Molecular marker primer kit for identifying annona squamosa germplasm resources and application

Abstract

The invention discloses a molecular marker primer kit for identifying annona squamosa germplasm resources and application of the molecular marker primer kit. A molecular marker primer comprises one or more of a primer pair AT-SSR-105, a primer pair AT-SSR-114 and a primer pair AT-SSR-115. According to the invention, 1331 Unigene strips are screened from a constructed cDNA library, SSR site searching is carried out on the Unigene strips by using MISA software, sequences meeting conditions are selected, 116 pairs of EST-SSR primers are designed by using software Primer primers5.0, after electrophoresis observation, 3 pairs of SSR molecular marker primers with good amplification effect and high polymorphism are screened, and by using the SSR molecular marker primers, the specific primer sequence of the EST-SSR primers is obtained. The genetic diversity and genetic relationship of annona squamosa groups can be analyzed, germplasm identification and genetic relationship analysis can also be carried out on annona squamosa varieties, the method has the advantages of being efficient, accurate, practical, free of seasonal influence and the like, and a foundation is laid for subsequent annona squamosa germplasm resource management, breeding, genetic protection, inter-group and intra-group genetic diversity analysis and the like.

Description

Technical Field

[0001] The present application relates to the field of biotechnology, and specifically to a molecular marker primer kit and application for identifying custard apple germplasm resources. Background Art

[0002] Sugar apple (Annona squamosa L.), also known as sugar apple, ghost lychee, Buddha head fruit (Taiwan), Ma Luotuo (Guangxi), Yangbo Luo (Longzhou, Guangxi), Fanbao Luo (Pingxiang, Guangxi), Lingo (Chaoshan, Guangdong), is a perennial semi-deciduous shrub or small tree of the genus Annonaceae, native to tropical American land or Caribbean islands or West Indies, and now widely distributed in tropical and warmer subtropical regions. As one of the five major tropical fruits in the world, sugar apple is deeply loved by consumers for its excellent quality, soft and smooth flesh, unique and sweet flavor, and the fruit contains essential nutrients such as protein, vitamins, carbohydrates, calcium, phosphorus, and iron. It has become a hot commodity in the market and the product is in short supply. The research on sugar apple variety resources in China started relatively late, and the genetic classification of its resources is relatively lacking, and the genetic relationship between seed sources is also unclear, which in turn affects the innovation of sugar apple germplasm resources and the breeding process of new varieties in my country. Genetic analysis of important germplasm resources is the basic work for parent selection in breeding, and can provide scientific support for germplasm innovation, rational use of resources and genetic improvement in breeding. Germplasm identification is an important basis for genetic improvement and intellectual property protection.

[0003] The traditional morphological identification method is simple and intuitive. However, the new varieties selected and bred in recent years are becoming more and more similar in morphology, and the morphological method can no longer meet the identification and purity analysis of many varieties. Molecular marker technology is a genetic marker based on the study of biological macromolecules, especially the polymorphism of genetic material of organisms-DNA. The basic repeating unit of SSR is composed of several nucleotides, and the number of repetitions is generally 10 to 50. The same type of microsatellite DNA can be distributed at different positions in the genome. Due to the different number of repetitions of the basic unit, the polymorphism of the SSR locus is formed. By comparing the migration distance of the amplified bands through polyacrylamide gel electrophoresis, the polymorphism of different individuals at a certain SSR locus can be known. Molecular marker technology can be used to construct the core germplasm resources of the population. The constructed core germplasm resources require the maximum representation of the genetic diversity of the resources with the least number, and study the environmental and agronomic traits of the germplasm resources. It is of great significance for genetic map integration, genetic diversity analysis, planting resource identification, gene positioning, molecular marker-assisted breeding, and gene positional cloning.

[0004] Therefore, finding and developing SSR primers suitable for sugar apple genetic research is the prerequisite for further research on sugar apple germplasm resource management, genetics, and protection. Summary of the invention

[0005] The purpose of the present invention is to provide a molecular marker primer kit for identifying sugar apple germplasm resources and its application. By designing and developing 116 pairs of sugar apple SSR primers, three pairs of SSR molecular marker primers with good amplification effect and high polymorphism are screened after electrophoresis observation. The SSR molecular marker primers can be used to analyze the genetic diversity and kinship of sugar apple populations, and can also be used to perform germplasm identification and kinship analysis on sugar apple varieties. The kit has the advantages of high efficiency, accuracy, practicality, and no seasonal influence, and lays a foundation for subsequent sugar apple germplasm resource management, breeding, genetic protection, and genetic diversity analysis between and within populations.

