Molecular identification method for sex-linked Luhua feather homozygote of Luhua chicken

Abstract

The invention discloses a molecular identification method for sex-linked Luhua feather homozygotes of Luhua chickens, and belongs to the technical field of molecular marker-assisted breeding. According to the method, KASP detection primers for detecting three sex-accompanied Luhua chicken feather color strong linkage sites are designed, homozygous linkage Luhua chicken individuals can be rapidly and accurately detected according to genotypes of the three sites, when SNP2 (C-> A) at a first intron 389bp of a CDKN2A gene and SNP3 and SNP4 at a first exon 172bp (T-> A) and 174bp (T-> C) of the CDKN2A gene are AA, AA and CC respectively, the chicken to be detected is the homozygous linkage Luhua chicken, and the chicken to be detected is the homozygous linkage Luhua chicken. Otherwise, the to-be-detected chicken is a heterozygous linkage Luhua chicken or a non-sex linkage Luhua chicken. An effective technical means is provided for purifying the sex-accompanied Luhua chicken feather color gene, and the breeding speed of the sex-linked Luhua chicken strain homozygosis and the breeding speed of a commercial line of the sex-linked Luhua chicken strain homozygosis are increased.

Description

Technical Field

[0001] The invention relates to the technical field of molecular marker-assisted breeding, in particular to a molecular identification method for sex-linked reed feather homozygotes of reed chicken. Background Art

[0002] Sex-linked feather color traits have attracted much attention in poultry breeding and production. The use of sex-linked feather color traits can realize the self-sexing of chicks, reduce the stress damage of artificial anal rotation identification to chicks, and reduce production costs. The reed feather, also known as the horizontal striped feather, is a typical feather color trait in domestic chickens. The reed feather phenotype of chickens includes the sex-linked reed feather phenotype and the autosomal reed feather phenotype, both of which form stripes of two different colors alternating on the feathers. The use of sex-linked reed feather traits can realize the breeding of new varieties (matching lines) that can self-sex, which brings great convenience to poultry production. Conventional traditional breeding techniques require the breeding of homozygous sex-linked reed feather line breeders. For roosters with reed feather phenotypes, it is necessary to determine whether their genotype is homozygous through test cross tests, which is laborious and time-consuming, and affects the breeding speed. Therefore, it is urgent to establish a molecular detection method that can quickly and accurately identify homozygous sex-linked reed chickens, so as to determine whether the phenotypic reed feather rooster is homozygous for sex-linked reed feathers, and then establish a homozygous strain as soon as possible to speed up the breeding of self-differentiated male and female matching lines of reed chickens.

[0003] Foreign countries have conducted in-depth research on the molecular mechanism of the influence of sex-linked transverse spot phenotype (reed phenotype) on local chicken breeds, which is mainly related to the CDKN2A gene. For domestic local chicken breeds, Wenshang Reed Chicken is the only local chicken breed in my country with sex-linked reed feather traits as a typical feature. Although it has been found that the CDKN2A gene is associated with the sex-linked reed phenotype, there are relatively few studies on the CDKN2A gene in domestic local chicken breeds, and with the update of the chicken reference genome version in the database, the specific mutation sites that affect its phenotype need to be further accurately located and explored. At the same time, accelerating the breeding speed of homozygous sex-linked reed chicken strains and their matching strains is also of great significance for the excavation of the purified reed chicken sex-linked reed feather color gene. Summary of the invention

[0004] The purpose of the present invention is to provide a molecular identification method for sex-linked reed feather homozygotes in reed chickens to solve the problems existing in the above-mentioned prior art. The present invention can quickly and accurately detect homozygous sex-linked reed feather individuals by designing KASP detection primers for detecting three sex-linked reed feather color strongly linked loci, and can significantly improve the purity of sex-linked reed chicken strains.

