning can be used using embryos of carriers of the specific gene. In this case, at least one homozygous gene carrier embryo, or at least four heterozygous gene carrier embryos with distinguishing phenotypes, is required.

[0030] Furthermore, at least 4 pairs of differentiating STR loci are designed in S201.

[0031] Furthermore, the detection object of this method is the third sample.

[0032] Furthermore, the third sample in the sample collection of S1 is immediately placed in a PCR storage tube containing 5 microliters of 1xPBS and 0.2 ml after collection, and the specimens that are not sent for inspection in time are promptly stored in a -80°C refrigerator.

[0033] Furthermore, the method for whole genome amplification of trace free DNA in culture medium in S3 is PicoPLEX, and the method steps include:

[0034] Step 1: Centrifuge 0.2 ml PCR tube containing the sample to be tested at low speed for 10 seconds to make sure there are no obvious droplets on the tube wall and lid;

[0035] Step 2, pre-amplification reaction;

[0036] Step 3, performing an amplification reaction on the pre-amplification product;

[0037] Step 4, Qubit quantification of the amplified product;

[0038] Step 5, DNA purification: The DNA obtained after PCR amplification is purified to remove impurities that may be introduced during the PCR reaction.

[0039] Furthermore, it is characterized in that the product of whole genome amplification of trace free DNA in the culture solution in S5 is subjected to high-throughput sequencing, and the method steps include:

[0040] i. Fragmentation of genomic DNA: using enzyme digestion to randomly break large DNA fragments into small DNA fragments, with the size of the fragments being around 500 bp;

[0041] ii. Fragment the target gene for analysis and quantification; use Qubit dsDNA HS Assay Kit for fragment size and quantification;

[0042] ⅲ. Library construction: Use the Aoji core single-cell sequencing library construction kit. The main steps include end repair: the 3' protruding end of the DNA after the fragment is removed, and the 5' concave end is filled, converted into 5'-phosphate and 3'-phosphate blunt-end DNA, an A tail is added, and then dA is added to the 3' end of the DNA to convert it into a sticky end for subsequent complementary pairing with the adapter; and the 5' end of the DNA is phosphorylated; then the repaired fragments are connected with adapters: mainly using DNA ligase to connect the DNA fragment with dA at the 3' end to the adapter adapter; the DNA fragments after the adapter connection are PCR amplified, and the amplified products contain a large number of Insert Fragments of the forward and reverse chains of the original template; then the PCR products are purified by magnetic beads, and the qualified products after purification can be used for high-throughput sequencing;

[0043] iv. Sequencing: After the library is qualified in quality inspection, the genome is sequenced using the second generation sequencing technology. The present invention uses the BGI200 sequencing platform;

[0044] ⅴ. Bioinformatics analysis: Perform bioinformatics analysis on the sequencing results. After the filtered data is compared with the reference gene, the chromosome euploidy result of the sample to be tested is obtained.

[0045] Compared with the prior art, the present invention has the following beneficial effects:

[0046] (1) This method is a non-invasive preimplantation genetic test for single-gene diseases based on culture medium PicoPLEX combined with STR linkage, and is the first application of this test method;

[0047] (2) The technical solution system of the present invention achieves a detection efficiency of nearly 90%, which is higher than the existing detection rate, and the method can be further optimized to improve the detection rate;

[0048] (3) PicoPLEX uses oligonucleotide primers with partially degenerate sequences that can randomly bind to genomic DNA, thereby achieving amplification of the entire genome;

[0049] (4) PicoPLEX is more operable, with better gene coverage and less amplification bias. BRIEF DESCRIPTION OF THE DRAWINGS

[0050] Figure 1 It is the pedigree of the specimen to be tested;

[0051] Figure 2 Verification of WDR19c.1595T>C in the family

[0052] Figure 3 Verification of the family WDR19c.l248 T>C

[0053] Figure 4 This is a flowchart of the preliminary experimental STR haplotype construction and embryo sample collection according to the embodiment of the present invention;

[0054] Figure 5 This is a flow chart of whole genome amplification, direct detection of pathogenic sites, STR haplotype analysis and CNV analysis described in an embodiment of the present invention;

[0055] Figure 6 This is a graph showing the CNV analysis and pathogenicity site detection results described in an embodiment of the present invention;

[0056] Figure 7 This is a graph showing the results of the STR haplotype linkage analysis described in the embodiment of the present invention;

[0057] Figure 8 This is a statistical table of culture medium and embryo tissue results described in the embodiments of the present invention;

[0058] Fig. 9 This is the STR linkage family described in the embodiment of the present invention Figure 1 ;

