Pyrimidinone compounds for treatment of acute inflammation

Abstract

The present invention relates to a method of treating an acute inflammatory disease in a subject comprising administering to the subject a therapeutically effective amount of a pyrimidinone compound.

Description

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS

[0002] This application claims the benefit of U.S. Provisional Application No. 63 / 346,193, filed on May 26, 2022, the contents of which are hereby incorporated by reference in their entirety. Technical Field

[0003] The present invention relates to a method of treating an acute inflammatory disease in a subject, comprising administering to the subject a therapeutically effective amount of a pyrimidinone compound. Background Art

[0004] Inflammation is a collection of sequential biological responses of body tissues to noxious stimuli, such as pathogens, damaged cells, or irritants. When tissue damage occurs, whether caused by bacteria, trauma, chemicals, heat, or other phenomena, the damaged tissue releases histamine and other humoral substances into the surrounding fluid and initiates the vascular phase of acute inflammation. This is a protective adaptive mechanism taken by the body to remove the noxious stimulus and initiate the healing process.

[0005] There are two forms of inflammation, commonly referred to as acute inflammation and chronic inflammation. Acute inflammation is the body's initial response to harmful stimuli and is achieved by increased movement of plasma and white blood cells from the blood that flow into the injured tissue. Acute inflammation can be divided into several stages. The earliest event in the inflammatory response is temporary vasoconstriction, a narrowing of the blood vessels caused by contraction of the smooth muscles in the blood vessel walls, which can be seen as whitening of the skin (blanching). The next few stages occur after minutes, hours and days. The first is an acute vascular response within seconds of tissue injury and lasts for several minutes. This is due to changes in the vascular endothelium that lead to vasodilation and increased capillary permeability, resulting in increased blood flow (congestion), redness (erythema) and the entry of fluid into the tissue (edema).

[0006] The main features of the vascular phase of the inflammatory response are vasodilation, which is the expansion of blood vessels to increase blood flow to the site of infection; increased vascular permeability allows diffusible components to enter the site; cellular infiltration by chemotaxis; or the directed movement of inflammatory cells (including neutrophils) through the vessel wall into the site of injury; changes in the biosynthetic, metabolic, and catabolic profiles of many organs; and activation of immune system cells and complex enzyme systems in the plasma. This leads to the cellular phase, in which neutrophils are attracted to the site of injury by the presence of chemokines, and then the neutrophils recognize foreign matter and begin to phagocytose it. However, uncontrolled inflammation can lead to many diseases, including acute hepatitis, acute pancreatitis, acute kidney disease, inflammatory bowel disease, inflammatory liver disease, rheumatoid arthritis, autoimmune diseases, sepsis, SIRS, and atherosclerosis.

[0007] The acute cellular response may be followed by an acute vascular response, which occurs within the next few hours. This phase is characterized by the presence of granulocytes, particularly neutrophils, in the tissues. These cells first attach themselves to the endothelial cells within the blood vessels (margination) and then penetrate into the surrounding tissues (diapedesis). During this phase, red blood cells may also infiltrate the tissues and bleeding may occur. If a blood vessel is damaged, fibrinogen and fibronectin are deposited at the site of injury, platelets aggregate and become activated, and red blood cells pile together in a so-called "rouleau" to help stop bleeding and aid clot formation. Dead and dying cells lead to pus formation. If the injury is severe enough, a chronic cellular response may occur over the next few days. This phase of inflammation is characterized by the presence of a mononuclear infiltrate consisting of macrophages and lymphocytes. Macrophages are involved in microbial killing, clearance of cells and tissue debris, and tissue remodeling. Summary of the invention

[0008] The present invention relates to a method for treating an acute inflammatory disease in a subject, comprising administering to the subject a therapeutically effective amount of a compound represented by formula (I):

[0009]

[0010] or a pharmaceutically acceptable salt or tautomer thereof,

[0011] in:

[0012] X is O or OH;

[0013] L is –(CH2)mCH2CH2-, –(CH2)mY(CH2)p-, –(CH2)mC(O)(CH2)p-, –(CH2)mC(O)O(CH2)p-, –(CH2)mC(O)NR 2 (CH2)p-, or -(CH2)mNR 2 C(O)(CH2)p;

[0014] Y is O, N or S(O)q;

[0015] R 1 It is C6-C 10 aryl or heteroaryl, wherein the aryl or heteroaryl is replaced by R a and R b and optionally one or more R e replace;