[0006] To achieve the above object, the present invention adopts the following technical solutions:

[0007] A molecular marker primer kit for identifying custard apple germplasm resources is characterized by comprising primer pairs AT-SSR-105, AT-SSR-114 and AT-SSR-115, wherein the sequence information of AT-SSR-105 is shown in SEQ NO.1 and SEQ NO.2, the sequence information of AT-SSR-114 is shown in SEQ NO.3 and SEQ NO.4, and the sequence information of AT-SSR-115 is shown in SEQ NO.5 and SEQ NO.6.

[0008] The invention discloses a primer composition for identifying SSR molecular markers of custard apple germplasm resources, characterized in that the composition is a combination of primer pairs AT-SSR-105, AT-SSR-114 and AT-SSR-115.

[0009] A method for identifying the traits of sugar apple germplasm resources using a molecular marker primer combination: the steps include:

[0010] (1) Primer synthesis: synthesizing the three primer pairs described in claim 1;

[0011] (2) extracting genomic DNA from the tested custard apple germplasm resource samples;

[0012] (3) performing PCR amplification using the genomic DNA extracted in step (1) as a template, wherein the upstream primer of the primer pair used for PCR amplification is modified with a bioluminescent group;

[0013] Step (3) PCR amplification system: the total volume of the reaction system is 10 μL, including 1.0 μL DNA template, 1.0 μL 10×Buffer Ι buffer, 0.1 μL Taq enzyme, 0.6 μL primer, 0.8 μL 2.5 mM dNTP, and deionized water to 10 μL; PCR amplification reaction program: 95°C pre-denaturation for 3 min; 95°C denaturation for 30 s, annealing for 30 s according to the annealing temperature of the primers, 72°C extension for 30 s, 32 cycles; 60°C extension for 10 min;

[0014] (4) performing electrophoresis on the PCR amplification product obtained in step (3) and collecting data;

[0015] (5) statistically analyzing the genetic diversity or clustering and polymorphism information content of the sugar apple resource population based on the data obtained in step (4);

[0016] The germplasm resource traits include leaf length, fruit size, and plant height.

[0017] A molecular marker for identifying the traits of custard apple germplasm resources, characterized in that it is obtained by amplifying the primer pair AT-SSR-105, AT-SSR-114 and AT-SSR-115 described in claim 1, and the DNA sequence after amplification is shown in SEQ NO.6-9, which is a microsatellite marker.

[0018] A custard apple molecular marker database, characterized by comprising the above-mentioned molecular markers.

[0019] A clustering map of kinship of custard apple germplasm resources, characterized by comprising the following steps:

[0020] (1) DNA was extracted from the tested sugar apple resource varieties using a DNA kit, and the quality and concentration of the DNA were detected using 1.2% agarose gel electrophoresis and a spectrophotometer;

[0021] (2) using the three pairs of SSR primers in claim 1, AT-SSR-105, AT-SSR-114 and AT-SSR-115, to perform PCR amplification;

[0022] (3) Statistical analysis of the characteristics of the amplified product bands and the size of the polymorphic bands;

[0023] (4) The UPGMA method was used to cluster the germplasm information obtained in step (1), and the MEGA10.0 software was used to obtain a clustering map of their phylogenetic relationships.

[0024] Compared with the prior art, the present invention has the following characteristics and beneficial effects:

[0025] The invention utilizes 1331 Unigenes to be screened from a constructed cDNA library, utilizes MISA software to search for SSR sites, selects sequences that meet conditions, designs 116 pairs of EST-SSR primers by utilizing software Primer primers5.0, and selects 3 pairs of SSR molecular marker primers with good amplification effect and high polymorphism after electrophoresis observation. The SSR molecular marker primers can be used to analyze the genetic diversity and kinship of a sugar apple population, and can also be used to perform germplasm identification and kinship analysis on sugar apple varieties. The invention has the advantages of high efficiency, accuracy, practicality, no seasonal influence, and the like, and lays a foundation for subsequent management of sugar apple germplasm resources, breeding, genetic protection, genetic diversity analysis between and within populations, and the like. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1 Cluster analysis of 36 sugar apple samples based on SSR molecular markers;

[0027] Figure 2 Electrophoresis diagram of polymorphic sites of three pairs of SSR primers. DETAILED DESCRIPTION

[0028] In order to make the technical means, innovative features, objectives and effects achieved by the present invention easy to understand, the present invention is further described below.