[0005] To achieve the above object, the present invention provides the following solutions:

[0006] The present invention provides a molecular identification method for sex-linked reed feather homozygotes of reed chicken, comprising the following steps:

[0007] Extracting the chicken DNA sample to be tested;

[0008] Using the chicken DNA sample to be tested as a template, using KASP detection primers for detecting SNP sites related to the sex-linked reed feather trait of reed chicken to perform PCR amplification, judging the genotype of the chicken to be tested according to the amplification result, and judging whether the chicken to be tested is homozygous for the sex-linked reed feather trait of reed chicken according to the genotype of the chicken to be tested;

[0009] The SNP loci associated with the sex-linked reed feather trait of reed chicken include SNP2, SNP3 and SNP4;

[0010] The SNP2 has a C / A mutation at position 131 of the sequence shown in SEQ ID NO. 14, and the genotypes include CC, CA and AA;

[0011] The SNP3 has a T / A mutation at position 113 of the sequence shown in SEQ ID NO.15, and the genotypes include TT, TA and AA;

[0012] The SNP4 has a T / C mutation at position 115 of the sequence shown in SEQ ID NO.15, and the genotypes include TT, TC and CC;

[0013] When the genotype of the site where the SNP2 is located is AA, the genotype of the site where the SNP3 is located is AA, and the genotype of the site where the SNP4 is located is CC, the chicken to be tested is a sex-linked reed feather homozygote of the reed chicken.

[0014] Optionally, the KASP detection primers include a primer combination for detecting SNP2, a primer combination for detecting SNP3, and a primer combination for detecting SNP4; the primer combination for detecting SNP2 includes an upstream primer SNP2-F1 of the sequence shown in SEQ ID NO.5, an upstream primer SNP2-F2 of the sequence shown in SEQ ID NO.6, and a downstream primer SNP2-R of the sequence shown in SEQ ID NO.7; the primer combination for detecting SNP3 includes an upstream primer SNP3-F1 of the sequence shown in SEQ ID NO.8, an upstream primer SNP3-F2 of the sequence shown in SEQ ID NO.9, and a downstream primer SNP3-R of the sequence shown in SEQ ID NO.10; the primer combination for detecting SNP4 includes an upstream primer SNP4-F1 of the sequence shown in SEQ ID NO.11, an upstream primer SNP4-F2 of the sequence shown in SEQ ID NO.12, and a downstream primer SNP4-R of the sequence shown in SEQ ID NO.13.

[0015] Optionally, in the primer combination for detecting SNP2, the primer combination for detecting SNP3, and the primer combination for detecting SNP4, a universal fluorescent label is added to the 5' end of the upstream primer.

[0016] Optionally, the universal fluorescent label includes a FAM fluorescent label and a VIC fluorescent label.

[0017] Optionally, the sequence of the FAM fluorescent label is shown as SEQ ID NO.16, and the sequence of the VIC fluorescent label is shown as SEQ ID NO.17.

[0018] Optionally, the reaction system of the PCR amplification is 2*KASPmaster mix 2.5 μL, primer mixture 1.25 μL and DNA sample 1.25 μL; wherein the primer mixture consists of upstream primer 1, upstream primer 2 and downstream primer in a volume ratio of 1:1:3; the reaction conditions of the PCR amplification are pre-denaturation at 95°C for 10 min, 1 cycle; denaturation at 95°C for 20 sec, annealing / extension at 61-55°C for 60 sec, 10 cycles; denaturation at 95°C for 20 sec, annealing / extension at 55°C for 60 sec, 27 cycles; reading at 25°C for 30 sec, 1 cycle.

[0019] The present invention also provides the use of KASP detection primers for detecting SNP sites related to sex-linked reed feather traits of reed chicken in identifying homozygous sex-linked reed feathers of reed chicken, wherein the SNP sites related to sex-linked reed feather traits of reed chicken include SNP2, SNP3 and SNP4; the SNP2 has a C / A mutation at the 131st position of the sequence shown in SEQ ID NO.14, and the genotype includes CC, CA and AA; the SNP3 has a T / A mutation at the 113th position of the sequence shown in SEQ ID NO.15, and the genotype includes TT, TA and AA; the SNP4 has a T / C mutation at the 115th position of the sequence shown in SEQ ID NO.15, and the genotype includes TT, TC and CC.

