Universal nucleic acid detection method for fusarium

Abstract

The invention discloses a universal nucleic acid detection method for fusarium, which comprises the following steps of: 1, extracting fusarium nucleic acid from a fusarium culture medium by using a fungus genome DNA (Deoxyribonucleic Acid) extraction kit on the market for later use; step 2, primer group preparation: six specific primers are prepared according to specific DNA in fusarium for standby application; 3, reaction liquid preparation: preparing a specific amount of reaction liquid according to the requirement of fusarium detection for later use; the method has the beneficial effects that the isothermal amplification fluorescence detection technology is adopted, and the fusarium is accurately detected by designing six specific primers aiming at the specific DNA of the fusarium, so that the detection time of the fusarium is shortened, the detection efficiency of the fusarium is higher, and the detection cost of the fusarium is lower; the method overcomes the problems of high detection cost, long detection time and the like in the current fusarium detection process, and has great practical application value.

Description

Technical Field

[0001] The invention relates to the technical field of food detection, and in particular to a universal nucleic acid detection method for Fusarium. Background Art

[0002] Fusarium fusarium-induced head blight and root rot are fungal diseases that threaten the safe production of many grain crops, causing reduced grain yields and reduced grain quality. Grains infected by Fusarium in the field can also cause grain deterioration and toxin contamination during storage. Fusarium fusarium completes infection by forming infection structures, synthesizing cell wall degrading enzymes (CWDEs) and toxins to resist host defense responses and destroy plant tissues.

[0003] Early diagnosis and prevention of crop diseases from the time they are not yet onset to the early stage of onset is one of the important means to reduce the incidence and severity of diseases. However, plant root rot caused by Fusarium is highly concealed, and the early symptoms are not obvious. In production, agricultural product growers usually rely on naked eye observation to determine the occurrence of root rot. When the symptoms on the upper part are clearly visible, the root disease is often in the middle and late stages, and the prevention and control measures taken at this time have little effect. Traditional pathogen detection often uses the method of isolating and purifying pathogens from diseased tissues, and then identifying them through morphology and molecular biology and verifying Koch's postulates. This method has a long cycle, low efficiency, and is not conducive to early warning and prevention of diseases.

[0004] Traditional identification methods of Fusarium mainly rely on morphological identification and molecular biological identification. However, morphological identification and molecular biological identification have great limitations. They need to separate, purify and culture the diseased parts of the infected plants, observe the morphology and spore-producing structure of the isolated strains under a microscope, and use molecular biological identification to compare the detection sequences to establish a developmental tree to identify the pathogens. Symptomatic treatment is then carried out, which takes a long time. Fusarium spreads quickly and timeliness is difficult to guarantee. Early diagnosis and early prevention of medicinal plant diseases from the time they are not yet onset to the early stage of onset are one of the important means to reduce the incidence and severity of the disease.

[0005] At present, the main methods for detecting Fusarium include real-time fluorescence PCR technology, recombinase isothermal amplification, mass spectrometry technology, near-infrared spectroscopy technology, etc. Although real-time fluorescence PCR technology makes up for the shortcomings of traditional PCR technology that are prone to cross-contamination leading to false positive results and time-consuming, it has disadvantages such as susceptibility to DNA degradation and complex matrix interference with detection results; the recombinase isothermal amplification method has a fixed reaction system and is not very practical; the mass spectrometry technology has a cumbersome pre-treatment process and cannot meet the needs of rapid detection. Summary of the invention

[0006] The purpose of the present invention is to provide a universal nucleic acid detection method for Fusarium in order to solve the above problems.

[0007] The present invention achieves the above-mentioned purpose through the following technical solutions:

[0008] A universal nucleic acid detection method for Fusarium, comprising the following steps:

[0009] Step 1: Sample preparation: Use a commercially available fungal genomic DNA extraction kit to extract Fusarium nucleic acid from Fusarium culture medium for later use;

[0010] Step 2: Primer set preparation: prepare six specific primers according to the specific DNA in Fusarium for future use;

[0011] Step 3: Preparation of reaction solution: prepare a specific amount of reaction solution according to the needs of Fusarium detection and set aside;

[0012] Step 4: Add the extracted Fusarium nucleic acid, primer set and reaction solution into a clean container in turn and mix them. After the mixture is fully mixed, put it into the isothermal amplification fluorescence detection system GenieII for real-time amplification and detection. The detection result of Fusarium is judged by observing the amplification curve and the dissolution curve.

