Molecular Markers Related to the Fur Traits of Zhongwei Goat and Their Applications

Abstract

The present invention belongs to the field of genetic breeding technology, and specifically relates to a molecular marker related to the fur traits of Zhongwei goats and its application. The fur traits of Zhongwei goats are the curvature length of hair strands or the proportion of flower spikes to hair strands. The nucleotide sequence of the molecular marker is shown in SEQ ID NO.1, and a mutation from C to T occurs at the 102 bp of the sequence shown in SEQ ID NO.1. The molecular marker can be used to select Zhongwei goat varieties with long curvature length of goat hair strands and a large proportion of flower spikes to hair strands.

Description

Technical Field

[0001] The invention relates to the technical field of genetic breeding, and in particular to a molecular marker related to the fur traits of Zhongwei goats and an application thereof. Background Art

[0002] Zhongwei goats are the only goat breed in the world that can produce white fur. In recent years, due to changes in demand for the livestock and poultry industry and changes in feeding conditions, the current core population of Zhongwei goats is seriously insufficient. Problems such as too few sheep in the core production areas, low reproduction rates, and degradation of excellent germplasm traits have become difficulties in the protection of the germplasm resources of this breed. Zhongwei goats are not only famous for their high-quality cashmere, but their fur also has certain economic value. Fur refers to the fur obtained from Zhongwei goats around 40 days old. This fur is white, shiny like jade, neatly curved, and has beautiful spikes. It is valued for its unique texture and characteristics. Therefore, improving the fur quality of Zhongwei goats and cultivating Zhongwei goats with excellent fur quality is one of the urgent problems to be solved in the current Zhongwei goat conservation work.

[0003] The bend length of the hair strand and the proportion of the inflorescence to the hair strand are important indicators of the fur traits of Zhongwei goats. It is very necessary to explore the molecular markers that affect the bend length of the hair strand and the proportion of the inflorescence to the hair strand at the genome level. Summary of the invention

[0004] To solve the above technical problems, the present invention provides a molecular marker related to the fur traits of Zhongwei goats, which can be used to select Zhongwei goat varieties with long bend length of goat hair strands and / or a large proportion of tassels to hair strands.

[0005] The specific technical solutions provided by the present invention are as follows:

[0006] In a first aspect, the present invention provides a molecular marker related to the fur trait of Zhongwei goats, wherein the fur trait of Zhongwei goats is the curvature length of hair strands or the proportion of tassels to hair strands, and the nucleotide sequence of the molecular marker is shown in SEQ ID NO.1, and a mutation from C to T occurs at the 102 bp of the sequence shown in SEQ ID NO.1. The mutation site is located at position 11504759 on chromosome 3 of the goat genome.

[0007] The second aspect of the present invention provides an application of the molecular markers related to the fur traits of Zhongwei goats in identifying the bending length of the hair strands of Zhongwei goats.

[0008] As a preferred embodiment of the present invention, the method for identifying the bending length of Zhongwei goat wool strands comprises:

[0009] Detect the base at the 102bp position of the molecular marker in the goat to be tested. When the base at this position is T, the bending length of the wool strand of the goat is greater than that when the base is C.

[0010] In the third aspect of the present invention, there is provided an application of the molecular marker related to the fur traits of Zhongwei goats in identifying the proportion of the flower spike in the wool strand of Zhongwei goats.

[0011] As a preferred embodiment of the present invention, the method for identifying the proportion of the flower spike in the wool strand of Zhongwei goats comprises the following steps:

[0012] Detect the base at the 102bp position of the molecular marker in the goat to be tested. When the base at this position is T, the proportion of the flower spike in the wool strand of the goat is greater than that when the base is C.

[0013] In the fourth aspect of the present invention, there is provided an application of the molecular marker related to the fur traits of Zhongwei goats in the genetic breeding of Zhongwei goats.

[0014] As a preferred embodiment of the present invention, the genetic breeding is to select Zhongwei goats with a long bending length of the wool strand and / or a large proportion of the flower spike in the wool strand.

[0015] As a preferred embodiment of the present invention, detect the genotype of the goat at the 102bp position of the molecular marker, and select individuals with the TT genotype as parents to increase the bending length of the wool strand of the offspring.

[0016] As a preferred embodiment of the present invention, detect the genotype of the goat at the 102bp position of the molecular marker, and select individuals with the TT genotype as parents to increase the proportion of the flower spike in the wool strand of the offspring.

[0017] As a preferred embodiment of the present invention, detect the genotype of the goat at the 102bp position of the molecular marker, and select individuals with the TT genotype as parents to increase the bending length of the wool strand and the proportion of the flower spike in the wool strand of the offspring.

