Indel marker closely linked with major gene loci of sesamin and sesamolin content and application of Indel marker

Abstract

The invention discloses an Indel marker closely linked with major gene loci of the content of sesamin and sesamolin and application of the Indel marker, the major gene loci of the content of sesamin and sesamolin are qHL6, the contribution rates of the major gene loci of the content of sesamin and sesamolin to sesamin and sesamolin are 31% and 63.1% respectively, the Indel marker closely linked with qHL6 is PB01, and a detection primer of the Indel marker is shown as SEQ ID NO.1-2; the molecular marker PB01 and the primer thereof provided by the invention can be used for predicting the content of sesamin and sesamolin in a sesame material, so that high-sesamin and sesamolin strains can be quickly screened, and character screening and early prediction of sesamin and sesamolin of sesame breeding offspring are realized; the method is of great significance to improvement of high sesame and high lignan (sesamin and sesamolin) characters.

Description

Technical Field

[0001] The invention relates to the fields of molecular biology and crop genetic breeding, and in particular to a molecular marker closely linked to a major effect QTL of sesame high sesamin and sesamolin and an application thereof. Background Art

[0002] Sesame is a traditional high-quality oil crop and an important edible and medicinal crop. It has the functions of oil, food and medicine (Majdalawieh et al., 2017; Pathaket al., 2014; Wang et al., 2012). The Shennong Herbal Classic and Compendium of Materia Medica both record the health-promoting effects of sesame. Modern research shows that sesame is rich in a variety of physiologically active ingredients, among which the characteristic functional ingredients of sesame, sesame lignans, mainly include sesamin and sesamolin (Andargie et al., 2021; Budowski et al., 1964; Satake et al., 2015), which have a variety of physiological effects, such as antioxidant, anti-aging, anti-tumor, lowering blood lipids, lowering blood pressure, anti-thrombotic, relieving atherosclerosis, anti-estrogen, protecting the liver, alleviating depression and treating Parkinson's disease (Wang Weidong, 2005; Andargie et al., 2021; Ide et al., 2012; Majdalawieh et al., 2017; Oyinloye et al., 2016; Schmidt et al., 2005; Tanabe et al., 2011; Umeda-Sawada et al., 1999; Wang et al., 2019; Abe-Kanoh et al., 2018). al., 2019; Kim et al., 2020; Kumar et al., 2015; Majdalawieh et al.,2017; Majdalawieh et al., 2020; Wan et al., 2015). With the continuous deepening of the research and application of the nutritional and medicinal value of sesame lignans (sesamin and sesamolin), and the increasing attention paid by the people to high-quality life and nutritional health, the demand for sesame products has increased dramatically. The exploration and development and utilization of sesame peculiar nutritional functional components, sesamin and sesamolin, have very broad application prospects in the fields of food, medicine and other health industries. However, ordinary sesame varieties cannot meet the demand for raw materials for high-quality, diversified and functional processing products, and the market products are highly homogenized and have low added value. Sesame materials or varieties with high lignans (sesamin and sesamolin content) have become urgently needed raw materials in the food, health care, medicine and chemical industries. Domestic and foreign breeders have made the cultivation of varieties with high lignan content one of the important goals of sesame breeding.

[0003] However, extensive studies conducted by domestic and foreign scholars on the variation of sesamin and sesamolin content have shown that the lignan content of sesame germplasm resources varies widely, but sesame resources with high sesamin and sesamolin are relatively scarce (Wang et al., 2012; Xu Fangtao et al., 2020). Wang et al. divided sesame into three levels: high, medium and low based on the distribution characteristics of sesamin and sesamolin content; among them, sesame with a sesamin content of less than 4.00 mg / g and a sesamolin content of less than 2.50 mg / g is low-lignan sesame, and sesame with a sesamin content of more than 8.00 mg / g and a sesamolin content of more than 4.50 mg / g is high-lignan sesame. Xu Fangtao et al. analyzed 62 sesame germplasm materials with different geographical origins and obvious phenotypic variation, and found that the average sesamin and sesamolin contents of sesame varieties were 3.90 mg / g and 1.92 mg / g, respectively. These studies show that there is great potential for genetic improvement of sesamin and sesamolin content in sesame.