[0059] Fig.10 This is the STR linkage family described in the embodiment of the present invention Figure 2 ;

[0060] Fig.11 It is the chromosome CNV map corresponding to the sample E-1 after high-throughput sequencing;

[0061] Fig.12 It is the chromosome CNV map corresponding to the sample N-1 to be tested after high-throughput sequencing;

[0062] Fig.13 It is the chromosome CNV map corresponding to the sample E-2 after high-throughput sequencing;

[0063] Fig.14 It is the chromosome CNV map corresponding to the sample N-2 to be tested after high-throughput sequencing;

[0064] Fig.15 This is the chromosome CNV map of the corresponding sample E-3 after high-throughput sequencing;

[0065] Fig.16 It is the chromosome CNV map corresponding to the sample N-3 after high-throughput sequencing;

[0066] Fig.17 This is the chromosome CNV map of the corresponding sample E-4 after high-throughput sequencing;

[0067] Fig.18 This is the chromosome CNV map corresponding to the sample N-4 after high-throughput sequencing;

[0068] Fig.19This is the chromosome CNV map of the corresponding sample E-5 after high-throughput sequencing;

[0069] Fig. 20 This is the chromosome CNV map of the corresponding sample N-5 after high-throughput sequencing;

[0070] Fig.21 This is the chromosome CNV map of the corresponding sample E-6 after high-throughput sequencing;

[0071] Fig. 22 This is the chromosome CNV map of the corresponding sample N-6 after high-throughput sequencing;

[0072] Fig.23 This is the chromosome CNV map of the corresponding sample E-7 after high-throughput sequencing;

[0073] Fig.24 This is the chromosome CNV map of the corresponding sample N-7 after high-throughput sequencing;

[0074] Fig.25 This is the chromosome CNV map of the corresponding sample E-8 after high-throughput sequencing;

[0075] Fig.26 This is the chromosome CNV map of the corresponding sample E-9 after high-throughput sequencing;

[0076] Fig. 27 This is the chromosome CNV map of the corresponding sample N-9 after high-throughput sequencing;

[0077] Fig.28 It is the chromosome CNV map of the corresponding sample after E-10 high-throughput sequencing;

[0078] Fig.29 It is the chromosome CNV map corresponding to the sample N-10 to be tested after high-throughput sequencing;

[0079] Fig.30 This is the chromosome CNV map of the corresponding sample N-11 after high-throughput sequencing;

[0080] Fig.31 This is the chromosome CNV map of the corresponding sample N-12 after high-throughput sequencing; DETAILED DESCRIPTION

[0081] In order to make the purpose, technical scheme and advantages of the present invention clearer, the present invention is further described in detail below in conjunction with specific embodiments and with reference to the accompanying drawings. It should be understood that these descriptions are only exemplary and are not intended to limit the scope of the present invention. In addition, in the following invention, the description of well-known structures and technologies is omitted to avoid unnecessary confusion of the concept of the present invention.

[0082] See also Figure 2 and Figure 3 The present invention is a method for simultaneously determining the chromosome copy number and the specific gene carrying status based on embryo culture medium. The method includes the collection of culture medium and embryo samples and single-cell amplification, chromosome abnormality analysis based on high-throughput sequencing, direct detection of specific pathogenic sites of single gene diseases, and STR haplotype construction and linkage analysis.

[0083] It can be understood that the detection object of this detection method is the embryo culture medium, which indirectly reflects the genetic information of the embryo. The embryo is not directly operated. In addition, the indirect reaction object is the embryo that has not been implanted in the uterus, not the human body or animal. The detection results do not involve the disease diagnosis results of both parents. Therefore, it does not belong to disease diagnosis and treatment methods.

[0084] Example 1: Analysis of nephronophthisis type 13 (autosomal recessive inheritance) based on culture medium chromosome euploidy and single gene carrier status

[0085] A case of a patient who received assisted reproductive technology in a hospital in Yunnan Province was collected. The patient was recommended to consider PGT-A due to her advanced age, repeated implantation failures, and poor reproductive history. And genetic testing showed that the patient was a carrier of the WDR19 gene. The female had a heterozygous variation of the WDR19c.1595T>C gene, the chromosome position was Chr4:39336619, the transcript number nucleotide change was NM_025132.3, WDR19c.1595T>C, p.TieS32Thr; the male had a heterozygous variation of the WDR19c.l248 T>C gene, the chromosome position was Chr4:39336619, the transcript number nucleotide change was NM_025132.3, WDR19c.l248 T>C, p.Asn416Asn, and the proband had heterozygous variations of the WDR19c.1595T>C and WDR19c.l248 T>C genes (the family diagram is shown in the figure). Figure 1 ), the site verification is as follows Figure 2 and Figure 3 shown).

