Indel markers closely linked to major gene loci related to sesamin and sesamolin content and their applications

Abstract

This invention discloses an Indel marker closely linked to the major gene loci for sesamin and sesamolin content and their application. The major gene locus for sesamin and sesamolin content is qHL6, which contributes 31% and 63.1% to sesamin and sesamolin content, respectively. The Indel marker closely linked to qHL6 is PB01, and its detection primers are shown in SEQ ID NO.1-2. The molecular marker PB01 and its primers provided by this invention can predict the levels of sesamin and sesamolin content in sesame materials, thereby enabling rapid screening of high sesamin and sesamolin content lines. This allows for the screening and early prediction of sesamin and sesamolin traits in sesame breeding progeny, which is of great significance for improving the high sesame and high lignan (sessamin and sesamolin) traits.

Description

Technical Field

[0001] This invention relates to the fields of molecular biology and crop genetics and breeding, specifically to a molecular marker closely linked to major QTLs of sesamin and sesamolin in sesame and its application. Background Technology

[0002] Sesame is a traditional, high-quality oilseed and an important crop used for both food and medicine, possessing medicinal, edible, and medicinal properties (Majdalawieh et al., 2017; Pathaket et al., 2014; Wang et al., 2012). The Shennong Bencao Jing (Shennong's Classic of Materia Medica) and the Compendium of Materia Medica both record the health benefits of sesame in strengthening the body. Modern research shows that sesame is rich in various physiologically active components. Among them, the special functional components of sesame, sesamolone, mainly including sesamin and sesamolin (Andargie et al., 2021; Budowski et al., 1964; Satake et al., 2015), have a variety of physiological effects, such as anti-oxidation, anti-aging, anti-tumor, lowering blood lipids, lowering blood pressure, anti-thrombosis, alleviating atherosclerosis, anti-estrogenic, liver protection, alleviating depression, and treating Parkinson's disease (Wang Weidong, 2005; Andargie et al., 2021; Ide et al., 2012; Majdalawieh et al., 2017; Oyinloye et al., 2016; Schmidt et al., 2005; Tanabe et al., 2011; Umeda-Sawada et al., 1999; Wang et al., 2019; Abe-Kanoh et al.). (Al., 2019; Kim et al., 2020; Kumar et al., 2015; Majdalawieh et al., 2017; Majdalawieh et al., 2020; Wan et al., 2015). With the deepening research and application of the nutritional and medicinal value of sesame lignans (sesamin and sesamolin), and the increasing emphasis on high-quality living and nutritional health, the demand for sesame products has increased dramatically. The discovery and development of sesamin and sesamolin, the unique nutritional and functional components of sesame, have very broad application prospects in the food, pharmaceutical, and other health industries. However, ordinary sesame varieties cannot meet the demand for high-quality, diversified, and functional raw materials for processed products, resulting in severe product homogenization and low added value in the market. Sesame materials or varieties with high lignan (sesamin and sesamolin content) have become urgently needed raw materials in the food, health, pharmaceutical, and chemical industries. Domestic and foreign breeders have made the cultivation of varieties with high lignan content one of the important goals of sesame breeding.

[0003] However, extensive research by scholars both domestically and internationally on the variation of sesamin and sesamolin content has shown that sesame germplasm resources exhibit wide variation in lignan content, but high-saeosin and high-sesamolinin sesame resources are relatively scarce (Wang et al., 2012; Xu et al., 2020). Based on the distribution characteristics of sesamin and sesamolin content, Wang et al. classified sesame into three grades: high, medium, and low; sesame with sesamin content less than 4.00 mg / g and sesamolin content less than 2.50 mg / g was classified as low-lignan sesame, while sessamin content greater than 8.00 mg / g and sesamolin content greater than 4.50 mg / g was classified as high-lignan sesame. Xu et al.'s analysis of 62 sesame germplasm materials from different geographical origins with significant phenotypic variation showed that the average sesamin and sesamolin content of sesame cultivars were 3.90 mg / g and 1.92 mg / g, respectively. These studies indicate that there is significant potential for genetic improvement of sesamin and sesamolin content in sesame.