[0020] Optionally, the KASP detection primers include a primer combination for detecting SNP2, a primer combination for detecting SNP3, and a primer combination for detecting SNP4; the primer combination for detecting SNP2 includes an upstream primer SNP2-F1 of the sequence shown in SEQ ID NO.5, an upstream primer SNP2-F2 of the sequence shown in SEQ ID NO.6, and a downstream primer SNP2-R of the sequence shown in SEQ ID NO.7; the primer combination for detecting SNP3 includes an upstream primer SNP3-F1 of the sequence shown in SEQ ID NO.8, an upstream primer SNP3-F2 of the sequence shown in SEQ ID NO.9, and a downstream primer SNP3-R of the sequence shown in SEQ ID NO.10; the primer combination for detecting SNP4 includes an upstream primer SNP4-F1 of the sequence shown in SEQ ID NO.11, an upstream primer SNP4-F2 of the sequence shown in SEQ ID NO.12, and a downstream primer SNP4-R of the sequence shown in SEQ ID NO.13.

[0021] Optionally, in the primer combination for detecting SNP2, the primer combination for detecting SNP3, and the primer combination for detecting SNP4, a universal fluorescent label is added to the 5' end of the upstream primer; the universal fluorescent label includes a FAM fluorescent label and a VIC fluorescent label.

[0022] Optionally, the sequence of the FAM fluorescent label is shown as SEQ ID NO.16, and the sequence of the VIC fluorescent label is shown as SEQ ID NO.17.

[0023] The present invention discloses the following technical effects:

[0024] The present invention can quickly and accurately detect homozygous sex-linked reed chicken individuals by designing KASP detection primers for detecting three sex-linked reed feather color strong linkage loci, and can significantly improve the purity of sex-linked reed chicken strains. This high-purity strain is of great significance for maintaining variety characteristics, improving production efficiency and meeting market demand. The molecular identification method of the present invention is more direct and efficient than traditional phenotypic selection methods, and greatly shortens the breeding cycle.

[0025] The present invention provides an effective technical means for purifying the sex-linked reed feather color gene of reed chicken, which helps to accelerate the breeding speed of homozygous sex-linked reed chicken strains and their matching strains, and lays a foundation for improving the competitiveness of the reed chicken industry and promoting the development of related industries. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0027] Figure 1 The agarose gel electrophoresis diagram of the PCR amplification products of the three SNP sites; the leftmost and rightmost lanes are markers (2000 bp), and the lengths of the amplified fragments of SNP2 and SNP3 / 4 are 356 bp and 370 bp, respectively;

[0028] Figure 2 The peak graphs of the first-generation sequencing of three sites, SNP2, SNP3 and SNP4; A is the peak graph of the first-generation sequencing of the SNP2 site, and B is the peak graph of the first-generation sequencing of the SNP3 and SNP4 sites;

[0029] Figure 3 The KASP genotyping results of each site; a is the KASP genotyping result of SNP2 site; b and c are the KASP genotyping results of SNP3 and SNP4 sites, respectively. The horizontal axis FAM fluorescence accounts for a higher proportion, which is homozygous type 1 (yellow dots), and the vertical axis VIC / HEX fluorescence accounts for a higher proportion, which is homozygous type 2 (blue squares); the two fluorescence proportions in the middle area are equal, which is a heterozygous type (green triangle); the black in the lower left corner is the negative control (NTC). DETAILED DESCRIPTION

[0030] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but should be understood as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0031] It should be understood that the terms described in the present invention are only for describing a particular embodiment and are not intended to limit the present invention. In addition, for the numerical range in the present invention, it should be understood that each intermediate value between the upper and lower limits of the scope is also specifically disclosed. The intermediate value in any stated value or stated range, and each smaller range between any other stated value or intermediate value in the described range is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded in the scope.

[0032] Unless otherwise indicated, all technical and scientific terms used herein have the same meanings as those generally understood by those skilled in the art. Although the present invention describes only preferred methods and materials, any methods and materials similar or equivalent to those described herein may also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of a conflict with any incorporated document, the content of this specification shall prevail.

[0033] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments of the present invention description without departing from the scope or spirit of the present invention. Other embodiments derived from the present invention description will be apparent to those skilled in the art. The present invention description and examples are exemplary only.

[0034] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0035] Example

[0036] 1. Sample source

[0037] The chicken breed required for the experiment of the present invention is Wenshang Luhua chicken, which is provided by the National Local Chicken Breed Gene Bank of Jiangsu Poultry Science Research Institute.