[0004] Sesamin and sesamolin content is a complex quantitative trait controlled by multiple genes. The use of molecular marker technology to carry out quantitative trait locus (QTL) genetic positioning and molecular marker-assisted breeding has been proven to be an effective means to solve the genetic improvement of complex traits such as crop yield and quality. Xu et al. (2021) identified 26 QTLs related to the variation of sesamin and sesamolin content through QTL analysis, among which the QTL loci qSmin11-1 and qSmol11-1 are located in the same interval of chromosome 11. Andargie et al. used gene prediction methods to predict 9 genes related to sesame lignan synthesis through computational analysis (Andargie et al., 2021). Ono et al. expressed cytochrome P450 genes CYP81Q1 and CYP81Q3 in Saccharomyces cerevisiae and identified that they catalyzed the synthesis of pinoresinol to piperitol and sesamin (Ono et al., 2006; Ono et al., 2018). Murata et al. (2018) identified CYP92B14 as being responsible for the oxygenation of sesamin to form sesamolin and sesamolin. However, there is still a lack of in-depth understanding of the genetic and molecular mechanisms of sesamin and sesamolin variation. Therefore, creating excellent and stable materials with high lignan (sesamin and sesamolin) content, discovering new QTLs that control sesame lignans (sesamin and sesamolin), and developing tightly linked molecular markers on this basis can accelerate the improvement process of sesame high lignan (sesamin and sesamolin) traits. Summary of the invention

[0005] In view of this, the present invention aims to discover new major gene loci that control lignan traits and develop molecular markers that are closely linked to them, so as to provide a new means for improving sesame high lignan content.

[0006] The technical solution of the present invention is as follows: The first aspect of the present invention provides a major gene locus qHL6 for the trait of high lignans (sesamin and sesamolin) in sesame, which is located on chromosome 6 and is a pleiotropic locus, and its contribution rates to sesamin and sesamolin are 31% and 63.1%, respectively.

[0007] The inventors first used EMS to induce mutagenesis in the sesame variety "Zhongzhi 14", and determined the sesamin and sesamolin contents of the M1 generation by liquid chromatography, screened mutants with sesamin contents higher than 7 mg / g, and obtained high sesamin and sesamolin mutant sesame with sesamin contents of 15.26 mg / g and sesamolin contents of 7.4 mg / g through multiple generations of self-pollination to the M8 generation. The mutant sesame was then used with "Miaoqian sesame" to discover the above-mentioned major effect QTL, and the specific approach was: hybridizing the sesame mutant and "Miaoqian sesame" to obtain F1 seeds, and self-pollinating the F1 plants to obtain the F2 population; extracting the total genomic DNA of the parents and F2 segregating populations; using simplified genome sequencing technology (ddRADseq) to perform genetic analysis on the parents and F2 progeny plants, constructing a high-density genetic linkage map of sesame, and combining the sesamin and sesamolin content data to locate the QTL.

[0008] The second aspect of the present invention provides a molecular marker PB01 which is closely linked to the major gene locus qHL6 of sesame high sesamin and sesamolin traits, and its sequence is shown below: gaatttattggtttgatttcgagcctaagttga[gtttac / g]ttgagcttgagctctattatttctgttcaccagccggctttc (the square brackets are for Indel sites).

[0009] The third aspect of the present invention provides a primer for detecting the molecular marker PB01, the sequence of which is as follows: PB01-F: 5'-GAATTTATTGGTTTGATTTCGAGCCTAAGTTG-3' (SEQ ID NO. 1); PB01-R: 5'-GAAAGCCGGCTGGTGAACAGAAATAATA-3' (SEQ ID NO. 2).

[0010] The fourth aspect of the present invention provides the use of molecular marker PB01 and primers thereof, including any of the following: (1) Preparation of detection kits; (2) Breeding of sesame seeds with high sesaminin and sesamelin content; (3) Early prediction or screening of sesame materials with high sesamin and sesamolin content.

[0011] The fifth aspect of the present invention provides a method for predicting / screening sesame materials with high sesamin and sesamolin content, specifically: using the genomic DNA of the sesame material as a template, using primers with sequences as shown in SEQ ID NO.1-2 to perform PCR amplification, and judging based on the size of the amplified product; wherein, when the amplified product is 76bp (SEQ ID NO.3), it indicates that the sesame material has high sesamin and sesamolin content.