[0004] Sesamin and sesamolin content are complex quantitative traits controlled by multiple genes. Using molecular marker technology for quantitative trait locus (QTL) genetic mapping and marker-assisted breeding has proven to be an effective means of addressing the genetic improvement of complex traits such as crop yield and quality. Xu et al. (2021) identified 26 QTLs associated with variations in sesamin and sesamolin content through QTL analysis, with QTL loci qSmin11-1 and qSmol11-1 located in the same region on chromosome 11. Andargie et al. used gene prediction methods to predict nine genes related to sesame lignan synthesis through computational analysis (Andargie et al., 2021). Ono et al. expressed the cytochrome P450 genes CYP81Q1 and CYP81Q3 in Saccharomyces cerevisiae and identified their catalytic activity in the synthesis of pinoresinol into piperine and sesamin (Ono et al., 2006; Ono et al., 2018). Murata et al. (2018) identified CYP92B14 as responsible for the oxygenation of sesamin to form sesalin and sesaminol. However, the genetic and molecular mechanisms underlying variations in sesamin and sesalin remain poorly understood. Therefore, creating high-quality and stable materials with high lignan (sessamin and sesalin) content, discovering new QTLs controlling sesame lignan (sessamin and sesalin) content, and developing tightly linked molecular markers based on these findings can accelerate the improvement of high lignan (sessamin and sesalin) content traits in sesame. Summary of the Invention

[0005] In view of this, the present invention aims to discover new major gene loci controlling lignan traits and develop molecular markers closely linked to them, so as to provide new means for improving the lignan content of sesame.

[0006] The technical solution of the present invention is as follows:

[0007] The first aspect of the present invention provides a major gene locus qHL6 for the sesame high lignan (sesamin and sesamolin) trait, which is located on chromosome 6 and is a pleiotropic locus, contributing 31% and 63.1% to sesamin and sesamolin, respectively.

[0008] The inventors first used EMS to mutate the sesame variety "Zhongzhi 14". They then determined the sesamin and sesamolin content of the M1 generation using liquid chromatography, screened for mutants with sesamin content higher than 7 mg / g, and obtained high-sesamin and sesamolin mutants (15.26 mg / g sesamin and 7.4 mg / g sesamolin) through multiple generations of self-pollination to the M8 generation. This mutant sesame was then used to discover the aforementioned major-effect QTLs by crossing it with "Miaoqian sesame". Specifically, the sesame mutant and "Miaoqian sesame" were hybridized to obtain F1 seeds, and the F1 plants were self-pollinated to obtain the F2 population. Total genomic DNA was extracted from the parents and the F2 segregating population. Reduced-radio sequencing (ddRADseq) was used to analyze the genes of the parents and individual F2 offspring plants, constructing a high-density genetic linkage map for sesame, and using the sesamin and sesamolin content data to locate the QTLs.

[0009] A second aspect of this invention provides a molecular marker PB01 closely linked to the major gene locus qHL6 for the high sesamin and sesamin phenotypes in sesame, the sequence of which is shown below:

[0010] gaatttattggtttgatttcgagcctaagttga[gtttac / g]ttgagcttgagctctattatttctgttcaccagccggctttc (Indel site is in square brackets).

[0011] A third aspect of this invention provides primers for detecting the molecular marker PB01, the sequences of which are shown below:

[0012] PB01-F: 5'-GAATTTATTGGTTTGATTTCGAGCCTAAGTTG-3' (SEQ ID NO. 1);

[0013] PB01-R: 5'-GAAAGCCGGCTGGTGAACAGAAATAATA-3' (SEQ ID NO. 2).

[0014] The fourth aspect of this invention provides applications of the molecular marker PB01 and its primers, including any of the following:

[0015] (1) Preparation of the detection kit;

[0016] (2) Breeding of sesame with high sesamin and sesamin levels;

[0017] (3) Early prediction or screening of sesame materials with high sesamin and sesamin content.

[0018] The fifth aspect of this invention provides a method for predicting / screening sesame materials with high sesamin and sesamolin content, specifically: using sesame material genomic DNA as a template, performing PCR amplification with primers showing sequences as shown in SEQ ID NO.1-2, and judging based on the size of the amplification product; wherein, when the amplification product is 76bp (SEQ ID NO.3), it indicates that the sesame material has high sesamin and sesamolin content.