[0086] The clinical significance of WDR19 gene mutation is unclear and does not meet the PGT-M intervention index. The patient and his wife were fully informed of the specific gene and chromosome euploidy of the biopsy tissue, arrested embryos and corresponding embryo culture medium for the purpose of scientific research, and as a reference for later transplantation. After being fully informed, they signed the informed consent form in person, and the research plan was approved by the ethics committee of a hospital in Yunnan.

[0087] Sample collection and process Figure 4 As shown:

[0088] For the carrier couple, 5 ml of peripheral blood was drawn from both parties for DNA extraction (first sample), followed by STR locus amplification; based on the STR information of the proband, the paternal and maternal chains were inferred to construct the family haplotype. The arrested blastocysts and corresponding culture medium of the carrier couple, as well as the blastocyst culture medium of non-arrested blastocysts, were collected, and the samples to be tested were subjected to Sureplex whole genome amplification, and the pathogenic gene loci were directly detected according to the primers determined and set according to the pathogenic loci; haplotype analysis was performed after amplification with STR primers designed for the pathogenic loci, and the chains from the father and mother were compared to determine whether the double strands of the sample to be tested came from the chain carrying the pathogenic gene of both parents; after pre-processing the sample to be tested, it was put on the machine for high-throughput sequencing, and the sequencing data after the machine was compared with the reference gene to determine the chromosome euploidy of the sample to be tested.

[0089] The method of the present invention for simultaneously detecting embryo chromosomal abnormalities and specific gene (pathogenic gene) carrying status based on blastocyst culture medium is used to determine the embryo chromosomal abnormalities and single gene disease pathogenic gene carrying status in the above case, and the specific steps are as follows:

[0090] S1, sample collection: peripheral blood samples of 5 ml each were drawn from the father, mother and proband (three blood samples in total) and stored in EDTA anticoagulant blood collection tubes, of which the father and mother peripheral blood samples were the first sample, and the proband peripheral blood samples were the second sample.

[0091] S2, family haplotype construction:

[0092] 1. The genomic DNA of the family was extracted using the Tiangen blood extraction kit. The genomic DNA of the parents and the proband was diluted to 5ng / uL after quality inspection for later use. The extracted genomic DNA was used to search and organize the STR information based on the WDR19 gene mutation site and STR Marker using the biological public database (NCBI http: / / www.ncbi.n lm.nih.gov / ), obtain the gene sequence, and design the STR primers (as shown in Table 1).

[0093] Table 1

[0094]

[0095]

[0096] Take out the diluted forward and reverse 10μM primer working solution of each STR locus from the -20 degree Celsius refrigerator, the component reagent of Novogene PhantaMax Super-Fidelity DNA Polymerase, genomic DNA and embryo Sureplex single cell amplification product, dissolve completely on the ice box, shake and mix thoroughly for 5s, centrifuge for 5s, and place on the ice box. Prepare the PCR reaction system of a single sample and a single primer pair according to the following conditions: 2x Phanta Max Buffer (2mM) 12.5uL, dNTP Mix (10mMeach) 0.5uL, Phanta Max Super-Fidelity DNA Polymerase 0.5uL, Primer F 1uL, Primer R 1uL, Template (5ng) 1uL, Nuclease-Free Water 8.5uL, the total volume of the system is 25uL. After the system is prepared, the prepared PCR reaction system is fully vortexed for 10 seconds, centrifuged in a microcentrifuge for 5 seconds, and then placed on a PCR instrument to perform PCR according to the conditions in Table 2 below:

[0097] Table 2

[0098]

