Method for analyzing production place of glossy privet fruit and evaluating quality of different processed products based on DNA bar code-fingerprint technology and multivariate statistics

Abstract

The invention provides a method for analyzing the production place of glossy privet fruits and evaluating the quality of different processed products based on a DNA bar code-fingerprint technology in combination with multivariate statistics. The DNA bar code for identifying the producing area of the glossy privet fruit, provided by the invention, comprises a matK gene segment. According to the application, the development producing area of the glossy privet fruit decoction pieces and the quality evaluation and research of different processed products are carried out, and a method of combining a DNA bar code technology with an ultra-high performance liquid chromatography fingerprint spectrum is established and is used for rapidly classifying and identifying the glossy privet fruit decoction pieces; according to the method, a glossy privet fruit fingerprint spectrum analysis method is optimized, UPLC fingerprint spectrums of raw glossy privet fruit decoction pieces and processed products are established, and HCA and PCA unsupervised chemical mode recognition models and PLS-DA supervised chemical mode recognition models are respectively established by adopting a chemical mode recognition method. According to the method, chemical mode recognition and the UPLC fingerprint spectrum are organically combined, chemical information of the glossy privet fruits and processed products of the glossy privet fruits can be comprehensively reflected, and the method can be used for quality control of the glossy privet fruits and the processed products of the glossy privet fruits.

Description

Technical Field

[0001] The present application relates to the technical field of traditional Chinese medicine analysis, and in particular to a method for evaluating the origin of Ligustrum lucidum and the quality of different processed products based on DNA barcode-fingerprint technology combined with multivariate statistical analysis. Background Art

[0002] Traditional Chinese medicine (TCM) is characterized by its diverse and complex composition. Traditionally, identification has typically relied on microscopic and thin-layer techniques, combined with judgment based on shape, color, aroma, and flavor. This is not only time-consuming and laborious, but also requires extensive experience. Subjective judgments lack high accuracy. Therefore, a comprehensive analysis, from the entire TCM to its specific components, must be conducted, correlating the chemical composition with various influencing factors, including its properties, origin, origin, and processing. The traditional Chinese medicinal herb Ligustrum lucidum (Glyceris privetii) is a tonic herb derived from the dried, mature fruit of the Oleaceae plant Ligustrum lucidum. Its sweet, bitter, and cooling properties, acting on the liver and kidney meridians, nourish the liver and kidneys, improve eyesight, and promote hair growth. It also possesses numerous pharmacological effects, including hypoglycemic, sex hormone-like effects, immune enhancement, anti-aging, lipid-lowering, and anti-tumor properties. Ligustrum lucidum is found in numerous locations, ranging from south of the Yangtze River basin to South China, southwestern provinces, southern North China, and southern Shaanxi and Gansu. Ligustrum lucidum is widely used and prepared in numerous ways, including steaming with vinegar, steaming with water, steaming with wine, steaming with salt, and stewing with wine. Different origins and different processing methods may affect the quality of the Chinese medicinal material Ligustrum lucidum. Therefore, it is very necessary to find a quality evaluation method suitable for the Chinese medicinal material Ligustrum lucidum. Summary of the Invention

[0003] The purpose of this application is to provide a method for evaluating the origin of Ligustrum lucidum and the quality of different processed products based on DNA barcode-fingerprint technology combined with multivariate statistical analysis, which can be used for quality control of Ligustrum lucidum and its processed products. The specific technical solution is as follows:

[0004] In a first aspect of the present application, a DNA barcode is provided for identifying the origin of Ligustrum lucidum, wherein the DNA barcode comprises a matK gene fragment; preferably, the nucleotide sequence of the matK gene fragment is shown in SEQ ID NO: 7.

[0005] The second aspect of the present application provides a primer pair for amplifying a DNA barcode for identifying the origin of Ligustrum lucidum, wherein the primer pair comprises a forward primer with a nucleotide sequence as shown in SEQ ID NO: 1 and a reverse primer with a nucleotide sequence as shown in SEQ ID NO: 2.

[0006] The third aspect of the present application provides a kit for identifying the origin of Ligustrum lucidum, wherein the kit comprises the primer pair described in the second aspect of the present application; preferably, the kit further comprises a genomic DNA extraction reagent and / or a PCR amplification reagent.

[0007] The fourth aspect of the present application provides a method for identifying the origin of Ligustrum lucidum, comprising the steps of performing PCR amplification on a Ligustrum lucidum sample to be tested using the primer pair described in the second aspect of the present application or the kit described in the third aspect of the present application;

[0008] Preferably, the method comprises the steps of:

[0009] Extracting genomic DNA from the Ligustrum lucidum fruit sample to be tested;

[0010] Using the genomic DNA as a template, PCR amplification is performed using the primer pair described in the second aspect of the present application or the kit described in the third aspect of the present application;

[0011] The PCR amplification product is sequenced, and then analyzed and integrated with the sequencing results of Ligustrum lucidum fruits from multiple different known origins to obtain a sample clustering dendrogram; the origin of the Ligustrum lucidum fruit sample to be tested is determined based on the specific cluster position of the Ligustrum lucidum fruit sample to be tested in the sample clustering dendrogram.

[0012] The fifth aspect of the present application provides a method for constructing a fingerprint spectrum of Ligustrum lucidum fruit, comprising the steps of:

[0013] (1) Taking Ligustrum lucidum fruit, ultrasonically extracting it with a methanol aqueous solution with a volume fraction of 75%-85% as a solvent to obtain a Ligustrum lucidum fruit test solution; preferably, the ratio of the mass of the Ligustrum lucidum fruit to the volume of the solvent is 1g: (40-60)mL; the ultrasonic extraction time is 35min-45min, the extraction power is 100W-200W, and the extraction frequency is 30kHz-50kHz; the Ligustrum lucidum fruit is selected from a raw Ligustrum lucidum fruit or a processed Ligustrum lucidum fruit;

[0014] (2) The test solution of the Ligustrum lucidum fruit is detected by ultra-high performance liquid chromatography to obtain a chromatogram of the Ligustrum lucidum fruit; wherein the chromatographic conditions include: chromatographic column: octadecylsilane bonded silica gel chromatographic column; mobile phase: phase A is acetonitrile, phase B is a formic acid aqueous solution with a volume fraction of 0.05%-0.15%; gradient elution is adopted with a volume fraction of 5%-100% phase A and 0%-95% phase B; flow rate: 0.2 mL / min-0.4 mL / min; column temperature: 28°C-32°C; injection volume: 2 μL-4 μL; detection wavelength: 220 nm-240 nm; preferably, the gradient elution is specifically: 0 min-6 min, 95%-78% B; 6 min-13 min, 78%-60% B; 13 min-18 min, 60%-0% B;

[0015] (3) taking R batches of raw or processed Ligustrum lucidum fruit from the same place of origin, repeating steps (1) and (2) in sequence to obtain chromatograms of R batches of Ligustrum lucidum fruit; analyzing the chromatograms of the R batches of Ligustrum lucidum fruit using traditional Chinese medicine chromatographic fingerprint similarity evaluation software to obtain fingerprints of Ligustrum lucidum fruit; wherein R≥10.

[0016] In some embodiments of the present application, in step (3), the R batches of raw Ligustrum lucidum fruit products or processed Ligustrum lucidum fruit products of the same origin are identified using the DNA barcodes described in the first aspect of the present application, the primer pairs described in the second aspect of the present application, the kit described in the third aspect of the present application, or the method described in the fourth aspect of the present application;

[0017] Preferably, the processed product is selected from at least one of steamed products, wine-steamed products, wine-stewed products, salt-steamed products and vinegar-steamed products.

