Specific primer combination for identifying desert cistanche seed adulteration, kit and application

Abstract

The invention discloses a specific primer combination for identifying desert cistanche seed adulteration, a kit and application, and belongs to the technical field of plant molecular biology detection. The specific primer combination for identifying the adulteration of the desert cistanche seeds comprises a forward primer as shown in SEQ ID NO.1, a reverse primer as shown in SEQ ID NO.5 and a reverse primer as shown in SEQ ID NO.6. The invention further discloses a method for identifying the adulteration of the desert cistanche seeds. By detecting the genome DNA of the desert and cistanche tubulosa seeds, the sample of the desert cistanche tubulosa seeds doped with the cistanche tubulosa seeds can be identified, the benefit of cistanche growers and the quality of cistanche medicinal materials are guaranteed, and technical reference is provided for standardized management of the traditional Chinese medicinal material seeds. The identification method disclosed by the invention is simple, convenient and efficient, can be realized by adopting simple PCR amplification and polyacrylamide gel electrophoresis, can detect the adulteration rate greater than or equal to 0.6%, is high in detection sensitivity, and is a method capable of identifying seed adulteration in a high-throughput and standardized manner.

Description

Technical Field

[0001] The invention belongs to the technical field of plant molecular biology detection, and particularly relates to a specific primer combination, a kit and an application for identifying adulteration of desert cistanche deserticola seeds. Background Art

[0002] Cistanche deserticola Deserticola YC Ma) and Cistanche tubulosa ( Cistanche tubulosa (Schenk) Wight) is a perennial parasitic plant of the genus Cistanche in the family Orobanchaceae. Both are the basal plants of the traditional Chinese medicine Cistanche specified in the Chinese Pharmacopoeia. However, there are certain differences between the two. Desert Cistanche has a higher sugar content and a soft texture, so it is called "soft big Yun". Its host is Haloxylon ammodendron, and it is produced in Inner Mongolia, Qinghai and other places; while Cistanche tubulosa has a hard texture and is called "hard big Yun". Its host is Tamarix multibranched, and it grows in southern Xinjiang. Due to its low yield and its inclusion in the food and medicine homology catalog in 2023, Desert Cistanche is generally more expensive than Cistanche tubulosa, and the price difference is large, about 10 times. The seeds of Desert Cistanche and Tubulosa are similar in appearance, and it is difficult to distinguish them based on the experience of growers alone. Due to the different hosts of the two, adulteration will lead to a lower parasitic rate of Cistanche, and inexperienced growers cannot distinguish them with the naked eye.

[0003] Chinese herbal medicine seeds are the source of the Chinese herbal medicine industry and the fundamental guarantee for the yield, quality and efficacy of Chinese medicine. However, at present, there is a lack of relevant management laws and regulations for Chinese herbal medicine seeds. In view of the problem of mixed sales of desert Cistanche tubulosa seeds, it is urgent to develop a seed identification method that can be operated with high throughput and standardized to provide necessary guarantees for the interests of Cistanche growers and the quality of Cistanche medicinal materials. Summary of the invention

[0004] In view of the problem that desert Cistanche seeds are adulterated with Cistanche tubulosa and there is a lack of relevant management regulations, the present invention provides a specific primer combination, a kit and an application for identifying the adulteration of desert Cistanche seeds, which can be operated in a high-throughput and standardized manner, are simple and easy to operate, provide a reliable basis at the molecular level for the identification of desert Cistanche seeds, and have important application value for ensuring the quality of Cistanche medicinal materials.

[0005] The present invention is achieved through the following technical solutions: A specific primer combination for identifying adulteration of desert cistanche deserticola seeds comprises a forward primer shown in SEQ ID NO.1, a reverse primer shown in SEQ ID NO.5 and a reverse primer shown in SEQ ID NO.6.

[0006] A kit for identifying adulteration of desert Cistanche deserticola seeds comprises the forward primer shown in SEQ ID NO.1, the reverse primer shown in SEQ ID NO.5 and the reverse primer shown in SEQ ID NO.6.

[0007] Furthermore, the kit for identifying adulteration of Cistanche deserticola seeds also includes 2×Premix Taq and ddH2O.

[0008] The above-mentioned reagent kit for identifying adulteration of desert Cistanche deserticola seeds is used in identifying adulteration of desert Cistanche deserticola seeds to identify whether desert Cistanche deserticola seeds are adulterated with Cistanche tubulosa.