[0019] In the above methods, genomic DNA can be extracted from sesame leaves or other tissues; in one embodiment of the present invention, genomic DNA is extracted from sesame leaves.

[0020] In the above method, the size of the amplified product can be detected by polyacrylamide gel electrophoresis.

[0021] Compared with existing technologies, the beneficial effects of the present invention are as follows:

[0022] This invention utilizes a newly created sesame mutant with high sesamin and sesamolin content to locate a major gene locus qHL6 on chromosome 6 of sesame that affects the sesamin and sesamolin content traits. This locus is a pleiotropic locus, which can explain 31% of the variation in the sesamin phenotype and 63.1% in the sesamolin phenotype. At the same time, a molecular marker PB01 closely linked to it was discovered, placing the work on locating major gene loci for the high sesamin and sesamolin content traits in sesame at the forefront of the field.

[0023] Based on the molecular marker PB01 discovered in this invention, further identification tools and methods are provided, which can be used to predict the content of sesamin and sesamolin in sesame materials, thereby enabling rapid screening of high sesamin and sesamolin strains. This can be used for screening and early prediction of sesamin and sesamolin traits in sesame breeding offspring, assisting in the selection of sesamin and sesamolin with clear targets and low cost.

[0024] Compared with traditional breeding methods, the detection of major gene loci for high sesamin and sesamolin in this invention is convenient and rapid, allowing for early screening and elimination during the seedling stage, which greatly improves selection efficiency and saves production costs. Attached Figure Description

[0025] Figure 1 The mass spectrometry peaks of sesamin and sesamolinin content in the high sesamin and sesamolinin mutant in Example 1 are shown; where A is the standard solution, B is the wild-type seed, and C is the high sesamin and sesamolinin mutant.

[0026] Figure 2 The diagram shows the LOD of the major QTL sites of sesamin and sesamolin in Example 1; where A is the major QTL site of sesamin and B is the major QTL site of sesamolin.

[0027] Figure 3 This is a schematic diagram of a polyacrylamide gel electrophoresis plate image after the primers for molecular marker PB01 in Example 2 were amplified in the F2 population parents and 75 lines. Among them, the arrow indicates marker (No. 42), samples No. 40 and 41 are the maternal parent (high sesamin and sesamolin mutant) and paternal parent (Miaoqian sesame), respectively, and samples No. 5, 8, 13, 20, 21, 26, 27, 29, 33, 43, 45, 46, 48, 49, 60, 69, 72, and 75 are the lines identified as containing the major gene locus qHL6 of the high sesamin and sesamolin traits. Detailed Implementation

[0028] The technical solution of the present invention will now be clearly and completely described in conjunction with the embodiments and accompanying drawings. It should be understood that the specific embodiments described herein are for illustration and explanation only and are not intended to limit the present invention.

[0029] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. The term "comprising" and any variations thereof in the specification and claims of this invention are intended to cover a non-exclusive inclusion.

[0030] The following examples show that the sesamin and sesamolin content in seeds was determined according to the method described in "Establishment of High-Efficiency Extraction and Detection Technology for Sesamin and Screening of High-Sesamin Germplasm" (Zhong Yanping et al., Beijing: Chinese Agricultural Science, 2022). DNA extraction, PCR, and polyacrylamide gel electrophoresis were performed according to the conditions described in "Molecular Cloning: A Laboratory Manual" (3rd Edition) (Huang Peitang et al., Beijing: Science Press, 2002).

[0031] Unless otherwise specified, the techniques or conditions described in the following examples are based on those described in the literature or the product instructions. Unless otherwise specified, the reagents or instruments used are all commercially available products.

[0032] Example 1

[0033] Based on the high sesamin and sesamolinin mutants created by the inventors, the major gene locus qHL6 for the high sesamin and sesamolinin traits was identified, and the marker PB01 was further developed. This example specifically includes the following processes:

[0034] (1) Creation of high sesamin and sesamin mutants.