[0018] In some embodiments of the present application, the chromatogram of a reference solution containing chemical components in Ligustrum lucidum fruit is determined using the same chromatographic conditions as in step (2), wherein the reference solution contains at least one of salidroside, scutellaria glycoside, verbascoside, terunguside, luteolin, ligustrin, oleuropein, and ligustrin G13;

[0019] According to the retention time of each determined component in the chromatogram of the reference solution, the component type corresponding to the chromatographic peaks with different retention times in the chromatogram of the test solution is determined.

[0020] The sixth aspect of the present application provides a Ligustrum lucidum fingerprint constructed according to the method described in the fifth aspect of the present application.

[0021] The seventh aspect of the present application provides the method for constructing the fingerprint of Ligustrum lucidum fruit described in the fifth aspect of the present application and / or the use of the fingerprint of Ligustrum lucidum fruit described in the sixth aspect of the present application in the quality evaluation of Ligustrum lucidum fruit.

[0022] The eighth aspect of the present application provides a method for evaluating the quality of Ligustrum lucidum fruit, comprising the steps of:

[0023] The method described in the fifth aspect of the present application is used to obtain fingerprints of raw Ligustrum lucidum fruit and fingerprints of different known Ligustrum lucidum fruit processed products; preferably, the processed products are selected from at least one of steamed products, wine-steamed products, wine-stewed products, salt-steamed products and vinegar-steamed products;

[0024] Obtaining a chromatogram of the Ligustrum lucidum fruit sample to be tested by adopting steps (1) and (2) described in the fifth aspect of the present application;

[0025] According to the fingerprint of the raw Ligustrum lucidum fruit, the fingerprints of the different known Ligustrum lucidum fruit processed products and the chromatogram information of the chromatogram of the Ligustrum lucidum fruit sample to be tested, one or more of a heat map, an HCA cluster dendrogram, a PCA score map, a Bi-plot map, a PLS-DA model 3D map, a PLS-DA model VIP map and a PLS-DA model verification map are drawn to determine the type of the Ligustrum lucidum fruit sample to be tested and evaluate its quality; preferably, the chemical marker for the quality evaluation of Ligustrum lucidum fruit comprises privetside G13.

[0026] Beneficial effects of this application:

[0027] The present application conducted a study on the origin and quality evaluation of different processed products of Ligustrum lucidum slices, which is a component of Erzhi Fang, and established a method combining DNA barcode technology with ultra-high performance liquid chromatography fingerprinting for the rapid classification and identification of Ligustrum lucidum slices; optimized the Ligustrum lucidum fingerprint analysis method, established UPLC fingerprints of raw and processed Ligustrum lucidum slices (steamed with vinegar, steamed with clear water, steamed with wine, steamed with salt, stewed with wine), and used the chemical pattern recognition method to establish HCA and PCA unsupervised chemical pattern recognition models and PLS-DA supervised chemical pattern recognition models, and screened out important chemical markers. The present application organically combines chemical pattern recognition with UPLC fingerprinting, which can comprehensively reflect the chemical information of Ligustrum lucidum slices and their processed products. It provides data support for the identification and quality control of Ligustrum lucidum slices and their processed products, provides a material basis for subsequent compatibility research, and can be used for the quality control of Ligustrum lucidum slices and their processed products.

[0028] Of course, it is not necessary to achieve all the advantages described above at the same time when implementing any product or method of the present application. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] In order to more clearly illustrate the embodiments of the present application or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments or the description of the prior art. Obviously, the drawings described below are only some embodiments of the present application. For ordinary technicians in this field, other embodiments can also be obtained based on these drawings.

[0030] Figure 1 This is a clustering dendrogram of 26 batches of Ligustrum lucidum samples based on matK sequences in Example 1 of the present application;

[0031] Figure 2 UPLC chromatogram of the raw Ligustrum lucidum slices in Example 2 of the present application;

[0032] Figure 3 This is the UPLC chromatogram of the mixed reference solution in Example 2 of the present application;

[0033] Figure 4This is the UPLC fingerprint of 26 batches of raw Ligustrum lucidum slices in Example 3 of the present application;

[0034] Figure 5 This is the UPLC fingerprint of the commercially available Ligustrum lucidum fruit in Example 3 of this application;

[0035] Figure 6 UPLC fingerprints of different processed Ligustrum lucidum fruits in Example 3 of the present application;

[0036] Figure 7 This is a heat map of raw Ligustrum lucidum fruit and different processed products in Example 4 of this application;

[0037] Figure 8 This is the HCA clustering dendrogram of raw Ligustrum lucidum fruit and different processed products in Example 4 of the present application;

[0038] Figure 9 This is the PCA score graph of raw Ligustrum lucidum fruit and different processed products in Example 4 of this application;

[0039] Figure 10 This is a bi-plot diagram of raw Ligustrum lucidum fruit and different processed products in Example 4 of this application;

[0040] Figure 11 3D images of the PLS-DA model of raw Ligustrum lucidum fruit and different processed products in Example 4 of the present application;

[0041] Figure 12 VIP diagram of the PLS-DA model of raw Ligustrum lucidum fruit and different processed products in Example 4 of the present application;

[0042] Figure 13 This is a PLS-DA model validation diagram for raw Ligustrum lucidum fruit and different processed products in Example 4 of this application. DETAILED DESCRIPTION

[0043] The following will be combined with the embodiments of the present application and the accompanying drawings to clearly and completely describe the technical solutions in this application. Obviously, the embodiments described are only part of the embodiments of the present application, rather than all the embodiments. All other embodiments obtained by those skilled in the art based on this application are within the scope of protection of this application.

[0044] DNA barcode molecular identification is a molecular biology technique based on the genetic material of plants and animals. It can be applied to the identification of Chinese medicine varieties, authenticity, origin, and adulteration. Compared with traditional identification methods, this method, combined with Chinese medicine fingerprint technology, does not rely on the influence of natural environmental factors such as the diversity of the original species of Chinese herbal medicine pieces, geography, climate, and human factors such as harvesting differences, purification, processing, storage, and transportation. It identifies a specific, shorter piece of genetic information, and its results are objective and accurate, supplementing Chinese medicine identification methods. Multivariate statistical analysis can intelligently integrate the large amount of chemical information obtained from Chinese medicine fingerprints using a large number of computer algorithms to perform discriminant analysis, obtain important chemical markers that affect differentiation and identification, and can, to a certain extent, predict unknown samples, making it easier to classify and identify Chinese medicine samples.

[0045] In a first aspect of the present application, a DNA barcode is provided for identifying the origin of Ligustrum lucidum, wherein the DNA barcode comprises a matK gene fragment; preferably, the nucleotide sequence of the matK gene fragment is shown in SEQ ID NO: 7.

[0046] The nucleotide sequence of the matK gene fragment described in this application: TTGTGTTTACGAGCCAAAGTTCTAGCA CAAGAAAGTCGAAGTATATACTTTATTCGATACAAACTCTTTTTTTTGGAAGATCCGCTATGATAATGAGAAAGATTTCTGCATATACGCCCAAATCGATCAATAATATCAGAATCTGATAAATCAGCCCGAACCGGCTTACTAATGGGATACCCTAGTACGTTACAAAATTTCGCTTTAGCCAATGATCCAATCAGAGGAATAATTGGAACAAGAGTATCGAACTTCTTAATAGCATTATTGAGTAGAAATGAATTTTCTAGAATTTGACTCCGTACCACTGAAGCGTTTAGTCGCACACTTGAAAGATAGCCCACAAATTCAAGGGAATGATTAGATAATTGGTTTAGATAAATCCTTCTTGGATGAAACCACAGCGAAAAATAACATTGCCAAAAAGTTACAAGGTAATATTTCCATTTATTCATCAAAAGAGGCGTCCCTTTTGAAGCCAGAAGGGATTTTCCTTGATACCTAACATAATGCATGAAAGGATCCTTGAACAGGCATAGATTGGTCTGAAAATCCTTAACAAAGACGTCTACAAGACGTTCTATTTTTCCATAGAAATAGATTCGTTCAAGAAGAGCTCCAGAAGATGTTGATCGTAAATGAGAAGATTGGTTACGTAGAAAGACGAAAATAGATTCGTATTCACATACATGAGAATTATATAAGAAGAAGAAGAATCTTTGATTCCTTTTTGAAAAAGAAGAACTGGCTTTCTTTGGAGTAATAAGACTATTCCAATTACAATACTCGCGAAGAAAGAATCGTAATAAATGCAAAGAAGGGGCATCTTTTACCCAATTGCGAAGAGTTTGAACCAAGATTTC(SEQ ID NO: 7).