[0012] In the above method, genomic DNA can be extracted from sesame leaves or other tissues; in one embodiment of the present invention, genomic DNA is extracted from sesame leaves.

[0013] In the above method, the size of the amplified product can be detected by polyacrylamide gel electrophoresis.

[0014] Compared with the prior art, the beneficial effects of the present invention are: The present invention utilizes the created high-sesamin and sesamolin sesame mutants to locate a major gene locus qHL6 located on chromosome 6 of sesame that affects the sesamin and sesamolin content traits. The locus is a one-cause pleiotropic locus that can explain 31% of the variation in the sesamin phenotype and 63.1% of the sesamolin phenotype. At the same time, a molecular marker PB01 closely linked to it was discovered, making the positioning of the major gene loci of the high-sesamin and sesamolin traits in sesame at the forefront of the same field.

[0015] Based on the molecular marker PB01 discovered by the present invention, its identification tools and methods are further provided, which can be used to predict the sesamin and sesamolin contents in sesame materials, and then quickly screen high sesamin and sesamolin strains for screening and early prediction of sesamin and sesamolin traits in sesame breeding offspring, and assist in the selection of sesamin and sesamolin with clear targets and low costs.

[0016] Compared with traditional breeding methods, the detection of the main effect gene loci of high sesame and sesamolin traits in the present invention is convenient and rapid, and early screening and elimination can be carried out in the seedling stage, which greatly improves the selection efficiency and saves production costs. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 The mass spectrum peak diagram of the sesamin and sesamelin content of the high-sesamin and sesamelin mutant in Example 1; wherein A is the standard solution, B is the wild-type seeds, and C is the high-sesamin and sesamelin mutant.

[0018] Figure 2 This is the LOD map of the main QTL sites of sesamin and sesamolin in Example 1; wherein A is the main QTL site of sesamin, and B is the main QTL site of sesamolin.

[0019] Figure 3 This is a schematic diagram of the polyacrylamide gel electrophoresis of the primers for the molecular marker PB01 in Example 2 after amplification in the F2 population parents and 75 strains; wherein the arrow indicates the marker (No. 42), samples No. 40 and No. 41 are the maternal parent (high sesame and sesamelin mutants) and the paternal parent (miaoqian sesame), respectively, and samples No. 5, 8, 13, 20, 21, 26, 27, 29, 33, 43, 45, 46, 48, 49, 60, 69, 72, and 75 are strains containing the major effect gene locus qHL6 of the high sesame and sesamelin traits identified. DETAILED DESCRIPTION

[0020] The technical solution of the present invention will be described clearly and completely below in conjunction with the embodiments and drawings. It should be understood that the specific implementation methods described herein are only used to illustrate and explain the present invention and are not used to limit the present invention.

[0021] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art to which the present invention belongs. The term "comprises" and any variations thereof in the specification and claims of the present invention are intended to cover non-exclusive inclusions.

[0022] The following examples determined the contents of sesamin and sesamolin in seeds according to the method of "Establishment of Efficient Extraction and Detection Technology of Sesamin and Screening of High Sesamin Germplasm" (Zhong Yanping et al., Beijing: Chinese Agricultural Science, 2022), and performed DNA extraction, PCR and polyacrylamide gel electrophoresis according to the conditions described in "Molecular Cloning Experiment Guide" (3rd edition) (translated by Huang Peitang et al., Beijing: Science Press, 2002).

[0023] If no specific techniques or conditions are specified in the following examples, the procedures are carried out in accordance with the techniques or conditions described in the literature in the art or in accordance with the product instructions; if no manufacturer is specified for the reagents or instruments used, they are all conventional products that can be obtained commercially.

[0024] Example 1 Based on the high-sesamin and sesamolin mutants created by the inventors, the main gene locus qHL6 for high-sesamin and sesamolin traits was discovered, and the marker PB01 was further developed. This example specifically includes the following processes: (1) Creation of high-sesamin and sesamolin mutants.