[0099] After PCR amplification is completed, the product is stored for a short time with tin foil in the dark at 4°C, and needs to be placed at -20°C overnight. The obtained PCR amplification product is subjected to agarose gel electrophoresis quality inspection, and the samples that pass the quality inspection are diluted to 1ng / μL-10ng / μL. Then prepare Hi-Di Formamide, 9.5uL, LI Z600, 0.5uL, 1 uL of diluted product, and the total system volume is 11uL system. The system is placed in the next step of capillary electrophoresis sequencing. Denature at 95°C in a metal bath for 4min, then quickly place in an ice box to cool for 4min, then briefly centrifuge, take 10μL sample and use the American ABI3730XL genetic analyzer for capillary electrophoresis sequencing. Data analysis was performed based on the obtained STR profiles to obtain the number of effective alleles for the father, mother, and proband. The WDR19c.1595T>C and c.1248T>C mutation sites and 15 STR markers upstream and downstream were used to screen effective STR sites to confirm the haplotype of the family and to perform subsequent preimplantation genetic testing. The 15 STR sites shown in Table 3 had high heterozygosity, with the highest seven STR sites being D4S2955, D4S7761, D4S5671, D4S251, D4S2382, D4S174, and D4S2919. The pathogenic gene WDR19c.1595T>C was located on the female's M1 chain, and the pathogenic gene WDR19c.1248T>C was located on the male's M2 chain. The proband's M1 chain comes from the mother's M1 chain carrying the pathogenic gene, and the proband's M2 chain comes from the father's M2 chain carrying the pathogenic gene. The results are shown in Table 3.

[0100] Table 3

[0101]

[0102] 2. Sample collection of blastocyst culture medium, arrested embryos, and biopsy tissues: The gametes of both carriers of the pathogenic gene are injected into fertilized eggs through intracytoplasmic sperm injection, and the eggs are cultured to blastocysts. The blastocyst biopsy tissues and arrested embryos, as well as the remaining culture medium of the corresponding embryos, are collected and placed in 0.2 ml PCR storage tubes containing 5 microliters of 1xPBS. Specimens that are not sent for examination in time should be promptly stored in a -80°C refrigerator. Naming of specimens In this case, we numbered the arrested development embryos and biopsy tissues as E-1, E-2, E-3, E-4, E-5, E-6, E-7, E-8, E-9, E-10, E-11, and E-12. Among them, E-11 and E-12 formed blastocysts, so blastocyst biopsies were taken from them; the corresponding blastocyst culture media were numbered: N-1, N-2, N-3, N-4, N-5, N-6, N-7, N-8, N-9, N-11, and N-12.

[0103] 3. Whole genome amplification of culture medium free DNA samples

[0104] The whole genome amplification product was obtained by amplification using the PicoPLEX method. ， The six bases ATGTGG at the end, which are highly distributed in the human body, are used as guides, and a random sequence of six bases is used to determine the specific amplification starting site.

[0105] (1) Sample processing

[0106] The third sample (sample to be tested, embryo culture fluid, the culture fluid is selected from the culture fluid of embryonic tissue of 2-5 days) is centrifuged at 200g for 3min. According to the number of samples, n, take n pre-amplification mixed solutions, flick briefly centrifuge for 10s and set aside. Each pre-amplification mixed solution is mixed with 4.75ul pre-amplification buffer (Lysis Buffer) and 0.25ul pre-amplification enzyme (Lysis Enzyme), and the total volume after mixing is 5ul. In each pre-amplification mixed solution that is mixed and set aside, add 10ul sample to be tested, run the following program according to Table 4, and obtain the pre-amplification reaction product.

[0107] Table 4

[0108]

[0109] (2) Amplification reaction: According to the number of reaction portions n, take n portions of amplification mixture, centrifuge briefly for 10 seconds and set aside. Each amplification mixture is prepared by mixing 58 μL of amplification buffer and 2 μL of amplification enzyme. Add 15 μL of pre-amplification reaction product to each amplification mixture, and run the following program according to Table 5 to obtain amplification reaction products.

[0110] Table 5

[0111]

[0112] (3) 1 μL of amplification reaction product from each sample was used for Qubit quantification. The quantified product was stored in foil at 4°C in the dark for a short period of time and at -20°C overnight.

[0113] 4. Direct detection of pathogenic sites

[0114] (1) Primers were designed based on the pathogenic sites WDR19c.1595T>C and c.1248,T>C (see Table 6 below):

[0115] Table 6 Primers for pathogenicity sites WDR19 c.1595T>C and c.1248, T>C

[0116] Pathogenic sites Forward Primer Reverse primer Product length WDR19-c1248 TTGATGTGGAACCCAACTTTG ACTATGCTATGCTGCCTTCACTAC 285 WDR19-c1595 GAAGACTGGCAATTCGTTAATGA TGAAGATGACAGCAAAGAACTACAA 230

[0117] (2) Set up the PCR program: pre-denaturation: 95℃ for 2 minutes; denaturation: 95℃ for 15 seconds; annealing / extension: 60℃ for 15-30 seconds; repeat steps b and c for a total of 40 cycles; melting curve analysis (optional): 95℃ for 15 seconds, 60℃ for 15 seconds, 95℃ for 15 seconds; use the software provided by the fluorescence quantitative PCR instrument to analyze the results. The pathogenic gene carrying status was obtained (the results are shown in Table 7)