[0047] The DNA barcode described in this application can be used to identify the different production areas of Glossy Privet Fruit.

[0048] In a second aspect, the present application provides a primer pair for amplifying a DNA barcode for identifying the origin of Ligustrum lucidum, wherein the primer pair comprises a forward primer having a nucleotide sequence as shown in SEQ ID NO: 1 and a reverse primer having a nucleotide sequence as shown in SEQ ID NO: 2.

[0049] Nucleotide sequence of the forward primer (F): 5′-CGTACAGTACTTTTGTGTTTACGAG-3′ (SEQ ID NO: 1);

[0050] Nucleotide sequence of the reverse primer (R): 5'-ACCCAGTCCATCTGGAAATCTTGGTTC-3' (SEQ ID NO: 2).

[0051] The above primer pair provided in this application can be used to amplify the matK gene fragment.

[0052] The third aspect of the present application provides a kit for identifying the origin of Ligustrum lucidum, wherein the kit comprises the primer pair described in the second aspect of the present application; preferably, the kit further comprises a genomic DNA extraction reagent and / or a PCR amplification reagent.

[0053] The present application does not particularly limit the specific components of the genomic DNA extraction reagent and the PCR amplification reagent. As long as the purpose of the invention of the present application can be achieved, they can all be purchased through commercial channels.

[0054] The fourth aspect of the present application provides a method for identifying the origin of Ligustrum lucidum, which includes the step of using the primer pair described in the second aspect of the present application or the kit described in the third aspect of the present application to perform PCR amplification on the Ligustrum lucidum sample to be tested.

[0055] In some embodiments of the present application, the method for identifying the origin of Ligustrum lucidum comprises the steps of:

[0056] Extracting genomic DNA from the Ligustrum lucidum fruit sample to be tested;

[0057] Using the genomic DNA as a template, PCR amplification is performed using the primer pair described in the second aspect of the present application or the kit described in the third aspect of the present application;

[0058] The PCR amplification product is sequenced, and then analyzed and integrated with the sequencing results of Ligustrum lucidum fruits from multiple different known origins to obtain a sample clustering dendrogram; the origin of the Ligustrum lucidum fruit sample to be tested is determined based on the specific cluster position of the Ligustrum lucidum fruit sample to be tested in the sample clustering dendrogram.

[0059] The present application has no particular restrictions on the specific operation of extracting genomic DNA from the Ligustrum lucidum fruit sample to be tested, as long as the purpose of the invention of the present application can be achieved. For example, the extraction can be performed according to the operating method in the DNA extraction kit.

[0060] The present application has no particular restrictions on the specific procedures of PCR amplification, as long as the purpose of the invention of the present application can be achieved, for example, initially 93℃-95℃, 0.5min-1.5min; 93℃-95℃, 25s-35s; 51℃-53℃, 15s-25s; 71℃-73℃, 45s-55s; 71℃-73℃ extension 4min-6min; 4℃ hold; a total of 30-40 cycles.

[0061] The analysis and integration described in this application may include: using CodonCode Aligner to compile sequencing data, and using MEGA software to use an unweighted paired group algorithm (UPGMA) to analyze and integrate the results. The specific operation methods can adopt methods commonly used in the art.

[0062] The fifth aspect of the present application provides a method for constructing a fingerprint spectrum of Ligustrum lucidum fruit, comprising the steps of:

[0063] (1) Take Ligustrum lucidum fruit and perform ultrasonic extraction with a methanol aqueous solution with a volume fraction of 75%-85% as a solvent to obtain a Ligustrum lucidum fruit test solution;

[0064] (2) The test solution of the Ligustrum lucidum fruit was detected by ultra-high performance liquid chromatography to obtain a chromatogram of the Ligustrum lucidum fruit; wherein the chromatographic conditions include: chromatographic column: octadecylsilane bonded silica gel chromatographic column; mobile phase: phase A is acetonitrile, phase B is a formic acid aqueous solution with a volume fraction of 0.05%-0.15%; gradient elution is performed with a volume fraction of 5%-100% phase A and 0%-95% phase B; flow rate: 0.2 mL / min-0.4 mL / min; column temperature: 28°C-32°C; injection volume: 2 μL-4 μL; detection wavelength: 220 nm-240 nm;

[0065] (3) taking R batches of raw or processed Ligustrum lucidum fruit from the same place of origin, repeating steps (1) and (2) in sequence to obtain chromatograms of R batches of Ligustrum lucidum fruit; analyzing the chromatograms of the R batches of Ligustrum lucidum fruit using traditional Chinese medicine chromatographic fingerprint similarity evaluation software to obtain fingerprints of Ligustrum lucidum fruit; wherein R≥10.

[0066] The octadecylsilane bonded silica gel chromatographic column described in the present application may be ACQUITY UPLC BEH Shield RP18 (2.1×100 mm, 1.7 μm).

[0067] During the research process, this application examined various mobile phases, column temperatures and elution gradients, and found that the chromatographic conditions provided in this application can meet the standard requirements for the separation peak shape and separation degree of Ligustrum lucidum extract.

[0068] In some embodiments of the present application, in step (1), the ratio of the mass of the Ligustrum lucidum fruit to the volume of the solvent is 1g:(40-60)mL; the time of the ultrasonic extraction is 35min-45min, the extraction power is 100W-200W, and the extraction frequency is 30kHz-50kHz; the Ligustrum lucidum fruit is selected from raw Ligustrum lucidum fruit or processed Ligustrum lucidum fruit.

[0069] In some embodiments of the present application, in step (2), the gradient elution is specifically: 0 min-6 min, 95%-78% B; 6 min-13 min, 78%-60% B; 13 min-18 min, 60%-0% B.

[0070] In some embodiments of the present application, in step (3), the R batches of raw Ligustrum lucidum fruit products or processed Ligustrum lucidum fruit products with the same origin are identified using the DNA barcodes described in the first aspect of the present application, the primer pairs described in the second aspect of the present application, the kit described in the third aspect of the present application, or the method described in the fourth aspect of the present application.

[0071] In some embodiments of the present application, in step (3), the processed product is selected from at least one of steamed products, wine-steamed products, wine-stewed products, salt-steamed products, and vinegar-steamed products.

[0072] The present application does not particularly limit the specific preparation methods for steamed products, wine-steamed products, wine-stewed products, salt-steamed products, and vinegar-steamed products, as long as the invention objectives of the present application can be achieved. For example, the preparation method of wine-steamed products includes the following steps: weighing a certain weight of clean Ligustrum lucidum fruit slices, adding 20%-30% of the slice weight of rice wine and letting it soak for 1 hour-3 hours, steaming on an induction cooker after the rice wine is completely absorbed, heating over high heat (1500W-2500W, 190°C-210°C) until the steamer is round and full, then switching to low heat (750W-850W, 120°C-140°C) and starting the timer, steaming for 7 hours-9 hours, removing from the steamer and letting it cool, drying at 55°C-65°C for 5 hours-7 hours, crushing, and passing through a No. 3 pharmacopoeia sieve for later use. Vinegar-steamed products and steamed products use the same method, adding 20%-30% of the slice weight of vinegar or drinking water and letting it soak for 1 hour-3 hours before steaming.

