Composition for identifying dark fringe oriental tun, red fin oriental tun and hybrid tun and application thereof

Abstract

The invention relates to a composition for identifying Dongfengtun, Red Fin Dongfengtun and Hybrid Trench and application thereof, and belongs to the field of molecular biology, the composition comprises a pair of primers and a group of probes, and the sequences are shown as SEQ ID NO.1-4. The invention also provides a kit for identifying Dongfengtun, Red Fin Dongfengtun and Hybrid Trench, and the kit is used for identifying Dongfengtun, Red Fin Dongfengtun and Hybrid Trench. The kit comprises the composition disclosed by the invention. The composition can be used for rapidly and synchronously detecting and analyzing the dark-festival oriental tun, the red-fin oriental tun and the hybrid tun, and is not limited by individuals, ages, genders, groups and the like of the three fishes.

Description

Technical Field

[0001] The present invention belongs to the field of molecular biology, and specifically relates to a composition and application for identifying dark-striped Oriental tuna, red-finned Oriental tuna and hybrid tuna. Background Art

[0002] Red Fin Oriental Village Takifugu rubripes ) and Dark Pattern Oriental Tun ( Takifugu obscurus ) belongs to the class Osteichthyes, order Tetraodontiformes, family Tetraodontidae, genus Oriental Tetraodont Takifugu ). Both are fish with high nutritional and economic value, and are the main economic species in my country's rivers and towns.

[0003] In order to meet the needs of the rapid development of the Hetun industry, breeders use the principle of hybrid vigor to increase production and efficiency, and use dark-striped Oriental Tun as the female parent and red-finned Oriental Tun as the male parent for hybrid breeding, and obtain hybrid Oriental Tun F1 generation (hereinafter referred to as hybrid Tun) with excellent traits such as high survival rate, fast growth rate and good muscle quality. The meat quality of hybrid Tun inherits the delicious flavor of the female parent, is softer than the muscle texture of the male parent, and hybrid Tun can be cultivated in fresh water. It is also better than the female parent in terms of body length and growth rate during the seedling period, which effectively reduces the breeding cost while meeting market demand. However, the morphological characteristics of hybrid Tun are atypical, with both dot-shaped and striped patterns, which are difficult to identify with the naked eye. If hybrid Tun is mixed into the breeding parent group, it will cause the Hetun germplasm to be mixed and disordered hybridization, which will seriously affect the healthy development of the Hetun breeding industry. Therefore, it is particularly important to establish a set of methods for quickly and accurately identifying hybrid Tun.

[0004] So far, there are few reports on the research of hybridization identification methods. COI Genetic DNA barcoding can be used to identify species of most bony fish, but this method can only identify maternal genetic information and cannot determine the paternal origin. Studies have shown that using sequence analysis and comparison of certain nuclear genes to obtain more genetic information of species may help reveal the parental origin and hybridization of hybrid species, but there are thousands of nuclear gene types, and it is still unknown which nuclear gene can be used for identification. There are no related reports on fish of the family Tunidae. Summary of the invention

[0005] The technical problem to be solved by the present invention is to provide a composition for identifying dark-striped Oriental taro, red-fin Oriental taro and hybrid taro and its application, which can identify dark-striped Oriental taro, red-fin Oriental taro and hybrid taro, and the method is simple, rapid, specific and low-cost.

[0006] The present invention is achieved through the following technical solutions: A composition for identifying dark-striped Oriental tuna, red-finned Oriental tuna and hybrid tuna, the composition comprises a pair of primers and a set of probes, the forward primer of the primers is: 5′-GAGCCCCGCAGCCTTTCT-3′ (SEQ ID NO.1); the reverse primer is: 5′-ATGTACGTCTTGATGCCCTTGA-3′ (SEQ ID NO.2); the probes are: probe 1: FAM-TGCTCCAT T GAAGATGCCAC-MGB (SEQ ID NO.3); Probe 2: HEX-TGCTCCAT C GAAGATGCCAC-MGB (SEQ ID NO. 4).

[0007] The present invention also provides a kit for identifying dark-striped Oriental tuna, red-finned Oriental tuna and hybrid tuna, wherein the kit comprises the composition.

[0008] The present invention also provides the use of the composition in identifying dark-striped Oriental tuna, red-fin Oriental tuna and hybrid tuna.

[0009] Furthermore, the application method is (1) extracting genomic DNA from a sample to be tested; (2) using the genomic DNA as a template, performing fluorescent PCR using the primer set shown in SEQ ID NO.1-2 and the probe set shown in SEQ ID NO.3-4; (3) Determine the species of the sample to be tested based on the difference in amplification Ct values; when a Ct value appears in the FAM signal channel and no Ct value appears in the HEX signal channel, the sample to be tested is a dark-striped T. truncatula; when the Ct value of the FAM signal channel is 2 to 5 greater than the Ct value of the HEX channel, the sample to be tested is a red-finned T. truncatula; when the Ct value of the FAM channel is close to the Ct value of the HEX channel and the difference between the two is less than 2, the sample to be tested is a hybrid T. truncatula.