[0118] Table 7

[0119]

[0120] Table 7 Combination Figure 8 It can be seen that the success rate of direct detection of pathogenic genes in tissue samples and culture fluid samples is 100%, and the consistency rate of the two results is 75% (3 / 12), indicating that the detection of pathogenic sites in patients with single gene diseases based on blastocyst culture fluid has a high success rate, but linkage analysis of STR loci is still needed to determine which chain of the pathogenic site chain comes from the parents, and further verify the results of direct detection to avoid inaccurate results caused by allele disconnection. It should be noted that the results are only for this family and pathogenic sites, which can represent single gene diseases of point mutation type, but not all types of diseases.

[0121] 5. Next-generation sequencing: perform next-generation sequencing on the whole genome amplification products, filter the obtained data and compare them with the reference gene. After statistical analysis of the comparison results, the chromosome copy number of the sample to be tested is obtained to determine whether the chromosome number is abnormal. The specific operations are as follows:

[0122] (1) DNA end repair reaction: add 6.5 μl of end repair reaction solution, 2 μl of end repair enzyme, 50 μl of DNA obtained by single-cell whole genome amplification and 6.5 μl of enzyme-free sterile water to a 200 μl PCR tube. Mix well and centrifuge briefly to collect all components at the bottom of the tube. Place the above PCR tube in a PCR instrument with the hot lid open. The reaction procedure is as follows: 15 min, 12°C; 15 min, 37°C; 20 min, 72°C; Hold on 4°C.

[0123] (2) Adaptor ligation: Directly add 14 μl of DNA ligase buffer, 2 μl of DNA ligase, 1 μl of adapter (10 pM) and 1.5 μl of enzyme-free sterile water to the reaction solution in which the DNA end repair has been completed. Then purify according to the following steps: ① Vortex the magnetic beads for 20 seconds to thoroughly mix them into a uniform solution; ② Transfer the above solution to a new 1.5 ml centrifuge tube; ③ Add 1 times the sample volume of magnetic beads, vortex for 5 seconds, and then cool to room temperature. Let stand for 5 minutes; ④ Centrifuge briefly, place the centrifuge tube on the magnetic rack, adsorb for 5-6 minutes to separate the magnetic beads and the supernatant solution until the solution is clear; ⑤ Continue to keep the centrifuge tube fixed on the magnetic rack, add 250μl to the centrifuge tube and let it stand at room temperature for 30 seconds. After the suspended magnetic beads are completely adsorbed, carefully discard the supernatant; ⑥ Repeat step 5; ⑦ Keep the centrifuge tube fixed on the magnetic rack and let it stand at room temperature for 10 minutes to allow the magnetic beads to dry in the air; ⑧ Remove the centrifuge tube from the magnetic rack, add 28μl EB (self-prepared) or deionized water, vortex and oscillate to completely resuspend the magnetic beads in the eluent, and let it stand at room temperature for 5 minutes; ⑨ Centrifuge briefly, place the centrifuge tube on the magnetic rack until the solution is clear (about 5 minutes), and transfer 23μl to a new PCR tube.

[0124] (3) Sequencing

[0125] The DNA in the centrifuge tube was diluted to 4 nM, then denatured with NaOH, and the library was diluted to 1.8 pM and sequenced on an Illumina machine. After filtering the sequencing data, aneuploidy analysis was performed (the results are shown in Table 8, and the scatter plot is shown in Figure 11-31 The results showed that the chromosome euploidy results of the developmental arrest and biopsy specimens numbered E1, E-3, E-9, E10, E11, and E12 were normal, while the chromosome euploidy results of the developmental arrest specimens E2, E4, E7, and E8 were abnormal. In addition, the chromosome euploidy results of the culture medium specimens N5, N6, N9, N10, N11, and N12 corresponding to their blastocysts were normal, while the chromosome euploidy results of N1, N3, N2, N4, N7, and N8 were abnormal. Among them, the results of the blastocyst culture medium numbered N-1 and N-3 corresponding to the numbered E-1 and E-3 were inconsistent. The chromosome euploidy of the arrested embryos E-1 and E-3 was 46,XN, and the chromosome euploidy of the corresponding blastocyst culture medium N-1 and N-3 was partial mosaicism, which did not mean complete abnormality. According to the results, embryos numbered E-1 and E-3 were not recommended for priority transplantation. Among the above samples, E11 and E12 formed blastocysts and only carried heterozygous mutant chromosomes with normal euploidy results, indicating that the inventive system based on blastocyst culture medium for detecting chromosome euploidy has a high accuracy rate, and the consistency rate with chromosome euploidy detection based on developmentally arrested embryos and biopsy tissue samples is 84% ​​(2 / 12).