[0018] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0019] The present invention provides an SNP locus affecting the bending length of the wool strand and the proportion of the flower spike in the wool strand of Zhongwei goats and a molecular marker containing this locus. By selecting individuals with the TT genotype at the SNP locus as the male parent or the female parent, the bending length of the wool strand and the proportion of the flower spike in the wool strand of the offspring can be increased. Description of the Drawings

[0020] Figure 1 It is a principal component analysis diagram, and the percentages of the first three explained variances are PC1, PC2, and PC3 as the X, Y, and Z axes respectively;

[0021] Figure 2 Distribution map of SNPs after quality control in 1Mb windows of chromosomes. The left Y-axis represents chromosome names, and the upper X-axis represents window size;

[0022] Figure 3 Manhattan Plots (A) and QQ-plots (B) show the GWAS results of the bending length of Zhongwei goat hair strands. Genome-wide significant SNPs are shown in red;

[0023] Figure 4 Manhattan Plots (A) and QQ-plots (B) show the GWAS results of the proportion of flower spikes in hair strands of Zhongwei goats. Genome-wide significant SNPs are shown in red. Specific implementation manners

[0024] The following details the specific implementation manners of the present invention. However, it should be understood that the protection scope of the present invention is not limited by the specific implementation manners. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative efforts fall within the protection scope of the present invention. The experimental methods described in the embodiments of the present invention are conventional methods unless otherwise specified.

[0025] Zhongwei goats are the only goat breed in the world that produces white fur. Zhongwei goats are not only famous for their high-quality cashmere, but their fur also has certain economic value. Therefore, improving the fur quality of Zhongwei goats and breeding Zhongwei goats with excellent fur quality is one of the urgent problems to be solved in the current conservation work of Zhongwei goats.

[0026] As important indicators of the fur traits of Zhongwei goats, the bending length of hair strands and the proportion of flower spikes in hair strands, it is very necessary to explore molecular markers that affect the bending length of Zhongwei goat hair strands and the proportion of flower spikes in hair strands at the genomic level.

[0027] The present invention provides a molecular marker related to the fur traits of Zhongwei goats. The fur traits of Zhongwei goats are the bending length of hair strands or the proportion of flower spikes in hair strands. The nucleotide sequence of the molecular marker is shown in SEQ ID NO.1, and a C to T mutation occurs at the 102bp of the sequence shown in SEQ ID NO.1. This mutation site is located at the 11504759th position on chromosome 3 of the goat genome. By using this molecular marker and selecting individuals with the TT genotype as the male parent or female parent, the bending length of the offspring hair strands and the proportion of flower spikes in hair strands can be increased.

[0028] Example 1

[0029] Experimental animals and phenotype sources:

[0030] All the experimental sheep in this study were from the Zhongwei Goat Breeding Farm in Ningxia Hui Autonomous Region. The phenotypic records of the hair strand bending length and the proportion of flower spikes in the hair strand in 2022 were measured, and the results are shown in Table 1. Ear tissue samples of 367 Zhongwei goat individuals were collected. After collection, all samples were immediately placed in liquid nitrogen for storage and then stored at -80 °C in the laboratory for a long time.

[0031] Table 1 Descriptions of the hair strand bending length and the proportion of flower spikes in the hair strand of Zhongwei goats

[0032]

[0033] I. Genomic DNA Extraction and Quality Inspection

[0034] The phenol-chloroform method was used to extract DNA from ear tissue samples. A spectrophotometer, model NanoDrop2000, was used to detect the DNA concentration, the absorption wavelength ratio of nucleic acid, protein and phenolic substances at the highest absorption peak 260 nm / 280 nm, and the absorption wavelength ratio of carbohydrates at the highest absorption peak 260 nm / 230 nm. And 1% agarose gel was used to detect and evaluate the DNA quality.

[0035] II. Library Construction and Sequencing on the Machine

[0036] After the qualified genomic DNA samples were processed, the genomic DNA was randomly fragmented into fragments with a length of 350 bp using a Covaris ultrasonic crusher. The whole library preparation was completed through steps such as end repair, adding polyA, adding sequencing adapters, purification, and PCR amplification. After the library construction was completed, Qubit2.0 was used for preliminary quantification, and qPCR was used to accurately quantify the effective concentration of the library to ensure the library quality. After the library quality inspection was qualified, the BGI MGI-T7 sequencing platform was used for sequencing, and the sequencing mode was PE150 mode.