[0009] Further, the method for identifying adulteration of desert Cistanche deserticola seeds comprises the following steps: (1) Extracting genomic DNA from the Cistanche deserticola seeds to be tested; (2) using the genomic DNA extracted in step (1) as a template, PCR amplification was performed using a kit for identifying adulteration of Cistanche deserticola seeds; (3) The amplified product of step (2) is subjected to non-denaturing polyacrylamide gel electrophoresis, and the type of Cistanche deserticola seeds is identified based on the band size.

[0010] Furthermore, the total volume of the PCR amplification in step (2) is 20 μL, including 1 μL of genomic DNA, 1 μL of the forward primer shown in SEQ ID NO.1, 1 μL of the reverse primer shown in SEQ ID NO.5, 1 μL of the reverse primer shown in SEQ ID NO.6, 10 μL of 2×Premix Taq, and the balance is ddH2O.

[0011] Furthermore, the reaction conditions for PCR amplification in step (2) are: pre-denaturation at 95°C for 5 min; 35 cycles of 95°C for 30 s, 53°C for 30 s, and 72°C for 30 s; and extension at 72°C for 5 min.

[0012] Furthermore, the formulation of the agarose gel in the non-denaturing polyacrylamide gel electrophoresis in step (3) is as follows: every 1011 mL includes 200 mL of 40% wt acrylamide (acrylamide:bisacrylamid = 39:1), 200 mL of 5×TBE, 600 mL of ddH2O, 10 mL of 20 wt% ammonium persulfate and 1 mL of TEMED.

[0013] Furthermore, in step (3), when a characteristic band of 182 bp is obtained by amplification, the sample to be tested is determined to be Cistanche deserticola seeds; when a characteristic band of 206 bp is obtained by amplification, the sample to be tested is determined to be Cistanche tubulosa seeds; when characteristic bands of 182 bp and 206 bp are obtained by amplification at the same time, it indicates that the Cistanche deserticola seeds are mixed with Cistanche tubulosa seeds.

[0014] The beneficial effects achieved by the present invention are: The invention designs a specific primer combination for identifying adulteration of desert Cistanche deserticola seeds. By detecting genomic DNA of desert Cistanche deserticola seeds and Cistanche tubulosa seeds, the invention can identify samples of desert Cistanche deserticola seeds mixed with Cistanche tubulosa seeds, thereby protecting the interests of Cistanche deserticola growers and the quality of Cistanche deserticola medicinal materials, and providing a technical reference for the standardized management of Chinese medicinal material seeds. The identification method is simple and efficient, and can be achieved by simple PCR amplification and polyacrylamide gel electrophoresis. The invention can detect an adulteration rate of ≥0.6%, and has high detection sensitivity. The invention is a method for identifying seed adulteration in a high-throughput and standardized manner. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] Figure 1 The ITS sequence comparison analysis results of Cistanche deserticola seeds and Cistanche tubulosa seeds, where the boxes represent InDel and two SNP difference sites, and the horizontal lines represent the positions of the forward and reverse primers of the specific primer combination; Figure 2 This is the electrophoresis result of PCR amplification of different adulteration ratios of Cistanche deserticola seeds and Cistanche tubulosa seeds. DETAILED DESCRIPTION

[0016] In order to enable those skilled in the art to better understand the technical solution of the present invention, the technical solution of the present invention is clearly and completely described below. Based on the embodiments in this application, other similar embodiments obtained by ordinary technicians in this field without making any creative work should all fall within the scope of protection of this application.

[0017] Example 1 ITS sequence acquisition of Cistanche deserticola seeds and Cistanche tubulosa seeds (1) Extraction of genomic DNA from Cistanche deserticola seeds Seeds of Cistanche deserticola and Cistanche tubulosa were collected from planting bases in Inner Mongolia and Xinjiang respectively, identified as Cistanche deserticola seeds and Cistanche tubulosa seeds by researchers from Shandong Academy of Traditional Chinese Medicine, and stored in a cold storage at 4°C; 100 mg of Cistanche deserticola seeds were weighed in a mortar, cryogenically frozen and ground with liquid nitrogen, and the seed genomic DNA was extracted using the Tiangen Plant Genomic DNA Kit.

[0018] (2) ITS fragment amplification The DNA of Cistanche deserticola was amplified using ITS universal primers. The sequences of the upstream primer (ITS-F) and the downstream primer (ITS-R) of the ITS universal primers are shown in SEQ ID NO.1 and SEQ ID NO.2, respectively: SEQ ID NO.1 (ITS-F): 5'-TCCTCCGCTTATTGATATGC-3'; SEQ ID NO.2 (ITS-R): 5'-GGAAGTAAAAGTCGTAACAAGG-3'; The PCR amplification program was 95°C pre-denaturation for 5 min; 95°C for 30 s, 55°C for 30 s, and 72°C for 1.0 min, 35 cycles; extension at 72°C for 7 min; The PCR amplification system was as follows: 1 μL DNA template, 1 μL forward primer and 1 μL reverse primer, 10 μL 2× PrimeSTAR MAXPremix, and 7 μL ddH2O; Agarose gel electrophoresis showed that the size of the amplified fragment was about 700 bp, which was in line with expectations.