[0016] R 2 Is H or C6-C 10 alkyl;

[0017] R a and Rb One of them is hydrogen and the other is -(CH2)rCO2R x 、-OCH2CO2R x , -(CH2)r tetrazole, -(CH2)r oxadiazolone, -(CH2)r tetrazolone, -(CH2)r thiadiazolol, -(CH2)r isoxazol-3-ol, -(CH2)r P(O)(OH)OR x , -(CH2)rS(O)2OH, -(CH2)rC(O)NHCN, or -(CH2)rC(O)NHS(O)2alkyl;

[0018] R c H, C1-C6 alkyl, C1-C6 haloalkyl, halogen, –CN, –OR x 、-CO2R x , or NO2;

[0019] R d is methyl, optionally substituted 5- to 10-membered aryl, optionally substituted 5- or 6-membered heteroaryl, or optionally substituted 5- or 6-membered carbocyclic ring;

[0020] Each R x is independently at each occurrence hydrogen or C1-C6 alkyl;

[0021] Each R e are independently C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, halogen, -OR y , C1-C6 haloalkyl, -NHR z , -OH, or -CN;

[0022] R f It is H or not present;

[0023] Each R y and R z are independently hydrogen, C1-C6 alkyl, or C1-C6 haloalkyl;

[0024] Each m and p is independently 0, 1 or 2, where m+p<3;

[0025] q is 0, 1, or 2;

[0026] r is 0 or 1; and

[0027] Dashed lines are optional double bonds;

[0028] Additional conditions: when X is O, L is –SCH2-, and R d When R is an optionally substituted phenyl group, c is not hydrogen or –CN; when X is O, L is –SCH2-, and R dWhen it is methyl, R c is not C1-C6 alkyl; and when X is O, L is –SCH2- and R d When it is 2-furanyl, R c Not –CN.

[0029] The present invention relates to treating acute inflammatory diseases, comprising administering to a subject in need thereof a therapeutically effective amount of a compound, or a pharmaceutically acceptable salt or tautomer thereof, selected from the group consisting of:

[0030]

[0031]

[0032] or a pharmaceutically acceptable salt thereof.

[0033] The present invention relates to treating acute inflammatory diseases, comprising administering to a subject in need thereof a therapeutically effective amount of a compound, or a pharmaceutically acceptable salt or tautomer thereof, selected from the group consisting of:

[0034]

[0035]

[0036] The present invention relates to treating acute inflammatory diseases, comprising administering to a subject in need thereof a therapeutically effective amount of a compound, or a pharmaceutically acceptable salt or tautomer thereof, selected from the group consisting of:

[0037]

[0038] The present invention relates to treating acute inflammatory diseases, comprising administering a therapeutically effective amount of a compound, or a pharmaceutically acceptable salt or tautomer thereof, to a subject in need thereof, wherein the chemical formula is:

[0039]

[0040] The present invention relates to treating acute inflammatory diseases, comprising administering a therapeutically effective amount of a compound, or a pharmaceutically acceptable salt or tautomer thereof, to a subject in need thereof, wherein the chemical formula is:

[0041]

[0042] The present invention relates to treating acute inflammatory diseases, comprising administering a therapeutically effective amount of a compound, or a pharmaceutically acceptable salt or tautomer thereof, to a subject in need thereof, wherein the chemical formula is:

[0043]

[0044] The present invention relates to treating acute inflammatory diseases, comprising administering a therapeutically effective amount of a compound, or a pharmaceutically acceptable salt or tautomer thereof, to a subject in need thereof, wherein the chemical formula is:

[0045]

[0046] In a further aspect, provided herein is a pharmaceutical composition comprising a compound as described herein, or a pharmaceutically acceptable salt or tautomer thereof, and a pharmaceutically acceptable excipient. The present invention relates to treating acute inflammatory diseases, comprising administering a pharmaceutical composition of the present invention to a subject in need thereof.

[0047] The present invention provides a compound of the present invention, and a pharmaceutically acceptable salt or tautomer thereof, or a pharmaceutical composition of the present invention for use in treating an acute inflammatory disease in a subject in need thereof.

[0048] The present invention provides the use of the compounds of the present invention, and pharmaceutically acceptable salts or tautomers thereof, for treating acute inflammatory diseases in a subject in need thereof.