[0025] "Zhongzhi 14" is a white sesame variety bred by the Oil Crops Research Institute of the Chinese Academy of Agricultural Sciences. It has a high plant height, medium-late maturity, moderate flowering period, loose plant shape, medium-sized leaves, pure white seeds, good commercial quality, and average disease resistance and lodging resistance. Zhongzhi 14 was planted in a net shed, and after collecting the seeds of excellent individual plants, it continued to be planted in the net shed. After three generations of purification, excellent individual plants were collected in each generation, and then one excellent individual plant was selected for breeding for mutagenesis.

[0026] The above-mentioned "Zhongzhi 14" seeds were used as mutagenic materials, and the chemical mutagen EMS was used at a concentration of 1% to induce mutagenesis to obtain M1 seeds. The seeds of the M1 generation were harvested, and the contents of sesamin and sesamolin in the seeds were determined using the NIRS DS 2500 multifunctional near-infrared analyzer. The individual plants with increased sesamin and sesamolin were selected to plant the M2 generation in the field. The M2 generation had a drastic separation in plant type, leaf angle, and seed color. The individual plants with black seeds, large leaf angle, branching, and high fruiting rate were selected for self-pollination and seed preservation. The NIRS DS The contents of sesamin and sesaglin in mature seeds of each individual plant were determined by 2500 multifunctional near-infrared analyzer for preliminary screening, and the contents of sesamin and sesaglin in individual seeds with increased contents of sesamin and sesaglin obtained by preliminary screening were accurately determined by liquid chromatography, and the individual plants with increased contents of sesamin and sesaglin identified by precise determination were planted in the field to obtain the M3 line; individual plant selection and self-pollination of M3-M7 lines were continued in the field according to plant type, leaf angle, seed color, leaf size, disease resistance, lodging resistance and commercial quality, and the contents of sesamin and sesaglin in seeds were determined by liquid chromatography, and individual plants with high contents of sesamin and sesaglin were selected for planting and purification. By the M8 generation, the characteristics of each line had stabilized, among which line 566 had the highest contents of sesamin and sesaglin and the best performance, and was named "SiHLignan1".

[0027] In the seeds of this mutant, the contents of sesamin and sesamolin were significantly increased. Figure 1 shown.

[0028] (2) Discovery of the major gene loci for high sesamin and sesamolin traits.

[0029] The high-sesamin and sesamolin mutant sesame "SiHLignan1" (sesamolin 15.26 mg / g, sesamolin 7.4 mg / g) with significant differences in sesamin and sesamolin content was hybridized with the low-sesamin and sesamolin sesame variety "Miaoqianzhima" (sesamolin content 1.4 mg / g, sesamolin 1.5 mg / g) to obtain F1 seeds, and the F1 plants were self-pollinated to obtain the F2 segregating population. This population was planted in Wuchang, Hubei. After the plants matured, the sesame seeds of each individual plant of the parents and F2 offspring were harvested. The sesamin and sesamolin content of the seeds of each individual plant of the parents and F2 population was determined by liquid chromatography to obtain phenotypic data.

[0030] The CTAB method was used to extract the total genomic DNA of the leaves of the parent and RIL isolation population. The specific steps are as follows: ① Leaves of each parent and F2 segregation population were stored in an ultra-low temperature refrigerator (-70℃) for future use; when used, appropriate amount of leaf samples were taken from the ultra-low temperature refrigerator, immediately placed in a frozen mortar, and ground into powder with liquid nitrogen; ② Quickly put it into a 50ml centrifuge tube, add CTAB extraction solution (2% CTAB, 0.1M Tris-Cl, 1.4M NaCl, 20mM EDTA, pH 7.5) preheated in a 65℃ water bath, mix well, and place it in a 65℃ water bath for 40 minutes; ③ Take out the centrifuge tube, add an equal volume of chloroform and isoamyl alcohol mixed in a volume ratio of 24:1, slowly invert the centrifuge tube upside down 30-50 times to mix thoroughly, and centrifuge at 1300g for 10 minutes; ④ Take the supernatant after centrifugation and place it in another centrifuge tube, repeat step ③ once, then take the supernatant again and add it to 0.6 times the volume of ice-cold isoamyl alcohol, slowly invert the centrifuge tube until flocculent precipitation gathers; then place it at -20℃ for 30 minutes, pick out the precipitate, rinse it with 75% (volume ratio) alcohol 2-3 times, dry it and dissolve it in sterile water; ⑤ Repeat the above steps once again, take the supernatant, add 0.1 times the volume of NaAc (3 mol / L, PH5.2) to it, mix well and slowly add 2 times the volume of ice-cold anhydrous ethanol. After standing for 5 minutes, slowly rotate the centrifuge tube until flocculent precipitate appears, pick out the precipitate and transfer it to a 1.5 ml centrifuge tube, rinse with 75% (volume ratio) alcohol 2-3 times, dry and dissolve in sterile water, and store in a -20℃ refrigerator for later use. The total genomic DNA of the leaves of each parent and RIL isolation group is obtained.