[0013] Furthermore, the Fusarium culture medium in step 1 is potato dextrose medium (PDA), and the nucleic acid extraction reagent used when extracting nucleic acid in step 1 is a commercially available fungal genomic DNA extraction kit.

[0014] Furthermore, the six specific primers in step 2 are: F3 upstream external primer: GGAGTGTTATAGCCCGTTG; B3 downstream external primer: CTACACAGGCATAGTTCACC; FIP upstream internal primer: GAACACTCGCATACGAAGACGACTGGCGTAATGGTCATCAA; BIP downstream internal primer: AAGTGAACGCAGGTGAGAGCCTTACTCAAATCCATCCGAGAA; LOOPF upstream loop primer: CTCCTTGGTCCGTGTTTCA; LOOPB downstream loop primer: CATCATCGACCGATCCTGAT.

[0015] Furthermore, the amount of the total reaction system in step 4 is 25 μl.

[0016] Furthermore, the reaction solution in step 3 was purchased from Mix reaction solution of Optigene Company, UK.

[0017] Furthermore, in step 4, when mixing the liquids, 15 μl of the reaction solution, 1 μl of each of the six primers, and 4 μl of the nucleic acid extract are first added.

[0018] Furthermore, the amplification parameters in step 4 are: 65°C amplification for 30 minutes; melting curve temperature is 80-98°C; 0.05°C is one cycle.

[0019] Furthermore, the method for determining the experimental results is as follows: according to the amplification curve and the melting curve, the amplification curve appears within 30 minutes, is obviously "S"-shaped, and the melting curve peak is single and sharp, which is determined as a positive result; the amplification curve does not show an obvious "S" shape, which is determined as a negative result; the "S"-shaped amplification curve appears for more than 30 minutes, which is determined as an invalid result; the amplification curve has an obvious "S" curve, but the melting curve has a mixed peak, which is determined as non-specific amplification. If the test result of the negative control is a negative result, then this experiment is considered valid, otherwise this experiment is invalid.

[0020] Furthermore, the present invention simultaneously detects Fusarium and Salmonella, and the results show that only Fusarium is specifically amplified, with a peak time within 20 minutes, while other samples are not amplified until one hour later, indicating that the system and primers used in the present invention only perform specific detection on Fusarium.

[0021] The beneficial effects of the present invention are:

[0022] The present invention adopts isothermal amplification fluorescence detection technology and designs six specific primers for the specific DNA of Fusarium to accurately detect Fusarium. It not only shortens the detection time of Fusarium, making the detection efficiency of Fusarium higher, but also makes the detection cost of Fusarium lower, overcoming the problems of high detection cost and long detection time in the current Fusarium detection process, and has great practical application value. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 This is an "S" type amplification curve diagram of isothermal amplification fluorescence detection in a universal nucleic acid detection method for Fusarium described in the present invention;

[0024] Figure 2 This is a melting curve diagram of isothermal amplification fluorescence detection in the universal nucleic acid detection method for Fusarium described in the present invention. DETAILED DESCRIPTION

[0025] A universal nucleic acid detection method for Fusarium, comprising the following steps:

[0026] Step 1: Sample preparation: Use a commercially available fungal genomic DNA extraction kit to extract Fusarium nucleic acid from Fusarium culture medium for later use;

[0027] Step 2: Primer set preparation: prepare six specific primers according to the specific DNA in Fusarium for future use;

[0028] Step 3: Preparation of reaction solution: prepare a specific amount of reaction solution according to the needs of Fusarium detection and set aside;

[0029] Step 4: Add the extracted Fusarium nucleic acid, primer set and reaction solution into a clean container in turn and mix them. After the mixture is fully mixed, put it into the isothermal amplification fluorescence detection system GenieII for real-time amplification and detection. The detection result of Fusarium is judged by observing the amplification curve and the dissolution curve.

[0030] In this embodiment, the Fusarium culture medium in step 1 is potato dextrose medium (PDA), and the nucleic acid extraction reagent used when extracting nucleic acid in step 1 is a commercially available fungal genomic DNA extraction kit.