[0073] The preparation method of the wine-stewed product comprises the following steps: weighing a certain weight of clean Ligustrum lucidum fruit slices, adding 20%-30% of the weight of the slices of rice wine and stewing for 1 hour-3 hours, heating the slices in water on an induction cooker after the rice wine is completely absorbed, heating the slices over high heat (1500W-2500W, 190°C-210°C) until the pot is full of roundness and steam, then switching to low heat (750W-850W, 120°C-140°C) and starting the timer, stewing the slices for 7 hours-9 hours, taking the slices out and letting them cool, drying them at 55°C-65°C for 5 hours-7 hours, crushing the slices and passing them through a No. 3 pharmacopoeia sieve for later use.

[0074] The preparation method of the salt-steamed product comprises the following steps: weighing a certain weight of clean Ligustrum lucidum fruit slices, spraying 20%-30% of the weight of the slices with 0.5wt%-1.5wt% salt water, mixing well and letting it soak for 2h-4h, and after the salt water is completely absorbed, steaming and stewing it thoroughly on an induction cooker, the steaming process is the same as above (i.e., heating with high heat (1500W-2500W, 190°C-210°C) until the steamer is full of roundness and gas, then switching to low heat (750W-850W, 120°C-140°C) and starting the timer), steaming for 1h-2h, taking out and cooling, drying at 55°C-65°C for 5h-7h, crushing and passing through a No. 3 pharmacopoeia sieve for later use.

[0075] In some embodiments of the present application, the method for constructing a fingerprint of Ligustrum lucidum further comprises the steps of:

[0076] The chromatogram of a reference solution containing chemical components in Ligustrum lucidum fruit is determined using the same chromatographic conditions as in step (2), wherein the reference solution contains at least one of salidroside, scutellaria glycoside, verbascoside, terunguside, luteolin, ligustrin, oleuropein, and ligustrin G13;

[0077] According to the retention time of each determined component in the chromatogram of the reference solution, the component type corresponding to the chromatographic peaks with different retention times in the chromatogram of the test solution is determined.

[0078] The present application uses the same chromatographic conditions in step (2) to determine the chromatogram of the reference solution containing the chemical components in Ligustrum lucidum, in order to determine the component types corresponding to the chromatographic peaks with different retention times in the chromatogram of the test solution based on the retention time of each determined component in the chromatogram of the reference solution, thereby accurately identifying the component types contained in the test solution.

[0079] In the sixth aspect, the present application provides a fingerprint of Ligustrum lucidum fruit constructed according to the method described in the fifth aspect of the present application.

[0080] The seventh aspect of the present application provides the method for constructing the fingerprint of Ligustrum lucidum fruit according to the fifth aspect of the present application and / or the use of the fingerprint of Ligustrum lucidum fruit according to the sixth aspect of the present application in the quality evaluation of Ligustrum lucidum fruit.

[0081] In an eighth aspect, the present application provides a method for evaluating the quality of Ligustrum lucidum fruit, comprising the steps of:

[0082] The method described in the fifth aspect of the present application is used to obtain fingerprints of raw Ligustrum lucidum fruit and fingerprints of different known Ligustrum lucidum fruit processed products; preferably, the processed products are selected from at least one of steamed products, wine-steamed products, wine-stewed products, salt-steamed products and vinegar-steamed products;

[0083] Obtaining a chromatogram of the Ligustrum lucidum fruit sample to be tested by adopting steps (1) and (2) described in the fifth aspect of the present application;

[0084] According to the fingerprint of the raw Ligustrum lucidum fruit, the fingerprints of the different known Ligustrum lucidum fruit processed products and the chromatogram information of the chromatogram of the Ligustrum lucidum fruit sample to be tested, one or more of a heat map, an HCA cluster dendrogram, a PCA score map, a Bi-plot map, a PLS-DA model 3D map, a PLS-DA model VIP map and a PLS-DA model verification map are drawn to determine the type of the Ligustrum lucidum fruit sample to be tested and evaluate its quality; preferably, the chemical marker for the quality evaluation of Ligustrum lucidum fruit comprises privetside G13.

[0085] The 2020 edition of the Chinese Pharmacopoeia only includes one processed product of Ligustrum lucidum, namely, Ligustrum lucidum with wine. By consulting the literature, it was found that the boundaries between steaming with wine and stewing with wine are unclear, and steaming with wine and stewing with wine are often confused as one. The present application combines DNA barcoding technology with ultra-high liquid phase fingerprinting technology to directly analyze the genetic material of Ligustrum lucidum. First, the reliability of the source of Ligustrum lucidum slices is ensured, and it is found that the collected raw Ligustrum lucidum slices can be clustered according to the place of origin, indicating that the origin of Ligustrum lucidum slices varies greatly, which is an important factor affecting the quality of Ligustrum lucidum slices. The present application selected Ligustrum lucidum from the same origin, prepared five processed products of Ligustrum lucidum according to the Chinese Pharmacopoeia and related references, and used fingerprints combined with chemometric methods to distinguish and identify them with artificial intelligence. The results showed that the five processed products, steamed, steamed with wine, stewed with wine, steamed with salt, and steamed with vinegar, can be clustered separately, and the changes in chemical composition are significantly different, suggesting that the most suitable processed products should be selected based on syndrome differentiation and treatment in clinical practice. The present application found that there were large differences between wine-steamed products and wine-stewed products. Through semi-quantification of peak area, it was found that the content of chemical marker glossoside G13 in wine-steamed products was significantly higher than that in wine-stewed products. Therefore, in practical applications, the processing technology should be standardized, and wine-steamed products and wine-stewed products should not be lumped together. Compared with traditional methods of identification of medicinal pieces such as microscopic identification, thin layer identification and content determination, the method provided by the present application extracts chemical markers on the basis of a comprehensive analysis of the chemical composition of Ligustrum lucidum and its processed products, simplifies the operation steps, and has good precision, achieving the purpose of differentiation and identification; the obtained chemical markers also provide a scientific basis and reference for the subsequent quality evaluation of Ligustrum lucidum and its different processed products, the formulation and improvement of quality standards for Chinese medicine pieces, and the high-quality and high-price management of medicinal pieces. The DNA sequencing analysis established in the present application, combined with Chinese medicine fingerprint maps and a variety of chemical pattern recognition technologies, carried out quality evaluation research on Ligustrum lucidum from multiple angles such as origin, source, and processing, providing a chemical substance basis guarantee for the subsequent study of the compatibility mechanism of wine-steamed Ligustrum lucidum and Herba Ecliptae Polygoni Multiflori in the Erzhi Fang.

[0086] Example

[0087] The following examples and comparative examples are provided to further illustrate the embodiments of the present application. Various tests and evaluations were performed according to the following methods. Furthermore, unless otherwise specified, percentages herein refer to mass percentages for solid-liquid mixing and solid-solid mixing, and volume percentages for liquid-liquid mixing.

[0088] In the following examples, 26 batches of raw slices of Ligustrum lucidum from Anhui, Henan, Shaanxi, Shanxi, Jiangsu, and Sichuan, as well as five batches of wine-fried slices from Sichuan, were used, all purchased from different slice factories. The specific information is shown in Table 1. The applicant prepared five processed Ligustrum lucidum products (steamed with wine, steamed with water, steamed with salt, stewed with wine, and steamed with vinegar) by referring to the pharmacopoeia and reviewing relevant literature. Salidroside reference substance (No. CHB171228, purity >98%), salidroside reference substance (No. CHB170302, purity >98%), verbascoside reference substance (No. CHB171103, purity >98%), luteolin reference substance (No. DST180228-016, purity >98%), ligustrin reference substance (No. CHB171205, purity >98%), oleuropein reference substance (No. CHB170616, purity >98%), and ligustrin G13 reference substance (No. CHB171203, purity >98%) were purchased from Shanghai Ronghe Pharmaceutical Technology Co., Ltd., and ligustrin reference substance (Batch No. CHBT009, purity >98%) was purchased from Chengdu Kroma Biotechnology Co., Ltd. Shaoxing rice wine, Longmen vinegar, and table salt were also purchased.