[0031] The simplified genome sequencing technology was used to genotype the parents and F2 progeny plants, that is, the genomic DNA of the target individuals was first cut and interrupted by restriction endonucleases, and then the library was constructed for high-throughput sequencing. By aligning the sequencing data (paired-end reads) to the reference genome of sesame (Wang et al., 2014), high-density SNPs and InDels between the two parents were discovered, and the genotype analysis of the F2 plants was performed; based on the high-density SNPs and InDels, the MSTMap software was used to construct a genetic linkage map; using the sesamin and sesamolin data, genotype data and genetic linkage map data of the F2 population parents and 75 lines, QTL analysis was performed using the QTL Cartographer (version 1.17j) software, and the Composite Interval Mapping (CIM) method was used, with the threshold determined by permutation (1000 times, p=0.05), to perform gene positioning analysis.

[0032] like Figure 2 As shown in the figure, the QTL positioning results are as follows: two QTL loci for sesamin, qSmin-6 and qSmin-12, were identified, with LOD values ​​of 13.27 and 7.28, respectively, and the phenotypic variation explanation rates of 31% and 9.9%, respectively; two QTL loci for sesamolin, qSmol-6 and qSmol-2, were identified, with LOD values ​​of 18.68 and 4.75, respectively, and the phenotypic variation explanation rates of 63.1% and 11.8%, respectively. Among them, qSmin-6 was located in the interval of 59.15-60.52 cM between markers c06b037 and c06b039 on chromosome 6 (chr6), and qSmol-6 was located in the interval of 55.97-60.52 cM between markers c06b035 and c06b039 on chromosome 6 (chr6). By comparing the sesame reference genome, qSmin-6 and qSmol-6, which have greater effects, are located in the same physical interval and are a single-cause, multi-effect site named qHL6.

[0033] (3) Development of PB01 marker.

[0034] Fourteen F2 exchange plants in the qHL6 interval were selected to plant F2:3 families (a total of 1030 plants) in the field. Based on the simplified genome sequencing results of the above parents, 20 SNPs and 2 indel markers were evenly developed in the qHL6 interval. Primer3 software was used to design amplification primers for each target site. The parameters set included: 1) the length of the primer sequence was between 17-32bp; 2) the Tm value was between 60-64℃, with the optimal value being 62℃; 3) the product size did not exceed 300bp; 4) the sequencing reads must be able to cover the target site. Then e-PCR software was used to detect the amplification specificity of each pair of primers. The developed specific primers were used to perform genotyping on the above F2:3 families through targeted sequencing technology. Combined with the results of sesamin and sesamolin content determination, qHL6 was narrowed down to the two markers PB01-PA08 on chromosome 6. PB01 is an InDel marker, which is closely linked to the high sesamin and sesamolin traits, and its detection primer sequence is as follows: PB01-F: 5'-GAATTTATTGGTTTGATTTCGAGCCTAAGTTG-3'; PB01-R: 5'-GAAAGCCGGCTGGTGAACAGAAATAATA-3'.

[0035] Example 2 The primers of the molecular marker PB01 obtained by the present invention, which is closely linked to the major effect gene locus qHL6, can be used to screen and predict the sesamin and sesamolin traits of sesame breeding offspring. This example specifically takes the F2 population constructed after hybridization of high sesamin and sesamolin mutants with Miaoqian sesame as an example, and molecular identification of each strain at the seedling stage includes the following steps: (1) Extraction of total DNA from leaves. The specific extraction procedure is as described in Example 1.

[0036] (2) Molecular identification was performed using primers for the molecular marker PB01 (i.e., PB01-F / R).