[0031] In this embodiment, the six specific primers in step 2 are: F3 upstream external primer: GGAGTGTTATAGCCCGTTG; B3 downstream external primer: CTACACAGGCATAGTTCACC; FIP upstream internal primer: GAACACTCGCATACGAAGACGACTGGCGTAATGGTCATCAA; BIP downstream internal primer: AAGTGAACGCAGGTGAGAGCCTTACTCAAATCCATCCGAGAA; LOOPF upstream loop primer: CTCCTTGGTCCGTGTTTCA; LOOPB downstream loop primer: CATCATCGACCGATCCTGAT.

[0032] In this embodiment, the amount of the total reaction system in step 4 is 25 μl.

[0033] In this embodiment, the reaction solution in step 3 was purchased from Mix reaction solution of Optigene Company, UK.

[0034] In this embodiment, when mixing the liquids in step 4, 15 μl of the reaction solution, 1 μl of each of the six primers, and 4 μl of the nucleic acid extract are first added.

[0035] In this embodiment, the amplification parameters in step 4 are: 65°C amplification for 30 minutes; melting curve temperature is 80-98°C; 0.05°C is one cycle.

[0036] In this embodiment, the method for determining the experimental results is as follows: judging according to the amplification curve and the melting curve, if the amplification curve appears within 30 minutes and is an obvious "S" shape, and the melting curve peak is single and sharp, it is determined as a positive result; if the amplification curve does not show an obvious "S" shape, it is determined as a negative result; if the "S"-shaped amplification curve appears for more than 30 minutes, it is determined as an invalid result; if the amplification curve has an obvious "S"-shaped curve, but the melting curve has a miscellaneous peak, it is determined as non-specific amplification. If the detection result of the negative control is a negative result, then this experiment is considered valid, otherwise this experiment is invalid.

[0037] In this embodiment, the present invention simultaneously detects Fusarium and Salmonella, and the results show that only Fusarium is specifically amplified, with a peak time within 20 minutes, while other samples are not amplified until one hour later, indicating that the system and primers used in the present invention only perform specific detection on Fusarium.

[0038] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principle of the present invention should be included in the protection scope of the present invention.

Claims

1. A universal nucleic acid detection method for Fusarium, characterized in that: It includes the following steps: Step 1: Sample preparation: Use a commercially available fungal genomic DNA extraction kit to extract Fusarium nucleic acid from Fusarium culture medium for later use; Step 2: Primer set preparation: prepare six specific primers according to the specific DNA in Fusarium for future use; Step 3: Preparation of reaction solution: prepare a specific amount of reaction solution according to the needs of Fusarium detection and set aside; Step 4: Add the extracted Fusarium nucleic acid, primer set and reaction solution into a clean container in turn and mix them. After the mixture is fully mixed, put it into the isothermal amplification fluorescence detection system GenieII for real-time amplification and detection. The detection result of Fusarium is judged by observing the amplification curve and the dissolution curve.

2. A universal nucleic acid detection method for Fusarium according to claim 1, characterized in that: The Fusarium culture medium in step 1 is potato dextrose medium (PDA), and the nucleic acid extraction reagent used when extracting nucleic acid in step 1 is a commercially available fungal genomic DNA extraction kit.

3. A universal nucleic acid detection method for Fusarium according to claim 1, characterized in that: The six specific primers in the step 2 are: F3 upstream external primer: GGAGTGTTATAGCCCGTTG; B3 downstream external primer: CTACACAGGCATAGTTCACC; FIP upstream internal primer: GAACACTCGCATACGAAGACGACTGGCGTAATGGTCATCAA; BIP downstream internal primer: AAGTGAACGCAGGTGAGAGCCTTACTCAAATCCATCCGAGAA; LOOPF upstream loop primer: CTCCTTGGTCCGTGTTTCA; LOOPB downstream loop primer: CATCATCGACCGATCCTGAT.

4. A universal nucleic acid detection method for Fusarium according to claim 1, characterized in that: The amount of the total reaction system in step 4 is 25 μl.

5. A universal nucleic acid detection method for Fusarium according to claim 1, characterized in that: The reaction solution in step 3 was purchased from Mix reaction solution of Optigene Company, UK.

6. A universal nucleic acid detection method for Fusarium according to claim 1, characterized in that: In step 4, when mixing the liquids, first add 15 μl of the reaction solution, 1 μl of each of the six primers, and 4 μl of the Fusarium nucleic acid extract.

7. A universal nucleic acid detection method for Fusarium according to claim 1, characterized in that: The amplification parameters in step 4 are: 65°C amplification for 30 minutes; melting curve temperature is 80-98°C; and each 0.05°C is one cycle.

Images