[0035] "Zhongzhi 14" is a white sesame variety bred by the Oil Crops Research Institute of the Chinese Academy of Agricultural Sciences. It has a relatively tall plant height, is a mid-to-late maturing variety, has a moderate flowering period, a loose plant type, medium-sized leaves, pure white seeds, good marketability, and moderate disease resistance and lodging resistance. Zhongzhi 14 was planted in a netted greenhouse. After harvesting seeds from superior individual plants, the variety was continued to be planted in the netted greenhouse for three generations of purification. Superior individual plants were harvested from each generation, and then one superior individual plant was selected for propagation and mutation induction.

[0036] Using the aforementioned "Zhongzhi 14" seeds as mutagenesis material, M1 seeds were obtained through mutagenesis induced by 1% EMS chemical mutagen. Seeds from superior M1 generation individual plants were harvested, and the sesamin and sesamolin content in the seeds was determined using a NIRS DS 2500 multi-functional near-infrared analyzer. Individual plants with elevated sesamin and sesamolin content were selected for field planting to produce M2 generation seeds. The M2 generation exhibited significant segregation in plant type, leaf angle, and seed color. Individual plants with black seeds, large leaf angles, branching, and high seed setting rate were selected for self-pollination and seed collection. Seeds were then analyzed using NIRS DS... A 2500 multifunctional near-infrared analyzer was used to screen mature seeds of individual plants for sesamin and sesamolin content. Seeds of individual plants with increased sesamin and sesamolin content obtained from the initial screening were then precisely measured using liquid chromatography. Individual plants with increased sesamin and sesamolin content identified by the precise analysis were planted in the field to obtain the M3 line. In the field, individual plants of the M3-M7 lines were selected and self-pollinated for seed saving based on plant type, leaf angle, seed color, leaf size, disease resistance, lodging resistance, and marketability. The sesamin and sesamolin content of the seeds was measured by liquid chromatography. Individual plants with high sesamin and sesamolin content were selected for planting and purification. By the M8 generation, the traits of each line had stabilized. Among them, line 566 had the highest sesamin and sesamolin content and performed the best, and was named "SiHLignan1".

[0037] The content of sesamin and sesamolin in the seeds of this mutant was significantly increased, specifically as follows: Figure 1 As shown.

[0038] (2) Discovery of major gene loci for high sesamin and sesamin traits.

[0039] A hybridization was conducted between the high-sialotin and sesamolin-containing mutant sesame "SiHLignan1" (sialotin 15.26 mg / g, sesamolin 7.4 mg / g) and the low-sialotin and sesamolin-containing sesame variety "Miaoqian Sesame" (sialotin 1.4 mg / g, sesamolin 1.5 mg / g) to obtain F1 seeds. The F1 plants were then self-pollinated to obtain the F2 segregating population. This population was planted in Wuchang, Hubei Province. After the plants matured, sesame seeds from the parents and individual F2 plants were harvested. The sesamin and sesamolin contents of the seeds from the parents and individual F2 plants were determined by liquid chromatography to obtain phenotypic data.

[0040] Total genomic DNA was extracted from leaves of the parental lines and RIL segregating populations using the CTAB method. The specific steps are as follows:

[0041] ① Leaves of each parent and F2 segregating population were stored in an ultra-low temperature freezer (-70℃) for later use; when using, take an appropriate amount of leaf sample from the ultra-low temperature freezer, put it into a frozen mortar, add liquid nitrogen and grind it into powder.

[0042] ② Quickly transfer the contents into a 50ml centrifuge tube, add the CTAB extraction solution (2% CTAB, 0.1M Tris-Cl, 1.4M NaCl, 20mM EDTA, pH 7.5) that has been preheated in a 65℃ water bath, mix well, and place in a 65℃ water bath for 40 minutes.

[0043] ③ Remove the centrifuge tube, add an equal volume of chloroform and isoamyl alcohol mixed in a volume ratio of 24:1, slowly invert the centrifuge tube 30-50 times to mix thoroughly, and centrifuge at 1300g for 10 minutes.

[0044] ④ Take the supernatant after centrifugation into another centrifuge tube, repeat step ③ once, and then take the supernatant and add it to 0.6 times the volume of ice-cold isoamyl alcohol. Slowly invert the centrifuge tube until flocculent precipitate forms. Then place it at -20℃ and let it stand for 30 minutes. Pick out the precipitate, wash it 2-3 times with 75% (volume ratio) alcohol, dry it, and dissolve it in sterile water.