[0019] (3) ITS fragment sequencing The PCR products obtained by amplification were sequenced, and the sequencing primers were the same as the PCR amplification primers; after sequence splicing, the inaccurate fragments at both ends were removed to obtain the ITS sequences of Cistanche deserticola seeds and Cistanche tubulosa seeds, respectively. The nucleotide sequences are shown in SEQ ID NO.3 and SEQ ID NO.4, respectively, and the lengths are 669 bp and 672 bp, respectively; SEQ ID NO.3: TCCTCCGCTTATTGATATGCTTAAACTCAGCGGGTAGTCCCGCCTGACCTGGGGTCGCGGTCAAAAGCGTGAATATATCACACCATTGGGTATGCGATAATGTCTACCATTCGACGCCATACGTCACAACAGCACGAGAGTTGAGAGTTCAACCACCACTGGTCGTGACGTGAGTCGCCGCAGGATCTCATTTAGGCCGGCCGCACATCAATAATGCACGGGAGGCCATTGTCCGCCCCCACCTAAGTATCACCCTAAAGGGACGGGAGGGGAGCGACGCGATGCGTGACGCCCAGGCAGACGTGCCCTTGGCCAAAAGGCTTCGGGCGCAACTTGCGTTCAAAGACTCGATGGTTCACGGGATTCTGCAATTCACACCAAGTATCGCATTTCGCTACGTTCTTCATCGATGCGAGAGCCGAGATATCCGTTGCCGAGAGTCGTTTTGACATTGGAGATTCATCCTCTTCCCCCAAATCACCGCGAACGGGACAGGGGAGGTGGACGCTTCATGAGTAATCCTTGGCGCATTCCGCGCCGGGGTTCGTTAGCCCGCACAACACCCACCATGGTGAGAGCATGCAGGGAGGGGGATGCGACGAGAGATTGCCCCCGCCGCAATCCCAATGTGATTATACATGTTCGCGGTTTGCTTCTACAGGATTCGAC; SEQ ID NO.4: .

[0020] Example 2 ITS sequence alignment, differential site analysis and specific primer design between Cistanche deserticola seeds and Cistanche tubulosa seeds (1) Analysis of ITS differential loci between Cistanche deserticola seeds and Cistanche tubulosa seeds The multiple sequence alignment software tool DNAMAN was used to compare the ITS sequences of Cistanche deserticola seeds and Cistanche tubulosa seeds. Figure 1 As shown in Table 1, a large number of differential sites were found between the two, among which there was an InDel site at 145 bp of CD-ITS, with a deletion of 5 bases "TTGAG"; there were two SNP differential sites at 165 bp and 173 bp respectively; the key differential sites of ITS sequences of C. deserticola seeds and C. tubulosa seeds are shown in Table 1. Figure 1 The boxes in the middle indicate the InDel and two SNP difference sites, and the horizontal lines indicate the positions of the forward and reverse primers of the specific primer combination.

[0021] Table 1 Key differential sites in ITS sequences between Cistanche deserticola seeds and Cistanche tubulosa seeds

[0022] (2) Design of TS-specific primer combinations for Cistanche deserticola seeds and Cistanche tubulosa seeds In order to distinguish the seeds of C. deserticola from those of C. tubulosa, two reverse specific primers of unequal length, CD-R1 (SEQ ID NO.5) and CT-R2 (SEQ ID NO.6), were designed to pair with the two SNP difference sites of 165 bp and 173 bp in the ITS sequence of C. deserticola and C. tubulosa, respectively. When used with the ITS-F forward primer, a 5 bp InDel difference fragment can be amplified. In order to effectively distinguish, a 20 bp fragment (lowercase letters) was added to the CT-R2 primer to further expand the difference of PCR products. The specific primer sequences of the specific primer combination for distinguishing the seeds of C. deserticola and C. tubulosa are as follows: SEQ ID NO.1 (ITS-F): 5'-TCCTCCGCTTATTGATATGC-3'; SEQ ID NO.5 (CD-R1): 5'-TGCGGCGACTCACGTCAC-3'; SEQ ID NO.6 (CT-R2): 5'-aggtaacgccagggttttccTGCGGCGATGCACGTCGT-3'; The specific primer combination was amplified by PCR to obtain a 182 bp fragment in the seeds of Cistanche deserticola and a 206 bp fragment in the seeds of Cistanche tubulosa, with a difference of 24 bp. The nucleotide sequences are shown in SEQ ID NO.7 and SEQ ID NO.8, respectively: SEQ ID NO.7: TCCTCCGCTTATTGATATGCTTAAACTCAGCGGTAGTCCCGCCTGACCTGGGGTCGCGGTCAAAAGCGTGAATATATCACACCATTGGGTATGCGATAATGTCTACCATTCGACGCCATACGTCACAACAGCACGAGAGTTGAGAGTTCAACCACTGGTCGTGACGTGAGTCGCCGCA; SEQ ID NO.8: TCCTCCGCTTATTGATATGCTTAAACTCAGCGGGTAGTCCCGCCTGACCTGGGGTCGCGTCGAAAGCGCAAAATAGATCGCACGATTGGGTATGCAATAATCCCACCGCACAACGCCAAACGTCACAACGACACGAGAGTTGAGTTGAGAGTTCAACCACCACTGGTCACGACGTGCATCGCCGCAggaaaaccctggcgttacct.