[0089] Methanol and acetonitrile were purchased from Sigma, USA, and formic acid was purchased from Tianjin Kemeiou Chemical Reagent Co., Ltd. Distilled water was purchased from Watsons. ITS, ITS2, matK, and psbA-trnH kits were purchased from Beijing Tiangen Biochemical Technology Co., Ltd.

[0090] Table 1 Sample information of raw and processed Ligustrum lucidum fruit

[0091]

[0092]

[0093] Note: "-" indicates non-existence; in the sample name, the name before the brackets is the batch sample name, and the name in the brackets is the numbered name of two or three randomly selected samples from the batch (some experiments are repeated two or three times to avoid errors). For example, AH1 is the batch sample name, and AH11-AH12-AH13 are the numbered names of three randomly selected samples from the AH1 batch.

[0094] Preparation of the wine-steamed product: Weigh 100g of clean Ligustrum lucidum fruit slices, and weigh three parallel portions. Add 25% (approximately 25g) of yellow rice wine to each portion and let it steep for 2 hours. Once the wine is completely absorbed, steam the slices on an induction cooker. Heat over high heat (2000W, 200°C) until the steamer is full of roundness. Then, reduce heat to low (800W, 130°C) and start the timer. Steam for 8 hours, then remove and allow to cool. Dry at 60°C for 6 hours. Grind an appropriate amount of the processed product and pass it through a No. 3 pharmacopoeia sieve for later use.

[0095] Preparation method of vinegar steamed products: except using vinegar instead of rice wine, the preparation method of other steamed products is the same as that of wine steamed products.

[0096] Preparation method of steamed products: except using drinking water instead of rice wine, the preparation method of other steamed products is the same as that of rice wine.

[0097] Preparation of the wine-stewed product: Weigh 100g of clean Ligustrum lucidum fruit slices, and weigh two parallel portions. Add 25% (approximately 25g) of rice wine to each portion and let it steep for 2 hours. Once the rice wine is completely absorbed, heat on an induction cooker over water and stew thoroughly. Heat over high heat (2000W, 200°C) until the pot is full of roundness and aroma. Then, reduce heat to low (800W, 130°C) and start the timer. Stew for 8 hours, remove, let cool, and oven-dry at 60°C for 6 hours. Grind an appropriate amount of the processed product and pass through a No. 3 pharmacopoeia sieve for later use.

[0098] Preparation of the salt-steamed product: Weigh 100g of clean Ligustrum lucidum fruit slices, weigh three parallel portions, spray each with 25mL of 1wt% saline, mix well, and let it sit for 3 hours. After the saline is completely absorbed, steam the mixture on an induction cooker until thoroughly cooked. Steam the mixture as above for 1.5 hours, then remove and allow to cool. Dry at 60°C for 6 hours. Grind an appropriate amount of the processed product and pass it through a No. 3 pharmacopoeia sieve for later use.

[0099] The instruments used in the following examples are shown in Table 2 below.

[0100] Table 2 Instrument information

[0101] Instrument name model Manufacturer One hundred thousandth of a scale Sartorius BT125D Sartorius Scientific Instruments Co., Ltd. One ten-thousandth balance FA2004A Shanghai Jingtian Electronic Instrument Co., Ltd. Desktop high-speed centrifuge TG16-WS Changsha Xiangyi Centrifuge Instrument Co., Ltd. Ultra-high performance liquid chromatography ACQUITY H-class Waters electrophoresis apparatus DYY-6C Beijing Liuyi Instrument Factory Gel imaging instrument BIO-RAD American Bio-Rad Company PCR instrument 4375786 Thermo Veriti Ultrasonic cleaner KH3200B Kunshan Hechuang Ultrasonic Instrument Co., Ltd.

[0102] Example 1

[0103] 1. DNA extraction

[0104] Take 30mg of raw Ligustrum lucidum slices from 26 batches respectively, add liquid nitrogen and grind thoroughly into fine powder. Quickly transfer the ground slice powder to a centrifuge tube, add 700μL of 65℃ preheated buffer GP1 (with mercaptoethanol, final concentration 0.1%), quickly invert and mix, then place the centrifuge tube in a 65℃ water bath for 60min, constantly inverting and mixing the sample during the process. Take the upper aqueous phase, add 700μL of chloroform, mix thoroughly, centrifuge at 12000rpm (~13400×g) for 5min, and repeat this step. Then carefully transfer the upper aqueous phase obtained in the previous step to a new centrifuge tube, add 700μL of buffer GP2, and mix thoroughly. Transfer the resulting liquid to the adsorption column CB3, centrifuge at 12000rpm (~13400×g) for 30s, discard the lower layer of waste liquid, and place the adsorption column CB3 into a collection tube. Add 500 μL of Buffer CD (with anhydrous ethanol) to the adsorption column CB3 and centrifuge at 12,000 rpm (~13,400 × g) for 30 seconds. Discard the waste liquid and place the adsorption column CB3 in a collection tube. Add 600 μL of Rinse Buffer PW (with anhydrous ethanol) to the adsorption column CB3 and centrifuge at 12,000 rpm (~13,400 × g) for 30 seconds. Discard the waste liquid and place the adsorption column CB3 in a collection tube. Repeat this step. Place the adsorption column CB3 in a new 2 mL collection tube and centrifuge at 12,000 rpm (~13,400 × g) for 2 minutes in an airtight container. Discard the waste liquid. Allow the adsorption column CB3 to stand at room temperature for 5 minutes to completely dry any residual rinse liquid from the adsorption material. Place the adsorption column CB3 in a clean 1.5 mL centrifuge tube, add 50 μL of ddH2O to the middle part of the adsorption film, let it stand at room temperature for 5 minutes, centrifuge at 12000 rpm (~13400×g) for 2 minutes, repeat this step, and collect the solution in a centrifuge tube.

[0105] 2. PCR amplification

[0106] Three sets of primer sequences were selected for PCR amplification of the extracted DNA, namely:

[0107] (1) ITS: forward primer F: 5'-GGAAGTAAAAGTCGTAACAAGG-3' (SEQ ID NO: 3); reverse primer R: 5'-TCCTCCGCTTATTGATATGC-3' (SEQ ID NO: 4);

[0108] (2) matK: forward primer F: 5'-CGTACAGTACTTTTGTGTTTACGAG-3' (SEQ ID NO: 1); reverse primer R: 5'-ACCCAGTCCATCTGGAAATCTTGGTTC-3' (SEQ ID NO: 2);

[0109] (3) psbA-trnH: forward primer F: 5'-GTTATGCATGAACGTAATGCTC-3' (SEQ ID NO: 5); reverse primer R: 5'-CGCGCATGGTGGATTCACAATCC-3' (SEQ ID NO: 6).

[0110] Pretreatment was performed using ddH2O 8.5 μL, 2× Taqmastermix 12.5 μL, DNA template 2 μL, forward primer 1 μL, and reverse primer 1 μL.

[0111] PCR conditions for ITS: initial 94°C for 5 min, 94°C for 1 min, 50°C for 1 min, 72°C for 1.5 min + 3 s / cycle, extension at 72°C for 7 min, and 4°C for 30 cycles.

[0112] PCR conditions for matK were as follows: initial 94°C for 1 min, 94°C for 30 s, 52°C for 20 s, 72°C for 50 s, extension at 72°C for 5 min, and 4°C hold for 36 cycles.