[0045] ⑤ Repeat the above steps once more, take the supernatant, add 0.1 volume of NaAc (3mol / L, pH 5.2), mix well, and slowly add 2 volume of ice-cold anhydrous ethanol. After standing for 5 minutes, slowly rotate the centrifuge tube until flocculent precipitate appears. Pick out the precipitate and transfer it to a 1.5 ml centrifuge tube. Wash 2-3 times with 75% (volume) alcohol, dry, dissolve in sterile water, and store at -20℃ for later use. This yields the total genomic DNA of the leaves of each parent and the RIL segregating population.

[0046] Genotyping of parents and F2 progeny was performed using simplified genome sequencing (SMR). First, restriction endonucleases were used to digest the genomic DNA of the target individuals, followed by library construction and high-throughput sequencing. By aligning the sequencing data (paired-end reads) to the sesame reference genome (Wang et al., 2014), high-density SNPs and InDels between the two parents were identified, and genotyping of F2 progeny was performed. Based on the high-density SNPs and InDels, a genetic linkage map was constructed using MSTMap software. Using sesamin and sesamolinin data, genotypic data, and genetic linkage map data from the F2 parents and 75 lines, QTL analysis was performed using QTL Cartographer (version 1.17j) software. Composite Interval Mapping (CIM) was used, with a permutation threshold of 1000 times (p=0.05), for gene localization analysis.

[0047] like Figure 2 As shown, the QTL mapping results are as follows: Two sesamin QTL loci, qSmin-6 and qSmin-12, were identified, with LOD values ​​of 13.27 and 7.28, respectively, and phenotypic variation explanation rates of 31% and 9.9%, respectively; Two sesamolinin QTL loci, qSmol-6 and qSmol-2, were identified, with LOD values ​​of 18.68 and 4.75, respectively, and phenotypic variation explanation rates of 63.1% and 11.8%, respectively. Specifically, qSmin-6 is located on chromosome 6 (chr6) within the 59.15-60.52 cM interval between markers c06b037 and c06b039, and qSmol-6 is located on chromosome 6 (chr6) within the 55.97-60.52 cM interval between markers c06b035 and c06b039. By comparing the sesame reference genome, qSmin-6 and qSmol-6, which have relatively large effects, are located in the same physical region and are a pleiotropic site, named qHL6.

[0048] (3) Development of the PB01 tag.

[0049] Fourteen F2 exchanged single plants within the qHL6 region were selected and planted in the field to form F2:3 families (a total of 1030 plants). Based on the simplified genome sequencing results of the parents, 20 SNPs and 2 indel markers were uniformly developed within the qHL6 region. Primers for each target locus were designed using Primer3 software, with the following parameters set: 1) primer sequence length between 17-32 bp; 2) Tm value between 60-64℃, with an optimal Tm of 62℃; 3) product size not exceeding 300 bp; 4) sequencing reads must cover the target locus. e-PCR software was then used to detect the amplification specificity of each primer pair. Using the developed specific primers, genotyping of the F2:3 families was performed using targeted sequencing technology. Combined with the results of sesamin and sesamolinin content determination, qHL6 was narrowed down to the two markers PB01-PA08 on chromosome 6. PB01 is an Indel marker, which is closely linked to the high sesamin and sesamolinin traits, and its detection primer sequence is as follows:

[0050] PB01-F: 5'-GAATTTATTGGTTTGATTTCGAGCCTAAGTTG-3';

[0051] PB01-R: 5'-GAAAGCCGGCTGGTGAACAGAAATAATA-3'.

[0052] Example 2

[0053] Using primers for the molecular marker PB01, which is tightly linked to the major gene locus qHL6 obtained in this invention, it is possible to screen and predict sesamin and sesamolinin traits in sesame breeding progeny at an early stage. This example specifically uses the F2 population constructed by crossing high-saesamin and sesamolinin mutants with Miaoqian sesame as an example. Molecular identification of each line was performed at the seedling stage, including the following steps:

[0054] (1) Extraction of total DNA from leaves. The specific extraction procedure is described in Example 1.