[0023] Example 3 Identification of adulteration of Cistanche deserticola seeds with Cistanche tubulosa seeds using specific primer combinations (1) Samples of Cistanche deserticola seeds and Cistanche tubulosa seeds with different adulteration rates (as shown in Table 2 below) were prepared, and genomic DNA of the samples was extracted using the Tiangen Plant Genomic DNA Kit in the same manner as in Example 1; Table 2 Samples of desert and Cistanche tubulosa seeds with different adulteration rates .

[0024] (2) PCR amplification was performed on different samples using the specific primer combination (SEQ ID NO.1, SEQ ID NO.5 and SEQ ID NO.6) for distinguishing between Cistanche deserticola seeds and Cistanche tubulosa seeds described in Example 2: The reaction system for PCR amplification was as follows: 1 μL DNA template, 1 μL each of the forward primer SEQ ID NO.1 and the reverse primers SEQ ID NO.5 and SEQ ID NO.6, 10 μL 2×Premix Taq, and 6 μL ddH2O; The reaction conditions for PCR amplification were as follows: pre-denaturation at 95°C for 5 min; 35 cycles of 95°C for 30 s, 53°C for 30 s, and 72°C for 30 s; and extension at 72°C for 5 min.

[0025] (3) PCR amplification products were detected by 8% non-denaturing polyacrylamide gel electrophoresis 8% non-denaturing polyacrylamide gel premix: Each 1011 mL includes 40% acrylamide (acrylamide:bisacrylamid = 39:1) 200 mL, 5×TBE 200 mL, ddH2O 600 mL, 20wt% ammonium persulfate 10 mL and TEMED 1 mL; the formula of 5×TBE 1000 mL is Tris 54 g, boric acid 27.5 g, 0.5 mol / L EDTA 20 mL, pH 8.0.

[0026] The method of non-denaturing polyacrylamide gel electrophoresis is as follows: a. Prepare 10 mL of backing solution (take 10 mL of premixed solution, add 100 µL of 20% ammonium persulfate and 10 µL of TEMED), pour into two tightly screwed special glass plates, and wait for the glue to polymerize completely; b. Prepare 40 mL of sealing solution (take 40 mL of premixed solution, add 400 µL of 20% ammonium persulfate and 40 µL of TEMED), slowly pour it into the middle of the glass plate from the top, and quickly insert the comb. The comb should not be inserted too deep, and wait until the glue is completely polymerized; c. After gelation, gently pull out the comb, rinse the residual gel above the comb hole with deionized water, put the gel plate into the electrophoresis tank, and add 1×TBE electrophoresis buffer; d. Add 2~3 µL of sample to each gel well and add DL 2000 DNA marker to distinguish the band size; e. Turn on the power of the electrophoresis apparatus and run the electrophoresis at 240 V for about 2 min. After the two DNA marker bands are separated, adjust the voltage to 150 V and run the electrophoresis for 3.5 h.

[0027] The silver staining method is as follows: a. Weigh 0.5 g of silver nitrate and dissolve it in 500 mL of deionized water to make a 0.1% silver nitrate solution. Stain the gel for 15 minutes. b. Rapidly rinse with deionized water for 30 s; c. Prepare 500 mL of developer (500 mL of deionized water + 10 g NaOH + 0.2-0.3 g Na2CO3, add 750 µL of formaldehyde before use), and develop the stained polyacrylamide gel for about 15 min, shaking continuously until the DNA bands are clearly visible; d. Rinse twice with deionized water; e. Observe and take photos. The results are as follows Figure 2 shown.