[0038] 2. Blood collection and DNA extraction

[0039] 2 mL of blood was collected from the wing vein, anticoagulated with EDTA and stored briefly in a 4°C refrigerator. Blood DNA was extracted using the phenol-chloroform extraction method and used for PCR amplification experiments.

[0040] 3. Primer synthesis

[0041] Primers were designed based on the three SNP sites on the CDKN2A gene, which were SNP2 (C->A) at 389bp in the first intron, SNP3 (T->A) at 172bp in the first exon, and SNP4 (T->C) at 174bp (reference genome version bGalGal1.mat.broiler.GRCg7b).

[0042] According to the primer sequences provided in Table 1, three SNP site-specific amplification primers and a DNA first-generation sequencing primer were synthesized respectively; according to the primer sequences provided in Table 2, KASP identification typing primers for the three SNP sites were synthesized.

[0043] Table 1 Target fragment specific amplification and first generation sequencing primer information

[0044]

[0045] Table 2 KASP site identification typing primer information

[0046]

[0047] 4. PCR amplification and first-generation sequencing

[0048] SNP2 amplification system 50μL: template DNA 2.0μL; 10pM primers 1.0μL each; ddH2O 21.0μL; 2×EasyTaqPCR SuperMix 25.0μL. Amplification program: 94℃ pre-denaturation for 3 minutes; 94℃ denaturation for 30 seconds, 58℃ annealing for 30 seconds, 72℃ extension for 30 seconds, a total of 34 cycles; 72℃ post-extension for 5 minutes.

[0049] SNP3 and SNP4 amplification system 40μL: template DNA 1.5μL; 10pM primers 1.75μL each; 1.1×T3 SuperPCR Mix 35.0μL. Amplification program: 98℃ pre-denaturation for 3 minutes; 98℃ denaturation for 10 seconds, 65℃ annealing for 10 seconds, 72℃ extension for 10 seconds, a total of 36 cycles; 72℃ post-extension for 5 minutes.

[0050] The target fragment was obtained by PCR amplification, and the PCR product was subjected to agarose gel electrophoresis. Figure 1 After the amplification products were purified, DNA Sanger sequencing was performed using the first-generation sequencing primers in Table 1 to further obtain accurate sequence and site information. The sequencing results of the three sites are as follows: Figure 2 , the sequence information of the amplified product is as follows:

[0051] SNP2 amplification product sequence (SEQ ID NO.14):

[0052] AAGCAGCAGGTGGTCGGCAGGCTATCTCTGTCTTTTCTCCCTCTTTGACAAATAATTTCTCTTCCCCCGGGCATAACTCAAAGCAGAAGAGCGCAGCTCCCCTCACACCGTCTGGGCGTTCTACCCTCGGAGGGCAGAAAAGCGCCGTGGCCGCCCCCGCGGGTGTAACTTTTCCCCG CCGTAAGTGGGGGGAAATGCGTCTCCGGAGGCTTAGAGACATTTCCCGATTTCAGATGGCAAAAGTGGGTCGCTGCGACTCTGCACAGCTCAGCTTAGGCCTCGGTCGTTGTACACAATTGTGTGTGTAAGGAAAAATAACGCGGCTGCTCGTTATGATGAGAATACGTGGACCTC.

[0053] SNP3 and SNP4 amplification product sequence (SEQ ID NO.15):

[0054] ATGGAGAGTGAGAGAGCTTTCTTACGGTGGGGGCCCCGCGGAGGGAACGCATTTCCATCGCGGCTCTCCGGGACCTCTCCTGTTCCCATGACCTCTCGGATAAGGTGCACCGACCGCCTTCGGCGCGCCCGCAGCCGGCCTCTGTCCTTCTCGCTGCTCCGGCGCATCTTGCGCGGGGTGGCCGC TGTCCTGCGGCGCTCCGGGACGCTTCGCCGCATTCTGCGCCGGGTTCTGAGAAGGAGGCACCGGGGCAGCCGCCGGCCCAGGTACGGCGGGGGGCGGCGGGGCCCGGAGGGCCGAGTGGAGGCGGCACGGGGCCCGCACGCGTCGTTCTCTCCTTTCTATTCTACTTTACTTTTCTCTTGAGC.