[0010] The beneficial effects of the present invention compared with the prior art are as follows: (1) Based on the nuclear gene SH3PX3 sequence characteristics of the dark-striped Oriental tuna, the red-finned Oriental tuna and the hybrid tuna, the present invention has established a SNP molecular marker that can identify the dark-striped Oriental tuna, the red-finned Oriental tuna and the hybrid tuna after analysis and comparison. The polymorphism of the SNP site is the base T or C. When the base is T, the corresponding species is the dark-striped Oriental tuna, when the base is C, the corresponding species is the red-finned Oriental tuna, and when the bases are both T and C, the corresponding species is the hybrid tuna. The corresponding species category can be directly identified according to the bases of the SNP polymorphic site; The primers and probes developed based on the SNP molecular markers of the present invention can be used for rapid and synchronous detection and analysis of dark-striped Oriental tuna, red-fin Oriental tuna and hybrid tuna, without being restricted by the individuals, ages, genders, groups, etc. of the three types of fish. The present invention provides reliable technical support for rapid and accurate identification of hybrid tuna and their parents. BRIEF DESCRIPTION OF THE DRAWINGS

[0011] Figure 1 This is the fluorescence PCR amplification curve of the dark pattern Oriental Tun; Figure 2 This is the fluorescence PCR amplification curve of Red Fin Oriental Tun; Figure 3 It is the hybridization fluorescence PCR amplification curve diagram; Figure 4 Peak diagram for analyzing the sequencing products of the SH3PX3 genes of the dark-striped Oriental tun, red-finned Oriental tun and hybrid tun. DETAILED DESCRIPTION

[0012] The present invention is further described below in conjunction with the accompanying drawings and embodiments.

[0013] The present invention establishes SNP molecular markers based on the nuclear gene SH3PX3 sequence characteristics of dark-striped Oriental tun, red-finned Oriental tun and hybrid tun, and establishes a convenient and rapid application method, which can be used for the identification of dark-striped Oriental tun, red-finned Oriental tun and hybrid tun seedlings.

[0014] Embodiment 1: (1) Samples and processing: 30 samples, including 10 samples of dark-striped tuna, red-finned tuna and hybrid tuna, whose species have been clearly identified. The dark-striped tuna samples and hybrid tuna samples were from Jiangsu Zhongyang Group Co., Ltd. (Hai'an Base), and the red-finned tuna samples were collected from the coastal waters of Qingdao, Shandong. 50 mg of each sample was extracted using a commercial genome extraction kit and stored for later use.

[0015] (2) SH3PX3 gene amplification and sequencing: A pair of primers were designed based on the SH3PX3 gene of the Oriental genus, and PCR amplification was performed using the sample DNA extracted in step (1) as a template. The amplified product was sent to a genetic biology company for sequencing.

[0016] (3) Establishment of core SNP molecular markers based on SH3PX3 gene for identification of dark-striped Oriental tuna, red-finned Oriental tuna and hybrid tuna: Figure 4As shown, the SH3PX3 gene sequencing products of 30 dark-striped Oriental tun, red-finned Oriental tun and hybrid tun were analyzed by molecular biology software, and the peak diagram of the site was analyzed. After comparison and analysis, it was found that there was a mutation site at the 30th position of the SH3PX3 nuclear gene amplification sequence. The polymorphic site at this site was T, corresponding to the dark-striped Oriental tun; the polymorphic site was C, corresponding to the red-finned Oriental tun; the polymorphic site was T / C, corresponding to the hybrid tun. Through the software, the dark-striped Oriental tun with a polymorphic site of T was a clear and obvious single peak here, the red-finned Oriental tun with a polymorphic site of C was a clear and obvious single peak here, and the hybrid tun with a polymorphic site of T / C was a clear and obvious double peak here, which shows that the SNP site is an effective site for distinguishing dark-striped Oriental tun, red-finned Oriental tun and hybrid tun. The SH3PX3 nuclear gene sequence of the amplified region of this site is shown in SEQ ID NO.5-7.

[0017] (3) Application of SNP sites: In order to more intuitively reflect the unique application of SNP, the present invention designs a pair of primers and a pair of fluorescent MGB probes based on the SNP sites, as shown in SEQ ID NO. 1-4: Forward primer SEQ ID NO.1: 5′-GAGCCCCGCAGCCTTTCT-3′; Reverse primer SEQ ID NO.2: 5′-ATGTACGTCTTGATGCCCTTGA-3′; Probe 1 SEQ ID NO.3: FAM-TGCTCCATTGAAGATGCCAC-MGB; Probe 2 SEQ ID NO.4: HEX-TGCTCCATCGAAGATGCCAC-MGB.