[0028] Depend on Figure 2 It can be seen that the 182 bp characteristic band in the electrophoresis results is the ITS fragment of Cistanche deserticola seeds, and the 206 bp characteristic band is the ITS fragment of Cistanche tubulosa seeds. When the sample adulteration rate is 0.1% and 0.3%, the Cistanche tubulosa seed band cannot be detected, while the Cistanche tubulosa seed band can be detected when the DT-3~DT-8 sample adulteration rate is greater than or equal to 0.6%, indicating that this specific primer combination can detect samples of Cistanche tubulosa seeds with an adulteration rate of ≥0.6% of Cistanche deserticola seeds, and the detection sensitivity is high.

[0029] The embodiments described above are only descriptions of the preferred modes of the present invention, and are not intended to limit the scope of the present invention. Without departing from the design spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by ordinary technicians in this field should all fall within the protection scope determined by the claims of the present invention.

Claims

1. A specific primer combination for identifying adulteration of desert Cistanche deserticola seeds, characterized in that: It includes a forward primer shown in SEQ ID NO.1, a reverse primer shown in SEQ ID NO.5 and a reverse primer shown in SEQ ID NO.

6.

2. A kit for identifying adulteration of desert Cistanche deserticola seeds, characterized in that: It comprises the forward primer shown in SEQ ID NO.1, the reverse primer shown in SEQ ID NO.5 and the reverse primer shown in SEQ ID NO.6 as described in claim 1.

3. The kit for identifying adulteration of Cistanche deserticola seeds according to claim 2, characterized in that: The kit for identifying adulteration of desert Cistanche deserticola seeds also includes 2×Premix Taq and ddH2O.

4. Use of the kit for identifying adulteration of desert Cistanche deserticola seeds according to claim 2 or 3 in identifying adulteration of desert Cistanche deserticola seeds, characterized in that: Identify whether the seeds of Cistanche deserticola are adulterated with Cistanche tubulosa.

5. Use of the kit for identifying adulteration of desert Cistanche deserticola seeds according to claim 4 in identifying adulteration of desert Cistanche deserticola seeds, characterized in that: The method for identifying adulteration of desert cistanche seeds comprises the following steps: (1) Extracting genomic DNA from the Cistanche deserticola seeds to be tested; (2) using the genomic DNA extracted in step (1) as a template, PCR amplification was performed using a kit for identifying adulteration of Cistanche deserticola seeds; (3) The amplified product of step (2) is subjected to non-denaturing polyacrylamide gel electrophoresis, and the type of Cistanche deserticola seeds is identified based on the band size.

6. Use of the kit for identifying adulteration of desert Cistanche deserticola seeds according to claim 5 in identifying adulteration of desert Cistanche deserticola seeds, characterized in that: The total volume of step (2) PCR amplification is 20 μL, including 1 μL of genomic DNA, 1 μL of the forward primer shown in SEQ ID NO.1, 1 μL of the reverse primer shown in SEQ ID NO.5, 1 μL of the reverse primer shown in SEQ ID NO.6, 10 μL of 2×Premix Taq, and the balance is ddH2O.

7. Use of the kit for identifying adulteration of desert Cistanche deserticola seeds according to claim 5 in identifying adulteration of desert Cistanche deserticola seeds, characterized in that: The reaction conditions for PCR amplification in step (2) were as follows: pre-denaturation at 95°C for 5 min; 35 cycles of 95°C for 30 s, 53°C for 30 s, and 72°C for 30 s; and extension at 72°C for 5 min.

8. Use of the kit for identifying adulteration of desert Cistanche deserticola seeds according to claim 5 in identifying adulteration of desert Cistanche deserticola seeds, characterized in that: The formula of agarose gel in the non-denaturing polyacrylamide gel electrophoresis in step (3) is as follows: every 1011 mL includes 200 mL of 40 wt% acrylamide, 200 mL of 5×TBE, 600 mL of ddH2O, 10 mL of 20 wt% ammonium persulfate and 1 mL of TEMED.

9. Use of the kit for identifying adulteration of desert Cistanche deserticola seeds according to claim 5 in identifying adulteration of desert Cistanche deserticola seeds, characterized in that: In step (3), when a characteristic band of 182 bp is obtained by amplification, the sample to be tested is determined to be Cistanche deserticola seeds; when a characteristic band of 206 bp is obtained by amplification, the sample to be tested is determined to be Cistanche tubulosa seeds; when characteristic bands of 182 bp and 206 bp are obtained by amplification at the same time, it indicates that the Cistanche deserticola seeds are mixed with Cistanche tubulosa seeds.

Images