[0029] The embodiments described herein are specific embodiments of the present invention, which are used to illustrate the concept of the present invention, are illustrative and exemplary, and should not be construed as limiting the embodiments of the present invention and the scope of the present invention. In addition to the embodiments described herein, those skilled in the art can also adopt other obvious technical solutions based on the claims and the contents disclosed in the specification of this application, including technical solutions that adopt any obvious replacement and modification of the embodiments described herein.

[0030] The basic repeating unit of SSR is composed of several nucleotides, and the number of repetitions is generally 10 to 50. The same type of microsatellite DNA can be distributed in different positions of the genome. Due to the different number of repetitions of the basic unit, the polymorphism of the SSR locus is formed. Each SSR locus is generally flanked by relatively conservative single-copy sequences, so a pair of specific primers can be designed based on the sequences on both sides to amplify the SSR sequence. By comparing the migration distances of the amplified bands through polyacrylamide gel electrophoresis, the polymorphism of different individuals at a certain SSR locus can be known.

[0031] Therefore, this application screened 1331 Unigenes (unique sequences) from the cDNA library constructed by the research group, used MISA software to search for SSR sites, selected the sequences that met the conditions, and designed 116 pairs of EST-SSR primers as shown in Table 1 by using the software Primerprimers5.0.

[0032] Table 1. 116 pairs of EST-SSR primers

[0033]

[0034]

[0035]

[0036] This application is based on the full-length data of the Annona transcriptome gene obtained by the project team in the early sequencing (uploaded to NCBI; URL: https: / / submit.ncbi.nlm.nih.gov / subs / sra / SUB7602336 / overview) , Phrap software (http / / www.phrap.org) was used to splice these ESTs, and then MISA software (http / / pgrc.ikp-gatersleben.de / misa) was used to search for SSR sites in the spliced ​​results. The repeating units of the SSR sites were selected to be dinucleotides, trinucleotides, tetranucleotides, pentanucleotides and hexanucleotides with a minimum repeating number of 8, 6, 4, 3 and 3 times respectively, and the SSR sites were more than 50 bp away from both ends of the sequence. 116 pairs of SSR primers were designed using Primer3.0Plus software, and the designed primers were evaluated using Oligo software. 116 pairs of SSR primers were designed, and the information is shown in Table 1. 36 custard apple germplasm resources with large phenotypic differences were selected from the custard apple materials collected by the project team. The amplification characteristics were analyzed by dextran gel electrophoresis and non-denaturing polyacrylamide gel electrophoresis (PAGE), and the effectiveness and polymorphism of the primers for cloning and sequencing of some amplified products were analyzed. It was found that 220 SSR sites were searched out of 1331 EST sequences of custard apple, distributed in 189 ESTs, with an occurrence frequency of 16.53%. The average length of these EST-SSRs is 18.43bp, and the average distribution frequency is 1 / 4.42kb.

[0037] The three pairs of primers with the best PCR amplification effects were selected and named AT-SSR-105, AT-SSR-114 and AT-SSR-115 for DNA fingerprint analysis of Annona mume. The reaction conditions and procedures were the same as those in the primer screening section. According to the electrophoresis results, the band at the same migration position was recorded as 1, and the absence of the band was recorded as 0. A 0, 1 matrix was established. The results are shown in Table 2.

[0038] Table 2.3 Primer pair migration matrix

[0039]

[0040]

[0041] Based on the statistical information of SSR loci, the genetic similarity (GS) between samples was calculated using Popgen32 software, and the 36 germplasms were clustered using the UPGMA method. The phylogenetic clustering map between them was obtained using MEGA10.0 software. The results are shown in Figure 1 .

[0042] Two specific implementation examples are provided as follows:

[0043] Case study 1: SSR primer screening for custard apple

[0044] The present invention uses the transcriptome sequence of Annona custardii to design 116 pairs of SSR primers (Table 1)

[0045] 1. After being synthesized in Shanghai Sangon Biotechnology Co., Ltd., they were used as candidate primers for Annona custardii, and the upstream primers of each pair of primers were modified with fluorescent groups.

[0046] 2. The main cultivated variety of Annona (Sugar Apple) was selected as the experimental material, and its young leaves were cut. The genomic DNA was extracted using a DNA kit (China Tiangen). The quality and concentration of DNA were detected by 1.2% agarose gel electrophoresis and NanoDrop spectrophotometer respectively.