[0113] PCR conditions for psbA-trnH were as follows: initial 94°C for 5 min, 94°C for 30 s, 55°C for 1 min, 72°C for 50 s, extension at 72°C for 10 min, and 4°C hold for 35 cycles.

[0114] 3. DNA barcode sequencing analysis

[0115] The sequences amplified by the PCR were sequenced separately, and the sequencing data were compiled using CodonCode Aligner. The results were analyzed and integrated using the unweighted paired group algorithm (UPGMA) using MEGA software. The analysis results showed that the sequences based on the psbA-trnH and ITS primers were not amplified in Ligustrum lucidum. The clustering dendrogram of the 26 batches of Ligustrum lucidum samples based on the sequences based on the matK primer was as follows: Figure 1 shown. Figure 1 The results showed that all 26 batches of samples used in this example were identified as Ligustrum lucidum fruits and clustered according to their origin; this indicates that the origins of Ligustrum lucidum samples vary greatly, and the origin factor affects the quality of Ligustrum lucidum products.

[0116] Example 2

[0117] Weigh appropriate amounts of reference substances including privet glycoside G13, pine chrysanthemum glycoside, privet glycoside, luteolin, salidroside, privet glycoside, verbascoside, and oleuropein, and dilute to a 10 mL brown volumetric flask with 80% chromatographic methanol to obtain a mixed reference solution.

[0118] Take 26 batches of commercially available raw Ligustrum lucidum slices in Table 1, accurately weigh 0.1000 g, add 5 mL of 80 vol% methanol aqueous solution, and ultrasonically extract for 40 min, the extraction power is 150 W, the extraction frequency is 40 kHz, and the sample is cooled to room temperature after ultrasonication. The sample is weighed, and the lost weight is supplemented with 80 vol% methanol aqueous solution. The sample is shaken, allowed to stand, and centrifuged at 8000 r / min for 5 min. The supernatant is taken and filtered through a 0.22 μm microporous filter membrane. The filtrate is taken to obtain the test solution.

[0119] Chromatographic conditions: Chromatographic column: ACQUITY UPLC BEH Shield RP18 (2.1×100 mm, 1.7 μm); mobile phase: phase A: acetonitrile, phase B: 0.1% formic acid in water; gradient elution as shown in Table 3; flow rate: 0.3 mL / min; column temperature: 30°C; injection volume: 3 μL; detection wavelength: 230 nm.

[0120] Table 3 Gradient elution program

[0121] t / min Acetonitrile (%) 0.1% volume fraction of formic acid aqueous solution (%) 0 5 95 6 22 78 13 40 60 18 100 0

[0122] The above chromatographic conditions were used to determine the above test solution and reference solution, and the UPLC chromatograms of the raw Ligustrum lucidum slices were obtained ( Figure 2 ) and reference substance UPLC chromatogram ( Figure 3 ), and the chromatographic peaks in the test solution were identified by the reference solution. Among them, chromatographic peaks 1, 6, 10, 11, 12, 13, 14, and 16 were salidroside, scutellaria glycoside, verbascoside, teruncleside, luteolin, ligustrin, oleuropein, and ligustrin G13, respectively. Teruncleside (peak 11) is the main active ingredient in Ligustrum lucidum fruit. It can be detected in all batches of samples with good resolution and high content. It is also the content determination component specified in the pharmacopoeia of Ligustrum lucidum fruit. Therefore, it was selected as the reference peak for calculating the relative retention time and relative peak area of ​​each common peak.

[0123] Example 3

[0124] Take 26 batches of commercially available raw Ligustrum lucidum slices (raw Ligustrum lucidum) and commercially available wine Ligustrum lucidum (commercially available wine-cured product, Sichuan) in Table 1, accurately weigh 0.1000g, add 5mL 80vol% methanol aqueous solution, ultrasonically extract for 40min, the extraction power is 150W, the extraction frequency is 40kHz, and after ultrasonication, cool to room temperature, weigh, make up the lost weight with 80vol% methanol aqueous solution, shake well, let stand, centrifuge at 8000r / min for 5min, take the supernatant, pass through a 0.22μm microporous filter membrane, take the filtrate, and obtain the test solution. In order to increase the accuracy and reliability of the analysis, each batch of samples was processed in parallel for 3 times.

[0125] Chromatographic conditions: Chromatographic column: ACQUITY UPLC BEH Shield RP18 (2.1×100 mm, 1.7 μm); mobile phase: phase A: acetonitrile, phase B: 0.1% formic acid in water; gradient elution as shown in Table 4; flow rate: 0.3 mL / min; column temperature: 30°C; injection volume: 3 μL; detection wavelength: 230 nm.

[0126] Table 4 Gradient elution program

[0127] t / min Acetonitrile (%) 0.1% volume fraction of formic acid aqueous solution (%) 0 5 95 6 22 78 13 40 60 18 100 0

[0128] The above chromatographic conditions were used to detect each test solution, and chromatograms of 26 batches of raw Ligustrum lucidum slices and chromatograms of commercially available wine Ligustrum lucidum slices were obtained. The UPLC (ultra-high performance liquid chromatography) spectra of the 26 batches of raw Ligustrum lucidum slices were imported into the "Chinese Medicine Chromatographic Fingerprint Similarity Evaluation System Software" (Version A) issued by the Chinese Pharmacopoeia Commission in AIA format for fingerprint analysis. The SC1 spectrum was used as the reference spectrum, the "time window width" was selected as 0.1min, and the average method was used for calculation to generate a control fingerprint spectrum and perform multi-point correction and automatic matching. The chromatogram after matching is as follows: Figure 4 As shown. Using the JSC1 decoction piece atlas as a reference, the same method was used to generate the UPLC fingerprint of the commercially available Ligustrum lucidum. The chromatogram after matching is as follows Figure 5 shown.

[0129] Fingerprint Similarity Analysis: The UPLC chromatographic fingerprints obtained were analyzed for similarity using the Chinese Pharmacopoeia Commission's Traditional Chinese Medicine Chromatographic Fingerprint Similarity Software. The similarity values ​​for 26 batches of raw Ligustrum lucidum slices are shown in Table 5. The results show that the similarities ranged from 0.589 to 0.882, indicating good similarity among the slices. The similarity evaluation results for the UPLC fingerprints of commercially available alcoholic Ligustrum lucidum slices are shown in Table 6. The similarities ranged from 0.684 to 1, indicating good similarity among the slices. However, there were some differences among the processed products produced by different slice factories.

[0130] Table 5 Similarity evaluation results of 26 batches of raw Ligustrum lucidum products

[0131] batch number Similarity batch number Similarity AH1 0.847 SX7 0.873 AH2 0.711 SC1 0.742 AH3 0.725 SC2 0.773 AH4 0.589 JS1 0.755 AH5 0.714 JS2 0.646 HN1 0.864 SsX1 0.821 HN3 0.857 SX4 0.882 HN7 0.736 SX5 0.865 JS3 0.703 SX6 0.858 SsX2 0.85 HN5 0.851 SX1 0.74 HN6 0.821 SX2 0.626 HN2 0.851 SX3 0.69 HN4 0.869

[0132] Table 6 Similarity evaluation results of commercially available wines with Ligustrum lucidum