[0037] III. Identification, Screening and Annotation of Variant Sites

[0038] The Raw reads data was filtered into Clean reads data using the fastp software version 0.20.0. A genomic index was built for the reference genome. The quality-controlled Clean reads data was aligned with the goat reference genomes ARS1 and GCF_001704415.1 using the Burrows-Wheeler Aligner software version 0.7.17. The aligned sam file was converted into a bam file using the SAMtools software version 1.8-20 and the bam file was sorted. The MarkDuplicates program in the GenomeAnalysis Toolkit software version 3.8 was used to remove duplicate data from the sorted bam file to obtain the final bam file. An index was built for the final bam file, and the HaplotypeCaller module in the GATK software was used for SNP variant detection. After obtaining the vcf file, the VariantFiltration module was used for filtering. The ANNOVAR software package was used to perform functional annotation on the detected gene variations. Based on the position of the variant sites on the reference genome and the gene position information on the reference genome, the regions where the variant sites occur in the genome can be obtained, including intergenic regions, intronic regions, or CDS regions, etc., as well as the effects of the variations.

[0039] IV. Data quality control and population stratification correction

[0040] The obtained genotyping data was quality-controlled using the PlinkV1.90 software, removing individuals with genotype call rates < 98%, SNPs with call rates < 98%, SNPs with minor allele frequencies < 5%, and SNPs with Hardy-Weinberg equilibrium test P values < 10 -6 . The first three principal components were calculated using the "-pca 3" parameter of the PlinkV1.90 software. The PCA plot was drawn using R language version 3.6.0. The results are as Figure 1 shown. There is no population stratification in the experimental samples, and there is no need to correct the population stratification phenomenon of Zhongwei goats.

[0041] A total of 32,219,876 SNPs participated in the quality control. After filtering by SNPs call rate, Hardy-Weinberg equilibrium, minor allele frequency, and individual call rate, the filtering conditions were -geno 0.02, -maf 0.05, -hwe 1e -6 , -mind 0.1. A total of 15,817,002 SNP sites were obtained for subsequent analysis. These sites were evenly distributed on the 29 pairs of autosomes of goats, as Figure 2 shown.

[0042] V. Genome-wide association study

[0043] The fastGWA-mlm model in GCTA V1.94.0beta software was used for the association analysis between SNPs and the trait of the length of the woolly thigh bend.

[0044] The Logistic regression model in GCTA V1.94.0beta software was used for the association analysis between SNPs and the trait of the proportion of the flower spike to the woolly thigh.

[0045] The Bonferroni correction method was used to determine the significance threshold of GWAS. The genomic inflation factor λ of the test statistic was calculated by the slope of the linear regression between the observed quantiles and the theoretical quantiles in R language V3.6.0. After calculation, the λ value of the trait of the length of the woolly thigh bend was 1.057, and the λ value of the proportion of the flower spike to the woolly thigh was 1.14, indicating no genomic inflation. Based on the resequencing data of 367 Zhongwei goats, 58 significant SNP loci related to the trait of the length of the woolly thigh bend were detected, and these loci were located on chromosomes 3, 6, 7, 8, 9, 10, 13, 16, 17, 18, and 28, as shown in Table 2, Supplementary Table 2 and Figure 3 as shown. 8 significant SNP loci related to the trait of the proportion of the flower spike to the woolly thigh were detected, and these loci were located on chromosomes 3, 6, 11, 16, 25, and 26, as shown in Table 3 and Figure 4 as shown.

[0046] Table 2 Significant SNP loci related to the trait of the length of the woolly thigh bend

[0047]

[0048] Supplementary Table 2 Significant SNP loci related to the trait of the length of the woolly thigh bend

[0049]

[0050] Table 3 Significant SNP loci related to the trait of the proportion of the flower spike to the woolly thigh

[0051]

[0052] VI. SNPs Affecting the Traits of the Length of the Woolly Thigh Bend and the Proportion of the Flower Spike to the Woolly Thigh in Zhongwei Goats

[0053] Further research on SNPs reaching the genome-wide significance level found that the C→T mutation at position 11504759 on chromosome 3 of the Zhongwei goat genome could significantly affect the traits of the length of the woolly thigh bend and the proportion of the flower spike to the woolly thigh in Zhongwei goats.

[0054] The association analysis of the SNP locus at position 11504759 on chromosome 3 of the Zhongwei goat genome with the traits of the length of the wool curl and the proportion of the flower spike in the wool curl is shown in Table 4:

[0055] Table 4 Polymorphism at position 11504759 on chromosome 3 of the Zhongwei goat genome

[0056]

[0057] Note: Different letters indicate significant differences ( P <0.05), and the same letter indicates no significant difference ( P >0.05). The proportion of the flower spike in the wool curl is a binary trait, denoted as 1 or 2, and it is stipulated that a proportion greater than or equal to 0.6 is denoted as 1, and less than 0.6 is denoted as 2; 1 represents a better phenotype, and the closer the value is to 1, the better the phenotypic individual.