[0126] Table 8

[0127]

[0128] 6. STR locus linkage analysis of trace free DNA in culture medium:

[0129] (1) Haplotype analysis of the samples to be tested: The samples to be tested collected in the above 3 steps were amplified according to the above step S2, using primers for the STR loci of the pathogenic gene for family differentiation of single gene diseases, and the amplification conditions were the same as those in Table 2 above. The STR loci amplification results of the samples to be tested were obtained (as shown in Tables 9-10). The results showed that the amplification success rate of the D4S2955, D4S7761, D4S5671, D4S251, and D4S2382 loci of the arrested embryos and biopsy tissues was 100%, and the allele of the E-4 sample at the D4S174 locus was dropped, and the allele of the E-8 sample at the D4S2919 locus was dropped, indicating that the STR success rate of the trace DNA to be amplified from the arrested embryos and biopsy tissue samples was high. The success rate of STR amplification from the trace amount of DNA derived from blastocyst culture medium is lower than that from arrested embryos and biopsy tissue samples. However, except for the failure of amplification of multiple STR mutation sites of N-7 that could not be judged, the remaining samples all had at least 4 valid STR allele sites amplified successfully, which is sufficient for haplotype analysis of the samples to be tested. The inventive system is feasible for STR linkage analysis based on the trace amount of DNA derived from blastocyst culture medium.

[0130] Table 9

[0131] Sample No. D4S2955 D4S7761 D4S5671 D4S251 D4S2382 D4S174 D4S2919 E-1 194 258 / 276 229 / 231 279 / 261 281 / 269 194 / 188 236 E-2 197 / 194 266 / 276 221 / 231 275 / 261 277 / 269 192 / 188 254 / 236 E-3 194 / 199 258 / 268 229 / 223 279 / 271 281 / 269 194 / 184 236 / 248 E-4 197 / 194 266 / 276 221 / 231 275 / 261 277 / 269 ADO / 188 254 / 236 E-5 194 / 199 258 / 268 229 / 223 279 / 271 281 / 269 194 / 184 236 / 248 E-6 194 / 199 258 / 268 229 / 223 279 / 271 281 / 269 194 / 184 236 / 248 E-7 197 / 199 266 / 268 221 / 223 275 / 271 277 / 269 192 / 184 254 / 236 E-8 197 / 199 266 / 268 221 / 223 275 / 271 277 / 269 192 / 184 ADO / 248 E-9 197 / 194 266 / 276 229 / 231 279 / 261 281 / 269 194 / 188 236 E-10 197 / 194 266 / 276 221 / 231 275 / 261 277 / 269 192 / 188 254 / 236

[0132] Table 10

[0133] Sample No. D4S2955 D4S7761 D4S5671 D4S251 D4S2382 D4S174 D4S2919 N-1 194 258 / ADO 229 / ADO ADO / 261 281 / 269 194 / 192 / ADO 236 N-2 194 266 / 276 ADO / 231 275 / 261 277 / 269 192 / 188 254 / 236 N-3 ADO / 199 258 / 268 229 / ADO 279 / 271 ADO / 269 ADO / 188 FA* N-4 194 266 / ADO ADO / 231 275 / 261 277 / ADO 192 / 188 254 / 236 N-5 ADO / 199 258 / 268 229 / 223 279 / 271 ADO / 269 194 / 184 236 / 248 N_6 194 258 / 268 ADO / 223 279 / ADO 281 / 269 ADO / 184 236 / 248 N-7 194 ADO / 268 FA* FA* ADO / 269 192 / ADO FA* N-8 ADO / 199 266 / ADO 221 / 223 279 / 271 281 / 269 192 / 184 ADO / 248 N-9 FA* 266 / ADO FA* 279 / 261 281 / 269 ADO / 188 236 N-10 194 ADO / 276 FA* ADO / 261 277 / 269 192 / 188 254 / 236 N-11 194 266 / 276 FA* 275 / 261 277 / 269 ADO / 188 254 / 236 N-12 194 258 / 276 229 / ADO FA* 281 / 269 194 / 188 236