[0133] JSC11 JSC12 JSC21 JSC22 JSC31 JSC32 JSC41 JSC42 JSC51 JSC52 comparison JSC11 1.000 0.808 0.422 0.476 0.519 0.563 0.535 0.609 0.503 0.627 0.737 JSC12 0.808 1.000 0.414 0.466 0.475 0.522 0.496 0.583 0.453 0.423 0.684 JSC21 0.422 0.414 1.000 0.879 0.757 0.563 0.783 0.657 0.58 0.466 0.797 JSC22 0.476 0.466 0.879 1.000 0.778 0.607 0.805 0.682 0.55 0.48 0.824 JSC31 0.519 0.475 0.757 0.778 1.000 0.867 0.975 0.795 0.708 0.708 0.924 JSC32 0.563 0.522 0.563 0.607 0.867 1.000 0.85 0.726 0.654 0.808 0.874 JSC41 0.535 0.496 0.783 0.805 0.975 0.85 1.000 0.819 0.701 0.687 0.932 JSC42 0.609 0.583 0.657 0.682 0.795 0.726 0.819 1.000 0.896 0.682 0.883 JSC51 0.503 0.453 0.58 0.55 0.708 0.654 0.701 0.896 1.000 0.682 0.787 JSC52 0.627 0.423 0.466 0.48 0.708 0.808 0.687 0.682 0.682 1.000 0.798 comparison 0.737 0.684 0.797 0.824 0.924 0.874 0.932 0.883 0.787 0.798 1.000

[0134] Fingerprint difference analysis: The fingerprints of commercially available alcoholic beverages, steamed products, wine-steamed products, wine-stewed products, vinegar-steamed products, and salt-steamed products prepared in this application were generated using the Chinese medicine chromatographic fingerprint similarity software (the fingerprints were established using the same method as the commercially available alcoholic beverages in this embodiment). Figure 6 As shown. Analysis and comparison using peak area as the labeled content showed that the steamed product had the lowest content of privet glycosides, while the salt-steamed product had the highest content. The contents of the wine-steamed, wine-stewed, and vinegar-steamed products were relatively similar. Certain differences were observed among the different processed products of Ligustrum lucidum fruit.

[0135] Investigation of fingerprint methodology

[0136] (1) Precision test

[0137] Six injections were made from the same Ligustrum lucidum fruit sample solution under the same chromatographic conditions as described above in this example. Using terebutrin (peak 11) as the reference peak (S), the relative retention times (RSD% < 2.0%) and relative peak areas (RSD% < 5.0%) of the common peaks were calculated, demonstrating good precision. The results are shown in Tables 7 and 8.

[0138] Table 7. Experimental results of relative retention time precision of common peaks

[0139]

[0140] Table 8. Experimental results of relative retention time precision of common peaks

[0141]

[0142]

[0143] (2) Repeatability test

[0144] Six samples of Ligustrum lucidum fruit solution were prepared in parallel using the same method for preparing the test solution as described above in this example. Six injections were performed consecutively under the same chromatographic conditions as described above in this example for analysis. Using terebutrin (peak 11) as the reference peak, the relative retention time (RSD% < 2%) and relative peak area (RSD% < 5%) of each common peak were calculated, indicating good repeatability. The results are shown in Tables 9 and 10.

[0145] Table 9 Common peak relative retention time repeatability experimental results

[0146]

[0147] Table 10 Common peak relative peak area repeatability experimental results

[0148]

[0149]

[0150] (3) Stability test

[0151] The same Ligustrum lucidum sample solution was injected and analyzed at 0 h, 2 h, 4 h, 8 h, 12 h, and 24 h using the same chromatographic conditions as described above in this example. Using terephthaloside (peak 11) as the reference peak, the relative retention time (RSD% < 2%) and relative peak area (RSD% < 5%) of each common peak were calculated, indicating that the sample was stable within 24 h. The results are shown in Tables 11 and 12.

[0152] Table 11 Common peak relative retention time stability test results

[0153]

[0154] Table 12 Common peak relative peak area stability test results

[0155]

[0156] Example 4

[0157] Using the data management function of the Waters empower workstation, we obtained information such as peak areas and retention times for each chromatographic peak in the Ligustrum lucidum (Gou Ligustrum lucidum) samples. Chemometric methods were then used to statistically analyze the raw Gou Ligustrum lucidum, commercially available Gou Ligustrum lucidum wine, and the processed Gou Ligustrum lucidum prepared in this application. Heat maps were created using an online plotting tool (https: / / software.broadinstitute.org / morpheus / ). Unsupervised chemical pattern recognition models (PCA and HCA) were established using SIMCA-P14.1 software. Further analysis and analysis were performed to establish a supervised chemical pattern recognition model using PLS-DA, identifying chemical markers. Finally, the model was validated using unknown samples.

[0158] 1. Heat map and hierarchical cluster analysis (HCA)

[0159] HCA is to gradually cluster the research objects according to the similarity of sample attributes until all samples are clustered together, and samples with high similarity will be classified into one category. Using the data management function of Waters empower workstation, the peak area, retention time and other related information of raw Ligustrum lucidum from Sichuan and different processed products were obtained. The online drawing tool (https: / / software.broadinstitute.org / morpheus / ) was used to draw the heat map of raw Ligustrum lucidum and different processed products. Figure 7 ((S: raw Ligustrum lucidum fruit; CZ: steamed with vinegar; Q: steamed with water; JZ: steamed with wine; YZ: steamed with salt; JD: stewed with wine) Figure 7The results show that compared with the raw product of Ligustrum lucidum, the chemical component contents of different processed products are significantly different. Among them, the color blocks of steamed products and vinegar-steamed products are closest to the raw product. In the salt-steamed product sample, the color blocks of chemical components 2, 4, 6, 8, 10, and 18 are more obvious. Chemical components 5 and 16 have a greater impact on the steamed product and vinegar-steamed product samples. In the wine-steamed product sample, the color blocks of chemical components 9, 11, 12, 13, 14, 15, and 17 are more obvious. The obtained data matrix was imported into SIMCA-P14.1, and the samples were subjected to hierarchical cluster analysis using Ward's method. The dendrogram is shown below. Figure 8 As shown in the figure, when the distance scale is about 60, the raw Ligustrum lucidum fruit and its different processed products can be significantly distinguished, among which G1: raw Ligustrum lucidum fruit; G2: steamed with vinegar; G3: steamed; G4: steamed with wine; G5: steamed with salt; G6: stewed with wine.

[0160] 2. Principal Component Analysis (PCA)

[0161] PCA is a method that reduces the dimensionality of a large number of correlated variables while retaining the main variable information as much as possible, and recombine them into a few new potential comprehensive indicators. It can reflect the significant components in the sample and reflect the characterization characteristics of the sample.

[0162] Simca-p14.1 was used to establish the PCA model of raw Ligustrum lucidum fruit from Sichuan and different processed products. The score diagram is shown in the figure below. Figure 9 As shown, from Figure 9 It can be seen that the raw and processed Ligustrum lucidum fruits can be clustered into their own categories: G1: steamed with salt; G2: steamed; G3: stewed with wine; G4: steamed with vinegar; G5: steamed with wine; and G6: raw Ligustrum lucidum fruit. In the PCA model, cross-validation Q2(cum) = 0.930. Based on cross-validation and other eigenvalues, the optimal number of components was selected, and a total of five principal components were extracted, with a cumulative contribution rate R 2 X (cum) = 0.970, with good accuracy. According to the established PCA model, the raw and processed Fructus Ligustri Lucidi can be clearly distinguished, which is of great significance for the distinction and identification of decoction pieces.

[0163] Secondly, this application generates a Bi-plot that can reflect the relationship between chemical composition and PCA distribution, such as Figure 10 As shown. Figure 10 It can be found that chemical components 2, 4, 6, 8, 10, and 18 have a greater influence on the distribution of salt-steamed samples; chemical components 5 and 16 have a greater influence on the distribution of steamed and vinegar-steamed samples; chemical components 9, 11, 12, 13, 14, 15, and 17 have a greater influence on the distribution of wine-steamed samples. This result is consistent with the heat map distribution result, further illustrating the accuracy of the model. Its chemical component distribution is of great significance in guiding the classification of Ligustrum lucidum fruit and its processed products.