[0047] 3. Using sample DNA as template, PCR amplification was performed with fluorescent modified primers and downstream primers. The PCR amplification system was as follows: the total volume of the reaction system was 10 μL, including 1.0 μL DNA template, 1.0 μL 10×Buffer Ι buffer, 0.1 μL Taq enzyme, 0.6 μL primer, 0.8 μL 2.5 mM dNTP, and deionized water was added to 10 μL; PCR amplification reaction procedure: PCR amplification reaction procedure: pre-denaturation at 95°C for 3 min; denaturation at 95°C for 30 s, renaturation for 30 s according to the annealing temperature of the primers, extension at 72°C for 30 s, 32 cycles; extension at 60°C for 10 min.

[0048] 4. The PCR amplification products were detected by dextran gel electrophoresis, and the characteristic bands and polymorphic band sizes amplified by each pair of primers were statistically analyzed, and polymorphic SSR molecular marker primers were screened.

[0049] 5. Finally, three pairs of SSR molecular marker primers were screened as shown in Table 3, named AT-SSR-105, AT-SSR-114, and AT-SSR-115. The sequence information is shown in SEQ NO.1 to 6, where SEQ NO.1, 3, and 5 are all upstream sequences. The three primers screened by repeating steps 2-4 were used for polyacrylamide electrophoresis detection of various custard apple resources. Figure 2 .

[0050] Table 3.3 Pairs of SSR molecular marker primers

[0051] serial number name Forward Primer Reverse Primer Repeating unit type Annealing temperature℃ SSR105 AT-SSR-105 CCATCTCCAGTCTCAAATCTCC CCGACCCTAGTTAGCACAAATC (A)10 59.81 SSR114 AT-SSR-114 CAAATAGAGTTGACTGCATCGG TAGACTCGGGAATGGATGATTT (A)15 61.71 SSR115 AT-SSR-115 GTAACAAGGTCTCCGTTGGTG CATTACTTATCGCATTTCGCTG (TAAA)5 59.80

[0052] Implementation case 2: Application of SSR primers in analysis of sugar apple resources

[0053] 1. The 36 sugar apple germplasm resources (pineapple sugar apple, AP sugar apple, durian sugar apple, green diamond sugar apple, honey sugar apple, Taidong No. 1, Taidong No. 2, Vietnamese sugar apple, Laotian sugar apple, Longzhou sugar apple, purple sugar apple, Jinwang sugar apple, Zhanglin Lin apple, Peruvian sugar apple, soursop, mountain soursop, smooth sugar apple, Huanglong sugar apple, red beef heart pear, white beef heart pear, large flower purple jade plate, purple jade plate, False eagle claw, GYSJ-1, GYSJ-2, GYSJ-3, GYSJ-4, GYSJ-5, GYSJ-6, GYSJ-7, GYSJ-8, GYSJ-9, GYSJ-10, BYSJ-1, BYSJ-2, BYSJ-3) were used as test materials. Young leaves were cut and DNA of the test annona resource varieties was extracted using a DNA kit. 1.2% agarose gel electrophoresis and spectrophotometer were used to detect the quality and concentration of DNA.

[0054] 2. Perform PCR amplification using the three pairs of SSR primers and their annealing temperatures screened in Example 1.

[0055] 3. Statistically analyze the characteristic and polymorphic band sizes of the amplified product bands.