[0134] (2) Based on the above STR locus amplification results, analyze which chain the samples to be tested come from, and further verify the accuracy of pathogenic locus detection. The family linkage analysis model is shown in the figure below. Figure 6-7As shown, the red mark in the model diagram indicates the mutation site and its linked alleles, ADO represents allele disconnection, and the black mark indicates that the WDR19c.1595T>C and WDR19c.l248 T>C gene mutations were not detected. The interpretation of the STR linkage analysis results is summarized in Table 11. The results show that, except for the N-7 specimen with failed STR locus amplification, the STR locus linkage results from the arrested embryos and biopsy tissue samples are consistent with the STR locus linkage results from the blastocyst culture medium. It is explained that the method of the invention system for determining the chromosome copy number and the specific gene carrying chain by STR linkage analysis based on trace DNA derived from blastocyst culture medium is feasible. It is a method for determining the chromosome copy number and the specific gene carrying chain using in vitro embryo culture medium for non-disease diagnosis purposes, and STR linkage analysis is performed based on embryo culture medium to obtain the genetic information of pre-implantation embryos cultured in embryo culture medium. Embryos carrying specific genes and / or aneuploidy are excluded through this information, and the chromosome euploidy is judged as partial mosaicism, and sorted. If there are other embryos without abnormalities, this embryo is not recommended for priority transplantation, but it does not mean that it is completely abnormal. When there is no better chromosome euploidy result, it can be considered as an implanted embryo.

[0135] Table 11

[0136]

[0137]

[0138] In summary, before embryo transplantation, the results of Table 7 and Table 11 need to be comprehensively considered to select the embryos to be implanted. (The chromosome ploidy and linkage results of N-1 to N-12 show that the chromosomes of E-4, E-7, and E-8 are abnormal, and the chromosomes of E-1, E-2, and E-3 are partially mosaic; Table 11 obtains the results of STR linkage analysis of embryo culture medium). According to the above test results, embryos with normal chromosomes and no pathogenic genes are screened from the pre-implantation embryos to be tested as embryos to be implanted.

[0139] It should be understood that the above specific embodiments of the present invention are only used for illustrative inventions or to explain the principles of the present invention, and do not constitute limitations on the present invention. Therefore, any modifications, equivalent substitutions, improvements, etc. made without departing from the spirit and scope of the present invention should be included in the protection scope of the present invention. In addition, the appended claims of the present invention are intended to cover all changes and modifications that fall within the scope and boundaries of the appended claims, or the equivalent forms of such scope and boundaries.

Claims

1. A method for determining chromosome copy number and specific gene carrying chain using embryo culture medium, characterized in that: This method is used to exclude embryos carrying specific genes and / or aneuploidy by simultaneously testing the chromosome euploidy and pathogenic gene carrying status of free DNA in the culture medium of the embryo before implantation.

2. A method for determining chromosome copy number and specific gene carrying chain using embryo culture medium according to claim 1, characterized in that: The specific steps include: S1: Sample collection: S101: extracting DNA samples from blood samples of both specific gene carriers and the proband or the previous generation relative; wherein the DNA of both specific gene carriers is the first sample, and the DNA of the proband or the previous generation specific gene carrier's parents is the second sample; S102: The gametes of both carriers of the specific gene are obtained through intracytoplasmic sperm injection to obtain a fertilized egg, which is cultured to a blastocyst, and the blastocyst biopsy tissue and arrested embryos, as well as the remaining culture medium of the corresponding embryos are collected; the trace amount of DNA in the blastocyst biopsy tissue and arrested embryos, as well as the remaining culture medium of the corresponding embryos is the third sample. S2: Construction of STR haplotypes: S201: Design primers for STR loci and perform PCR amplification; S202: The amplified product of S201 is subjected to capillary electrophoresis to analyze the result data and determine the STR haplotype; STR locus sequences that effectively distinguish haplotypes are screened from the STR information of the father and the mother, and the target gene haplotypes of the father and the mother are determined by combining the sequencing information of the STR loci with the STR information of the second sample, wherein the second sample is derived from the DNA of the proband or the parents of the previous generation of the specific gene carrier; S3: The third sample collected in S1 is amplified by the PicoPLEX method to obtain a whole genome amplification product. The PicoPLEX method uses 3 ， The six bases ATGTGG at the end of the genome, which are highly distributed in the human body, are used as guides, and the six bases are used as random sequences to determine the specific amplification start site, and amplification is performed to obtain the whole genome amplification product. S4: The whole genome amplification product of S3 is directly tested for specific sites, that is, primers are designed for the whole genome amplification product of S3 according to the type of monogenic disease and mutation site, and Sanger sequencing is performed. The third sample collected in S1 is used as the sample to be tested, and whether the third sample carries the abnormal gene at the corresponding site of the specific gene family is directly tested; S5: Perform next-generation sequencing on the whole genome amplification product of S3 to determine whether its chromosome copy number is abnormal; S6: STR locus linkage analysis of the third sample: S601: The whole genome amplification products of S3 were amplified by PCR using primers designed based on the distinguishing STR loci screened from the corresponding pathogenic gene loci of the family of patients with monogenic diseases in S201, and the amplified products were subjected to capillary electrophoresis to obtain the STR locus haplotype information; S602: Perform the test with the paternal and maternal haplotype chains constructed in S202 to determine whether the sample to be tested has inherited the variant chain.