[0164] (3) Partial Least Squares Analysis (PLS-DA)

[0165] PLS-DA can perform discriminant analysis on samples while avoiding the influence of sample collinearity. In order to better identify chemical markers, a supervised PLS-DA model was established for raw Ligustrum lucidum fruit and its different processed products. Figure 11 This is the 3D diagram of the PLS-DA model, among which G1: steamed with salt; G2: steamed with water; G3: stewed with wine; G4: steamed with vinegar; G5: steamed with wine; G6: raw Ligustrum lucidum fruit product, which is consistent with the results of the PCA model, verifying the reliability of the results.

[0166] In order to weigh the importance of each variable for identification, a VIP diagram (Variable Projection Importance) was drawn ( Figure 12 ), explaining the importance of variables in relation to X and Y. Figure 12 The results show that the VIP values ​​of variables 3, 4, 5, 15, 16, and 17 are greater than 1, which means that these variables play an important role in the differentiation, among which variable 16 is privet glycoside G13. In the PLS-DA model, the cross-validation Q2(cum) = 0.942. Based on the cross-validation and other characteristic values, the six best components were extracted to obtain the principal components, and their cumulative contribution rate R 2 Y (cum) = 0.946, indicating good accuracy, proving that the PLS-DA model fits the data well and predicts new data.

[0167] In order to accurately assess the potential risks of the current PLS-DA model, it is necessary to verify that the model is not only suitable for the training set, but also can predict well for the new prediction set. In practice, the X-matrix is ​​kept unchanged, and the goodness of fit (R2 and Q2) of the original model is compared with the goodness of fit of the model based on the data with the random order of Y observations. Figure 13 As shown, the results show that all blue Q2 values ​​extending to the left are lower than the original point on the right and the regression line of the Q2 point intersects the vertical axis (left) below zero, indicating that the original model is valid, further verifying the rationality and effectiveness of the model.

[0168] The above description is only a preferred embodiment of the present application and is not intended to limit the present application. Any modifications, equivalent replacements, improvements, etc. made within the spirit and principles of the present application shall be included in the scope of protection of the present application.

Claims

1. A DNA barcode for identifying the origin of Ligustrum lucidum, wherein: The DNA barcode includes a matK gene fragment; preferably, the nucleotide sequence of the matK gene fragment is shown in SEQ ID NO:

7.

2. A primer pair for amplifying a DNA barcode for identifying the origin of Ligustrum lucidum, wherein: The primer pair comprises a forward primer having a nucleotide sequence as shown in SEQ ID NO: 1 and a reverse primer having a nucleotide sequence as shown in SEQ ID NO:

2.

3. A kit for identifying the origin of Ligustrum lucidum, wherein: The kit comprises the primer pair according to claim 2; preferably, the kit further comprises a genomic DNA extraction reagent and / or a PCR amplification reagent.

4. A method for identifying the origin of Ligustrum lucidum, wherein: The method comprises the steps of using the primer pair described in claim 2 or the kit described in claim 3 to perform PCR amplification on the Ligustrum lucidum fruit sample to be tested; Preferably, the method comprises the steps of: Extracting genomic DNA from Ligustrum lucidum fruit samples to be tested; Using the genomic DNA as a template, PCR amplification is performed using the primer pair described in claim 2 or the kit described in claim 3; The PCR amplification product is sequenced, and then analyzed and integrated with the sequencing results of Ligustrum lucidum from multiple different known origins to obtain a sample clustering dendrogram; based on the specific clustering position of the Ligustrum lucidum sample to be tested in the sample clustering dendrogram, the origin of the Ligustrum lucidum sample to be tested is determined.

5. A method for constructing a fingerprint map of Ligustrum lucidum, comprising the steps of: (1) Take Ligustrum lucidum fruit, use methanol aqueous solution with a volume fraction of 75%-85% as solvent, perform ultrasonic extraction, and obtain a Ligustrum lucidum fruit test solution; preferably, the ratio of the mass of the Ligustrum lucidum fruit to the volume of the solvent is 1g: (40-60)mL; the ultrasonic extraction time is 35min-45min, the extraction power is 100W-200W, and the extraction frequency is 30kHz-50kHz; the Ligustrum lucidum fruit is selected from a raw Ligustrum lucidum fruit or a processed Ligustrum lucidum fruit; (2) using ultra-high performance liquid chromatography to detect the test solution of the Ligustrum lucidum to obtain a chromatogram of the Ligustrum lucidum; wherein: Chromatographic conditions include: chromatographic column: octadecylsilane bonded silica gel chromatographic column; mobile phase: phase A is acetonitrile, phase B is a formic acid aqueous solution with a volume fraction of 0.05%-0.15%; gradient elution is adopted with a volume fraction of 5%-100% phase A and 0%-95% phase B; flow rate: 0.2mL / min-0.4mL / min; column temperature: 28°C-32°C; injection volume: 2μL-4μL; detection wavelength: 220nm-240nm; preferably, the gradient elution is specifically: 0min-6min, 95%-78%B; 6min-13min, 78%-60%B; 13min-18min, 60%-0%B; (3) Taking R batches of raw Ligustrum lucidum fruit or processed Ligustrum lucidum fruit with the same origin, repeating the steps (1) and (2) in sequence, respectively, to obtain chromatograms of the R batches of Ligustrum lucidum fruit; analyzing the chromatograms of the R batches of Ligustrum lucidum fruit using a traditional Chinese medicine chromatographic fingerprint similarity evaluation software to obtain a fingerprint of Ligustrum lucidum fruit; wherein R≥10.

6. The method according to claim 5, wherein: In the step (3), the R batches of raw Ligustrum lucidum products or processed Ligustrum lucidum products with the same origin are identified by using the DNA barcode according to claim 1, the primer pair according to claim 2, the kit according to claim 3 or the method according to claim 4; Preferably, the processed product is selected from at least one of steamed products, wine-steamed products, wine-stewed products, salt-steamed products and vinegar-steamed products.

7. The method according to claim 5 or 6, wherein: Also includes the steps: The chromatogram of a reference solution containing chemical components in Ligustrum lucidum is determined using the same chromatographic conditions as in step (2), wherein the reference solution contains at least one of salidroside, scutellaria glycoside, verbascoside, teruncifloside, luteolin, ligustroglucosidin, oleuropein and ligustroglucosidin G13; According to the retention time of each determined component in the chromatogram of the reference solution, the component type corresponding to the chromatographic peaks with different retention times in the chromatogram of the test solution is determined.

8. The Fructus Ligustri Lucidi fingerprint obtained by constructing according to the method described in any one of claims 5-7.

9. The method for constructing a Ligustrum lucidum fingerprint as described in any one of claims 5 to 7 and / or the use of the Ligustrum lucidum fingerprint as described in claim 8 in the quality evaluation of Ligustrum lucidum.

10. A method for evaluating the quality of Ligustrum lucidum, wherein: Includes steps: The method according to any one of claims 5 to 7 is used to obtain fingerprints of raw Ligustrum lucidum and fingerprints of different known Ligustrum lucidum processed products respectively; preferably, the processed products are selected from at least one of steamed products, wine steamed products, wine stewed products, salt steamed products and vinegar steamed products; Using step (1) and step (2) as described in any one of claims 5 to 7 to obtain a chromatogram of the Ligustrum lucidum fruit sample to be tested; According to the fingerprint of the raw Ligustrum lucidum fruit, the fingerprints of the different known Ligustrum lucidum fruit processed products and the chromatogram information of the Ligustrum lucidum fruit sample to be tested, one or more of a heat map, an HCA cluster dendrogram, a PCA score map, a Bi-plot map, a PLS-DA model 3D map, a PLS-DA model VIP map and a PLS-DA model verification map are drawn to determine the type of the Ligustrum lucidum fruit sample to be tested and evaluate its quality; preferably, the chemical marker for quality evaluation of Ligustrum lucidum fruit comprises privet glycoside G13.

Images