[0055] Among them, the 131st position of the sequence shown in SEQ ID NO.14 is the SNP2 site, and the base at this site has a C / A mutation; the 113th position of the sequence shown in SEQ ID NO.15 is the SNP3 site, and the base at this site has a T / A mutation, and the 115th position is the SNP4 site, and the base at this site has a T / C mutation.

[0056] 5. KASP identification and typing

[0057] (1) Universal fluorescent tags were added to the 5' end of the primers shown in Table 2, F1 (FAM): GAAGGTGACCAAGTTCATGCT (SEQ ID NO. 16), F2 (VIC): GAAGGTCGGAGTCAACGGATT (SEQ ID NO. 17).

[0058] (2) The newly synthesized primers were diluted to 10 μM with TE (pH = 8.0), and then mixed in a volume ratio of upstream typing primer F1: upstream typing primer F2: downstream universal primer R = 1:1:3 and loaded onto the machine. 1.25 μL of primer mixture was added to every 5 μL of reaction system.

[0059] (3) DNA sample dilution and addition: The DNA sample was diluted to a single-digit ratio according to the lowest concentration sample (45.0 ng / μL) to dilute the entire batch of samples. Each 5 μL reaction system contained 1.25 μL of the diluted DNA sample.

[0060] (4) The PCR reaction system was constructed (each reaction) as shown in Table 3, and the reaction was carried out in a 96-well plate.

[0061] Table 3 PCR reaction system

[0062]

[0063] (5) Seal the 96-well PCR reaction plate, shake, and centrifuge to ensure that the reaction system is evenly mixed.

[0064] (6) After centrifugation, PCR reaction was performed. The reaction procedure is shown in Table 4.

[0065] Table 4 PCR reaction program

[0066]

[0067] 6. Interpretation of results

[0068] The homozygous type 1 corresponding to SNP2 is the AA genotype, and the homozygous type 2 corresponding to SNP3 and SNP4 is the AA and CC genotypes, respectively ( Figure 3 ). The phenotype and genotype information of the experimental chickens used for testing are shown in Table 5. According to the data in Table 5 and Figure 3 It can be seen that if the genotypes of SNP2, SNP3 and SNP4 are AA, AA and CC respectively, the chicken to be tested is a homozygous linkage reed chicken (Z B Z B ); otherwise, the chicken to be tested is a heterozygous linked Luhua chicken (Z B Z b ) or non-sex-linked Luhua chicken (Z b Z b ).

[0069] Table 5 Phenotypic and genotypic information of experimental chickens

[0070]

[0071] The embodiments described above are only descriptions of the preferred modes of the present invention, and are not intended to limit the scope of the present invention. Without departing from the design spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by ordinary technicians in this field should all fall within the protection scope determined by the claims of the present invention.

Claims

1. A molecular identification method for sex-linked reed feather homozygotes in reed chicken, characterized in that: The following steps are involved: Extracting DNA samples of chickens to be tested; Using the chicken DNA sample to be tested as a template, using KASP detection primers for detecting SNP sites related to the sex-linked reed feather trait of reed chicken to perform PCR amplification, judging the genotype of the chicken to be tested according to the amplification result, and judging whether the chicken to be tested is homozygous for the sex-linked reed feather trait of reed chicken according to the genotype of the chicken to be tested; The SNP loci associated with the sex-linked reed feather trait of reed chicken include SNP2, SNP3 and SNP4; The SNP2 has a C / A mutation at position 131 of the sequence shown in SEQ ID NO. 14, and the genotypes include CC, CA and AA; The SNP3 has a T / A mutation at position 113 of the sequence shown in SEQ ID NO.15, and the genotypes include TT, TA and AA; The SNP4 has a T / C mutation at position 115 of the sequence shown in SEQ ID NO.15, and the genotypes include TT, TC and CC; When the genotype of the site where the SNP2 is located is AA, the genotype of the site where the SNP3 is located is AA, and the genotype of the site where the SNP4 is located is CC, the chicken to be tested is a sex-linked reed feather homozygote of the reed chicken.