[0055] (2) Molecular identification was performed using primers for the molecular marker PB01 (i.e., PB01-F / R).

[0056] After PCR amplification, polyacrylamide gel electrophoresis and band pattern analysis, a total of 50 lines with 76bp bands (i.e., lines containing the major gene locus qHL6 for the high sesamin and sesamin traits) were obtained.

[0057] See the photographs of the parent populations and the gel plates obtained after electrophoresis and staining of 75 strains. Figure 3Among them, samples 40 and 41 are the maternal and paternal parents, respectively. Samples 5, 8, 13, 20, 21, 26, 27, 29, 33, 43, 45, 46, 48, 49, 60, 69, 72, and 75 correspond to ZT16, ZT28, ZT13, ZT43, ZT44, ZT19, ZT20, ZT33, ZT06, ZT09, ZT11, ZT21, ZT23, ZT35, ZT36, ZT40, ZT12, and ZT25, respectively. Amplification of these samples yielded the same 76bp band as the maternal parent, which is the line identified as containing the major gene locus qHL6 for the high sesamin and sesamin traits.

[0058] In addition, the sesamin and sesamolin content of 75 lines in the F2 population was determined after grain maturity. The results showed that among the 18 lines obtained by molecular marker-assisted selection, 77.8% of the lines had lignan (saesamin and sesamolin) content higher than the average of 7.01 mg / g of the F2 population (saesamin and sesamolin were 4.78 mg / g and 2.23 mg / g, respectively) (see Table 1, a total of 14 lines).

[0059] Table 1. Fourteen sesame lignan lines with sesame lignan content higher than the population mean obtained by marker-assisted selection.

[0060]

[0061] Compared with conventional breeding methods, using the molecular marker PB01 to identify and assist in the selection of lines with higher sesamin and sesamolin content can improve the selection efficiency by 36.5 percentage points (calculated as: the selection efficiency of lines selected by marker minus the selection efficiency calculated by conventional phenotypic measurement). Analysis shows that the proportion of lines in the F2 population with sesamin and sesamolin content higher than 8 mg / g obtained through marker-assisted selection reached 72.2% (calculated as: number of lines with a combined sesamin and sesamolin content higher than 8 mg / g in Table 1 / number of lines obtained through marker-assisted selection).

[0062] In summary, using the molecular marker PB01 to predict the sesamin and sesamolin content of sesame breeding progeny by identifying the major gene locus qHL6 can greatly increase the breeding efficiency of sesamin and sesamolin improvement.

[0063] It should be noted that the above embodiments are only some embodiments of the present invention and not all embodiments, and are only used to illustrate the technical solutions of the present invention and not to limit it; based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

Claims

1. An Indel marker tightly linked to major gene loci related to sesamin and sesamolin content, characterized in that, The major gene locus for sesamin and sesamolinin content is located on chromosome 6 and named qHL6; the nucleotide sequence of the Indel marker is shown below: GAATTTATTGGTTTGATTTCGAGCCTAAGTTGA[GTTTAC / G]TTGAGCTTGAGCTCTATTATTTCTGTTCACCAGCCGGCTTC.

2. To test the application of the Indel-labeled primers as described in claim 1 in the breeding of sesame with high sesamin and sesamin content.

3. The application according to claim 2, characterized in that, The sequences of the primers are shown in SEQ ID NO.1-2.

4. To detect the use of the Indel-labeled primers as described in claim 1 in predicting or identifying sesame materials with high sesamin and sesamin content, wherein the primer sequences are shown in SEQ ID NO. 1-2.

5. A method for screening sesame materials high in sesamin and sesamin, characterized in that, Using genomic DNA of sesame material as a template, PCR amplification was performed using primers with sequences as shown in SEQ ID NO.1-2, and the size of the amplification product was used to determine its content. When the sequence of the amplification product is as shown in SEQ ID NO.3, it indicates that the sesame material has a high content of sesamin and sesamin.

6. The method according to claim 5, characterized in that, The amplification products were detected by polyacrylamide gel electrophoresis.

7. The method according to claim 5, characterized in that, The genomic DNA was extracted from sesame leaves.

Images