[0058] As can be seen from Table 4, for individuals with the genotype TT, the length of their wool curl is the longest and the proportion of the flower spike in the wool curl is the largest.

[0059] The nucleotide sequence of the molecular marker containing the SNP locus is shown in SEQ ID NO.1: AGTTCAGTCGCTCAGTCGTGTCTGACTCTTTGCCACCCCATGAATTGCAGCACGCCAGGCCTCCCTGTCCATCACCAACTCCCGGAGTTCACTCAAACTCASGTCCATCAAGTCAGTGATGCCATCCAGCCATCTCATCCTCTGTCGTCCCCTTCTCCTCCTGCTCCCAATCCCTCCCAGCATCAGAATCTTTTCCAATGAGG, where S is the base C or T.

[0060] In the genome-wide association study, the SNP molecular marker at position 11504759 on chromosome 3 of the genomes of 367 Zhongwei goats reached the genome-wide significant level, indicating that this marker is significantly associated with the traits of the length of the wool curl and the proportion of the flower spike in the wool curl of Zhongwei goats. Moreover, when this marker mutates to T, it is beneficial for Zhongwei goats to have a longer length of the wool curl and a larger proportion of the flower spike in the wool curl, as shown in Table 5.

[0061] Table 5 SNP gene frequency and genotype frequency at position 11504759 on chromosome 3 of the Zhongwei goat genome

[0062]

[0063] As can be seen from Table 5 in combination with Table 4, Zhongwei goats with long hair strand bending length and a large proportion of flower spikes in the hair strand can be bred through the C→T mutation at position 11504759 on chromosome 3 of the Zhongwei goat genome. By selecting individuals with the TT genotype and using them as the male or female parent, the traits of the hair strand bending length and the proportion of flower spikes in the hair strand of the offspring of Zhongwei goats can be improved.

[0064] It should be noted that when the claims of the present invention involve numerical ranges, it should be understood that any value between the two endpoints of each numerical range and the two endpoints themselves can be selected. To avoid redundancy, preferred embodiments of the present invention are described.

[0065] Although the preferred embodiments of the present invention have been described, those skilled in the art can make additional changes and modifications to these embodiments once they know the basic creative concept. Therefore, the appended claims are intended to be interpreted to include the preferred embodiments and all changes and modifications that fall within the scope of the present invention.

[0066] Obviously, those skilled in the art can make various changes and modifications to the present invention without departing from the spirit and scope of the present invention. Thus, if these modifications and variations of the present invention fall within the scope of the claims of the present invention and their equivalent technologies, the present invention also intends to include these modifications and variations.

Claims

1. A molecular marker related to the fur traits of Zhongwei goats, characterized in that: The fur trait of Zhongwei goat is the curvature length of the hair strand or the proportion of the tassel to the hair strand. The nucleotide sequence of the molecular marker is shown in SEQ ID NO.

1. A mutation from C to T occurs at the 102 bp of the sequence shown in SEQ ID NO.

1.

2. Use of a typing detection reagent for molecular markers related to the fur traits of Zhongwei goats as claimed in claim 1 in identifying the bending length of Zhongwei goat wool strands, characterized in that: The method for determining the bending length of Zhongwei goat wool strands includes the following steps: The base at the 102 bp position of the molecular marker of the goat to be tested is detected. When the base at the 102 bp position is T, the curvature length of the goat's hair strand is greater than the curvature length of the goat's hair strand when the base at the 102 bp position is C.

3. An application of a typing detection reagent for molecular markers related to the fur traits of Zhongwei goats according to claim 1 in identifying the proportion of inflorescences to hair strands of Zhongwei goats, characterized in that: The method for identifying the proportion of flower spikes to hair strands of Zhongwei goats comprises the following steps: The base at the 102 bp position of the molecular marker of the goat to be tested is detected. When the base at the 102 bp position is T, the ratio of the inflorescence to the hair strand of the goat is greater than when the base at the 102 bp position is C.

4. Use of a typing detection reagent for molecular markers related to the fur traits of Zhongwei goats as described in claim 1 in breeding Zhongwei goats with long hair strand bend length and / or a large proportion of tassels to hair strands.

5. The use according to claim 4, characterized in that: The genotype of the goat at the 102 bp position of the molecular marker is detected, and individuals with the TT genotype are selected as parents to increase the curvature length of the hair strands and / or the proportion of the flower spike to the hair strands of the offspring.

Images