[0056] 4. The UPGMA method was used to cluster the 36 germplasms, and the MEGA10.0 software was used to obtain the phylogenetic cluster map. At the genetic similarity coefficient of 0.610, the 36 germplasm materials can be divided into 5 types: Class I includes Taidong No. 1, Taidong No. 2, Jinwang Sugar Apple, Vietnamese Sugar Apple, Laos Sugar Apple, Longzhou Sugar Apple, GYSJ-4, GYSJ-6, Zhanglin Linqin, Purple Sugar Apple, GYSJ-9, Pineapple Sugar Apple, BYSJ-1, BYSJ-2, BYSJ-3, AP Sugar Apple, Honey Treasure Sugar Apple, Durian Sugar Apple, Green Diamond Sugar Apple, GYSJ-1, GYSJ-6, Zhanglin Linqin, Purple Sugar Apple, GYSJ-9, Pineapple Sugar Apple, BYSJ-1, BYSJ-2, BYSJ-3, AP Sugar Apple, Honey Treasure Sugar Apple, Durian Sugar Apple, Green Diamond Sugar Apple, GYSJ-1, GYSJ- There were 25 germplasms including GYSJ-7, GYSJ-8, red-fleshed ox heart pear, white-fleshed ox heart pear and Peruvian sugar apple, which were similar in leaf and flower morphological characteristics; Class II included 7 species including GYSJ-2, GYSJ-3, GYSJ-5, soursop, mountain soursop, smooth sugar apple and yellow dragon sugar apple; Class III included 2 species including large-flowered purple jade plate and purple jade plate; Class IV was GYSJ-10 germplasm clustered into a separate class; Class V was False Eagle Claw germplasm clustered into a separate class. Class I can be divided into 5 subclasses at the level of genetic similarity coefficient of 0.710. The genetic relationship between each subclass is relatively close. Subclass 1 includes 11 germplasms, including Taidong No. 1, Taidong No. 2, Jinwang Sugar Apple, Vietnamese Sugar Apple, Laos Sugar Apple, Longzhou Sugar Apple, GYSJ-4, GYSJ-6, Zhanglin Linqin, Purple Sugar Apple and GYSJ-9; Subclass 2 includes 8 germplasms, including pineapple sugar apple, BYSJ-1, BYSJ-2, BYSJ-3, AP sugar apple, honey treasure sugar apple, durian sugar apple and green diamond sugar apple; Subclass 3 includes 3 germplasms, including GYSJ-1, GYSJ-7 and GYSJ-8; Subclass 4 includes red meat ox heart pear and white meat ox heart pear; Subclass 5 is clustered into a separate class with Peruvian sugar apple, the results are shown in the figure. Figure 1 .

[0057] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principle of the present invention should be included in the protection scope of the present invention.

Claims

1. A molecular marker primer kit for identifying Annona custardii germplasm resources, characterized in that: It includes primer pairs AT-SSR-105, AT-SSR-114 and AT-SSR-115, wherein the sequence information of AT-SSR-105 is shown in SEQ NO.1 and SEQ NO.2, the sequence information of AT-SSR-114 is shown in SEQ NO.3 and SEQ NO.4, and the sequence information of AT-SSR-115 is shown in SEQ NO.5 and SEQNO.

6.

2. Identify the SSR molecular marker primer composition of Annona custardii germplasm resources, characterized by: The composition is a combination of primer pairs AT-SSR-105, AT-SSR-114 and AT-SSR-115.

3. A method for identifying the traits of sugar apple germplasm resources using the molecular marker primer composition of claim 2, wherein the steps include: (1) Primer synthesis: synthesizing the three primer pairs described in claim 1; (2) Extracting genomic DNA from the tested custard apple germplasm samples; (3) using the genomic DNA extracted in step (1) as a template for PCR amplification, wherein the upstream primer of the primer pair used for PCR amplification is modified with a bioluminescent group; (4) Performing electrophoresis on the PCR amplification product obtained in step (3) and collecting data; (5) Statistically analyzing the genetic diversity or clustering and polymorphic information content of the sugar apple resource population based on the data obtained in step (4).

4. The method for identifying the traits of sugar apple germplasm resources using a molecular marker primer combination as claimed in claim 3, characterized in that: The germplasm resource traits include leaf length, fruit size, and plant height.

5. A molecular marker for identifying the traits of Annona custardii germplasm resources, characterized in that: The DNA sequence after amplification is obtained by using the primer pair AT-SSR-105, AT-SSR-114 and AT-SSR-115 described in claim 1, and is shown in SEQ NO. 6~9, which is a microsatellite marker.

6. A sugar apple molecular marker database, characterized in that: Comprising the molecular marker according to claim 5.

7. A clustering map of phylogenetic relationships of custard apple germplasm resources, characterized in that: The following steps are involved: (1) DNA was extracted from the tested sugar apple resource varieties using a DNA kit, and the quality and concentration of the DNA were detected using 1.2% agarose gel electrophoresis and a spectrophotometer; (2) using the three pairs of SSR primers in claim 1, AT-SSR-105, AT-SSR-114 and AT-SSR-115, to perform PCR amplification; (3) Statistical analysis of the characteristics and polymorphic band sizes of the amplified product bands; (4) The UPGMA method was used to cluster the germplasm information obtained in step (1), and the MEGA10.0 software was used to obtain the clustering map of their phylogenetic relationships.

Images