[0037] After PCR amplification, polyacrylamide gel electrophoresis and band type statistics, a total of 50 strains with a 76bp band (i.e., strains containing the major gene locus qHL6 for high sesame and sesamolin traits) were obtained.

[0038] See the gel plate photos of the population parents and 75 strains after electrophoresis and staining. Figure 3Among them, samples No. 40 and 41 are the maternal and paternal parent respectively, and samples No. 5, 8, 13, 20, 21, 26, 27, 29, 33, 43, 45, 46, 48, 49, 60, 69, 72, and 75 correspond to ZT16, ZT28, ZT13, ZT43, ZT44, ZT19, ZT20, ZT33, ZT06, ZT09, ZT11, ZT21, ZT23, ZT35, ZT36, ZT40, ZT12, and ZT25, respectively. The amplification can obtain the same 76bp band as the maternal parent, which is the strain containing the major effect gene locus qHL6 of high sesamin and sesamelin traits.

[0039] In addition, the contents of sesamin and sesamolin in 75 strains of the F2 population were measured after the grains matured. The results showed that among the 18 strains obtained by molecular marker-assisted selection, 77.8% (see Table 1, a total of 14 strains) had lignan (sesamin and sesamolin) contents higher than the F2 population average of 7.01 mg / g (sesamin and sesamolin were 4.78 mg / g and 2.23 mg / g, respectively).

[0040] Table 1 Fourteen sesame strains with higher lignan content than the population mean obtained by molecular marker-assisted selection

[0041] Compared with conventional breeding methods, the selection efficiency of strains with higher sesamin and sesamolin contents can be increased by 36.5 percentage points by using molecular marker PB01 to identify and assist in the selection (calculated as: the selection efficiency of strains selected by marker minus the conventional selection efficiency calculated after measuring phenotypic values). Analysis shows that the proportion of strains with sesamin and sesamolin contents higher than 8 mg / g in the F2 population obtained by molecular marker-assisted selection reached 72.2% (the number of strains with the sum of sesamin and sesamolin contents higher than 8 in Table 1 / the number of strains obtained by molecular marker-assisted selection).

[0042] In summary, the use of molecular marker PB01 to predict the sesamin and sesamolin content in sesame breeding offspring by identifying the major gene locus qHL6 can greatly increase the breeding efficiency of sesamin and sesamolin improvement.

[0043] It should be noted that the above embodiments are only part of the embodiments of the present invention rather than all the embodiments, and are only used to illustrate the technical solution of the present invention rather than to limit it. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative work are within the scope of protection of the present invention.

Claims

1. An Indel marker tightly linked to the major effect gene loci of sesamin and sesamolin content, characterized in that: The main effect gene locus of sesamin and sesamolin content is located on chromosome 6, named qHL6; the nucleotide sequence of the Indel marker is as follows: GAATTTATTGGTTTGATTTCGAGCCTAAGTTGA[GTTTAC / G]TTGAGCTTGAGCTCTATTATTTCTGTTCACCAGCCGGCTTC.

2. Application of the Indel marker as claimed in claim 1 in sesame breeding with high sesamin and sesamelin.

3. Detect the application of the Indel-labeled primer as claimed in claim 1 in the breeding of sesame seeds containing high sesamin and sesamelin.

4. The use according to claim 3, characterized in that The sequences of the primers are shown in SEQ ID NO.1-2.

5. A detection kit, characterized in that: The detection kit is used to detect the Indel marker according to claim 1, and the detection kit comprises primers whose sequences are shown in SEQ ID NO.1-2.

6. Use of the detection kit as claimed in claim 5 in predicting or identifying sesame materials high in sesamin and sesamolin.

7. A method for screening sesame materials with high sesamin and sesamolin content, characterized in that: Sesame material genomic DNA is used as a template, and PCR amplification is performed using primers with sequences shown in SEQ ID NO.1-2, and judgment is made based on the size of the amplified product.

8. The method according to claim 7, characterized in that When the amplification product is 76 bp, it indicates that the sesame material has high sesamin and sesamolin contents.

9. The method according to claim 7, characterized in that: The amplified product was detected by polyacrylamide gel electrophoresis.

10. The method according to claim 7, characterized in that The genomic DNA is extracted from sesame leaves.

Images