3. A method for determining chromosome copy number and specific gene carrying chain using embryo culture medium according to claim 2, characterized in that: The STR loci in step S201 are designed and obtained based on the specific gene loci corresponding to the family of the specific gene carrier.

4. The method for determining chromosome copy number and specific gene carrying chain using embryo culture medium according to claim 2, characterized in that: The primer design and molecular biology techniques in the method for directly detecting the specific gene corresponding sites in S4 are designed based on the pathogenic site genes of the specific gene carriers.

5. The method for determining chromosome copy number and specific gene carrying chain using embryo culture medium according to claim 2, characterized in that: The establishment of the haplotype of a family with a single gene disease in S2 requires blood DNA samples from the carrier couple and the proband, or blood DNA samples from the parents of the previous generation of gene carriers. When there are no samples from the proband and the parents of the previous generation of gene carriers, reverse reasoning can be used using embryos of disease-causing gene carriers. In this case, at least one homozygous gene carrier embryo or at least four heterozygous gene carrier embryos with distinguishing phenotypes are required.

6. The method of determining chromosome copy number and specific gene carrying chain using embryo culture medium according to claim 2, characterized in that: At least 4 pairs of differentiating STR loci are designed in the S201.

7. The method of claim 1 for determining chromosome copy number and specific gene carrying chain using embryo culture medium, characterized in that: The detection object of this method is the third sample.

8. The method of determining chromosome copy number and specific gene carrying chain using embryo culture medium according to claim 2, characterized in that: The third sample in the sample collection of S1 was immediately placed in a 0.2 ml PCR storage tube containing 5 microliters of 1xPBS after collection. The specimens that were not sent for inspection in time were promptly stored in a -80°C refrigerator.

9. The method for determining chromosome copy number and specific gene carrying chain using embryo culture medium according to claim 2, characterized in that: The method for whole genome amplification of trace free DNA in the culture medium in S3 is PicoPLEX, and the method steps include: Step 1: Centrifuge 0.2 ml PCR tube containing the sample to be tested at low speed for 10 seconds to make sure there are no obvious droplets on the tube wall and lid; Step 2, pre-amplification reaction; Step 3, performing an amplification reaction on the pre-amplification product; Step 4, Qubit quantification of the amplified product; Step 5, DNA purification: The DNA obtained after PCR amplification is purified to remove impurities that may be introduced during the PCR reaction.

10. The method for determining chromosome copy number and specific gene carrying chain using embryo culture medium according to claim 2, characterized in that: The product of whole genome amplification of trace free DNA in the culture solution in S5 is subjected to high-throughput sequencing, and the method steps include: i. Fragmentation of genomic DNA: using enzyme digestion to randomly break large DNA fragments into small DNA fragments; ii. Fragment the target gene for analysis and quantification; use Qubit dsDNA HS Assay Kit for fragment size and quantification; ⅲ. Library construction: Use the Aoji core single-cell sequencing library construction kit. The main steps include end repair: the 3' protruding end of the DNA after the fragment is removed, and the 5' concave end is filled, converted into 5'-phosphate and 3'-phosphate blunt-end DNA, an A tail is added, and then dA is added to the 3' end of the DNA to convert it into a sticky end for subsequent complementary pairing with the adapter; and the 5' end of the DNA is phosphorylated; then the repaired fragments are connected with adapters: mainly using DNA ligase to connect the DNA fragment with dA at the 3' end to the adapter adapter; the DNA fragments after the adapter connection are PCR amplified, and the amplified products contain a large number of Insert Fragments of the forward and reverse chains of the original template; then the PCR products are purified by magnetic beads, and the qualified products after purification can be used for high-throughput sequencing; iv. Sequencing: After the library is qualified in quality inspection, the genome is sequenced using the second generation sequencing technology. The present invention uses the BGI200 sequencing platform; ⅴ. Bioinformatics analysis: Perform bioinformatics analysis on the sequencing results. After the filtered data is compared with the reference gene, the chromosome euploidy result of the sample to be tested is obtained.

Images