2. The molecular identification method according to claim 1, characterized in that The KASP detection primers include a primer combination for detecting SNP2, a primer combination for detecting SNP3, and a primer combination for detecting SNP4; The primer combination for detecting SNP2 includes an upstream primer SNP2-F1 of the sequence shown in SEQ ID NO.5, an upstream primer SNP2-F2 of the sequence shown in SEQ ID NO.6, and a downstream primer SNP2-R of the sequence shown in SEQ ID NO.7; The primer combination for detecting SNP3 includes an upstream primer SNP3-F1 of the sequence shown in SEQ ID NO.8, an upstream primer SNP3-F2 of the sequence shown in SEQ ID NO.9, and a downstream primer SNP3-R of the sequence shown in SEQ ID NO.10; The primer combination for detecting SNP4 includes an upstream primer SNP4-F1 of the sequence shown in SEQ ID NO.11, an upstream primer SNP4-F2 of the sequence shown in SEQ ID NO.12, and a downstream primer SNP4-R of the sequence shown in SEQ ID NO.

13.

3. The molecular identification method according to claim 2, characterized in that In the primer combination for detecting SNP2, the primer combination for detecting SNP3, and the primer combination for detecting SNP4, a universal fluorescent label is added to the 5' end of the upstream primer.

4. The molecular identification method according to claim 3, characterized in that The universal fluorescent labels include FAM fluorescent labels and VIC fluorescent labels.

5. The molecular identification method according to claim 4, characterized in that The sequence of the FAM fluorescent tag is shown in SEQ ID NO.16, and the sequence of the VIC fluorescent tag is shown in SEQ ID NO.

17.

6. The molecular identification method according to claim 1, characterized in that The reaction system of the PCR amplification is 2.5 μL of 2*KASP master mix, 1.25 μL of primer mixture and 1.25 μL of DNA sample; wherein the primer mixture is composed of upstream primer 1, upstream primer 2 and downstream primer in a volume ratio of 1:1:3; the reaction conditions of the PCR amplification are pre-denaturation at 95°C for 10 min, 1 cycle; denaturation at 95°C for 20 sec, annealing / extension at 61-55°C for 60 sec, 10 cycles; denaturation at 95°C for 20 sec, annealing / extension at 55°C for 60 sec, 27 cycles; reading at 25°C for 30 sec, 1 cycle.

7. Use of KASP detection primers for detecting SNP sites associated with sex-linked reed feather traits of reed chicken in identifying homozygous sex-linked reed feather traits of reed chicken, characterized in that: The SNP sites associated with the sex-linked reed feather traits of reed chicken include SNP2, SNP3 and SNP4; the SNP2 has a C / A mutation at the 131st position of the sequence shown in SEQ ID NO.14, and the genotypes include CC, CA and AA; the SNP3 has a T / A mutation at the 113th position of the sequence shown in SEQ ID NO.15, and the genotypes include TT, TA and AA; the SNP4 has a T / C mutation at the 115th position of the sequence shown in SEQ ID NO.15, and the genotypes include TT, TC and CC.

8. The use according to claim 7, characterized in that: The KASP detection primers include a primer combination for detecting SNP2, a primer combination for detecting SNP3, and a primer combination for detecting SNP4; the primer combination for detecting SNP2 includes an upstream primer SNP2-F1 of the sequence shown in SEQ ID NO.5, an upstream primer SNP2-F2 of the sequence shown in SEQ ID NO.6, and a downstream primer SNP2-R of the sequence shown in SEQ ID NO.7; the primer combination for detecting SNP3 includes an upstream primer SNP3-F1 of the sequence shown in SEQ ID NO.8, an upstream primer SNP3-F2 of the sequence shown in SEQ ID NO.9, and a downstream primer SNP3-R of the sequence shown in SEQ ID NO.10; the primer combination for detecting SNP4 includes an upstream primer SNP4-F1 of the sequence shown in SEQ ID NO.11, an upstream primer SNP4-F2 of the sequence shown in SEQ ID NO.12, and a downstream primer SNP4-R of the sequence shown in SEQ ID NO.

13.

9. The use according to claim 8, characterized in that: In the primer combination for detecting SNP2, the primer combination for detecting SNP3 and the primer combination for detecting SNP4, a universal fluorescent label is added to the 5' end of the upstream primer; the universal fluorescent label includes a FAM fluorescent label and a VIC fluorescent label.

10. The use according to claim 9, characterized in that: The sequence of the FAM fluorescent tag is shown in SEQ ID NO.16, and the sequence of the VIC fluorescent tag is shown in SEQ ID NO.17.

Images