[0018] Fluorescence PCR amplification was performed using the genomic DNA of dark-striped Oriental tun, red-finned Oriental tun and hybrid tun as templates, using primers and probes shown in SEQ ID NO.2-5.

[0019] The 25μl reaction system of fluorescent PCR is as follows: The amplification reaction system of fluorescent PCR is 25μL, containing 12.5μL of fluorescent PCR Mix premix (purchased from Qingdao Lijian Biotechnology Co., Ltd.), 5μL of DNA template, 0.5μL of each primer (20μM), 0.5μL of each probe (10μM), and 5.5μL of water. The final concentration of the primers shown in SEQ ID NO.2-3 in the reaction system is 20 μM, and the final concentration of the probes shown in SEQ ID NO.4-5 in the reaction system is 10 μM.

[0020] The reaction conditions of fluorescence PCR are as follows: the reaction program of fluorescence PCR includes: 37°C, 2 minutes; 95°C, 2 minutes, 95°C, 15 seconds, 48°C, 30 seconds, 45 cycles.

[0021] The amplification curves of the dark-striped Oriental tun, red-finned Oriental tun and hybrid tun are shown in Figure 1 , Figure 2 , Figure 3 As shown, the detection primers and probes of the SNP molecular marker can be used to amplify the dark-striped Oriental truncatum, the red-finned Oriental truncatum and the hybrid truncatum to obtain good amplification curves.

[0022] (4) Application of the method established by SNP molecular markers: The results of fluorescence PCR amplification based on SNP molecular markers are shown in Table 1. When amplifying the dark-striped Oriental tun samples, an obvious amplification signal was observed in the FAM channel, and 20≤Ct≤35, while there was no effective amplification in the HEX channel; when amplifying the red-finned Oriental tun samples, both the FAM and HEX channels were effectively amplified, and the Ct value of the FAM channel was 2~5 greater than the Ct value of the HEX channel; when amplifying the hybrid tun samples, both the FAM and HEX channels were effectively amplified, and the Ct values ​​of the FAM channel and the HEX channel were close, with a difference of less than 2. Therefore, the present invention can achieve rapid and accurate identification of dark-striped Oriental tun, red-finned Oriental tun and hybrid tun by a fluorescence PCR method based on SNP molecular markers.

[0023] The sequence of the SNP site amplification region of the SH3PX3 gene of the dark-striped Oriental Tun (SEQ ID NO.5): GAGCCCGCAGCCTTTCTCCTGCTCCA T TGAAGATCCCACAAAACAGACCAAGTTCAAGGGCATCAAGACGTACAT; The sequence of the SNP site amplified region of the SH3PX3 gene of the red fin Dongfangtun (SEQ ID NO.6): GAGCCCGCAGCCTTTCTCCTGCTCCAT C GAAGATCCCACAAAACAGACCAAGTTCAAGGGCATCAAGACGTACAT; The sequence of the SNP site amplification region of the hybrid SH3PX3 gene (SEQ ID NO.7): GAGCCCGCAGCCTTTCTCCTGCTCCAT ( T / C )GAAGATCCCACAAAACAGACCAAGTTCAAGGGCATCAAGACGTACAT.

[0024] Table 1 Fluorescence PCR amplification results based on SNP molecular markers .

Claims

1. A composition for identifying dark-striped Oriental tuna, red-finned Oriental tuna and hybrid tuna, characterized in that: The composition comprises a pair of primers and a set of probes, wherein the primers are shown as SEQ ID NO.1-2; and the probes are shown as SEQ ID NO.3-4.

2. A kit for identifying dark-striped Oriental tuna, red-fin Oriental tuna and hybrid tuna, characterized in that: The kit comprises the composition according to claim 1.

3. Application of the composition described in claim 1 in identifying dark-striped Oriental tuna, red-fin Oriental tuna and hybrid tuna.

4. The use according to claim 3, characterized in that: The method of application is (1) Extracting genomic DNA from the sample to be tested; (2) using the genomic DNA as a template, performing fluorescent PCR using the primer set shown in SEQ ID NO.1-2 and the probe set shown in SEQ ID NO.3-4; (3) Determine the species of the sample to be tested based on the difference in amplification Ct values; when a Ct value appears in the FAM signal channel and there is no Ct value in the HEX signal channel, the sample to be tested is a dark-striped Oriental tun; When the Ct value of the FAM signal channel is 2-5 greater than the Ct value of the HEX channel, the sample to be tested is red fin Oriental tun; when the Ct value of the FAM channel is close to the Ct value of the HEX channel, and the difference between the two is less than 2, the sample to be tested is hybrid tun.

Images