[0049] The present invention provides the compound of the present invention, and use of a pharmaceutically acceptable salt or tautomer thereof in preparing a medicament for treating acute inflammatory diseases. BRIEF DESCRIPTION OF THE DRAWINGS

[0050] Figure 1 The secretion of pro-inflammatory cytokines is shown; tumor necrosis factor α, TNFα, interleukin, IL-1α, IL-1β, and IL-6 in macrophages stimulated with LPS were reduced by short hairpin RNA siACMSD compared to vehicle control.

[0051] Figure 2 The expression of ACMSD and QPRT under inflammatory diseases is shown.

[0052] Figure 3 The expression of QPRT in primary human bone marrow mononuclear cells (BMMC) is shown.

[0053] Figure 4 ACMSD inhibition using Compounds I-17 and I-18 was shown to restore NAD in Kupffer cells, primary hepatocytes, and renal proximal tubule HK2 cells. + of biosynthesis.

[0054] Figure 5 It was shown that ACMSD inhibition using compound 1-18 enhanced the expression of two downstream target genes longevity factors, SIRT-1 in Kupffer cells and SIRT-3 in HK2 primary tubule cells.

[0055] Figure 6 Two compounds, 1-17 and 1-18 (500 nM), were shown to activate SIRT1 in primary hepatocytes 24 hours after treatment.

[0056] Figure 7 It was shown that ACMSD inhibition using compound 1-18 (50 μM) also reversed the decrease in SIRT expression induced by cisplatin injury in HK2 primary tubule cells.

[0057] Figure 8 It was shown that SIRT1 is a core component of the SIRT1 / STAT3 pathway and thus, the expression and activity of SIRT1 induced by ACMSD inhibition using compound I-18 enhanced the expression of signal transducer and activator of transcription 3 (STAT3) in Kupffer cells in a dose-dependent manner.

[0058] Fig. 9 It was shown that ACMSD inhibition using compound 1-18 enhanced the expression of IL-10 in Kupffer cells in a dose-dependent manner, thereby promoting an anti-inflammatory response.

[0059] Fig.10 It was shown that ACMSD inhibition with compounds 1-17 and 1-18 (1 μM) and with compound 1-18 reduced the secretion of the pro-inflammatory cytokine IL-6 in Kupffer cells in a dose-dependent manner following LPS-induced inflammation.

[0060] Fig.11 It was shown that ACMSD inhibition using compounds 1-17 and 1-18 also reduced the secretion of the pro-inflammatory cytokine IL-6 in co-cultured primary hepatocytes and Kupffer cells in a dose-dependent manner following LPS-induced inflammation (50 ng / mL).

[0061] Fig.12 It was shown that ACMSD inhibition using compound 1-18 (5 μM) also reduced LPS-induced IL-6 secretion in human primary bone marrow mononuclear cells (BMMCs).

[0062] Fig.13 It was shown that ACMSD inhibition using compounds 1-17 and 1-18 reduced the secretion of the inflammatory cytokine TNFα in Kupffer cells, BMMC cells, and co-cultured primary hepatocytes and stellate cells after LPS-induced inflammation (50 ng / mL).

[0063] Fig.14It was shown that ACMSD inhibition using compounds I-17 and I-18 (5 μM) reduced the expression of TNFα in co-cultured primary hepatocytes and stellate cells after treatment with a free fatty acid mixture (6 hours after exposure to a mixture of palmitate (0.33 mM) and oleate (0.66 mM)), as well as in ex vivo renal tissue samples in the CLP-induced sepsis mouse model after intraperitoneal injection of 30 mg / kg / dose of compound I-18.

[0064] Fig.15 It was shown that ACMSD inhibition using compounds 1-17 and 1-18 (1 μM) reduced the secretion of the inflammatory cytokine IL-1β in Kupffer cells, as well as co-cultured primary hepatocytes and stellate cells after LPS-induced inflammation (50 ng / mL).

[0065] Fig.16 ACMSD inhibition using compound 1-17 (5 μM) was shown to reduce the expression of IL-1β in co-cultured primary hepatocytes and stellate cells after treatment with a free fatty acid mixture (6 hours after exposure to a mixture of palmitate (0.33 mM) and oleate (0.66 mM)), as well as in ex vivo renal tissue samples in the CLP-induced sepsis mouse model after intraperitoneal injection of 30 mg / kg / dose of compound 1-18.

[0066] Fig.17 It was shown that ACMSD inhibition resulted in decreased expression of MCP1 in ex vivo renal tissue samples in a CLP-induced sepsis mouse model following intraperitoneal injection of 30 mg / kg / dose of compound 1-18.

[0067] Fig.18 It was shown that ACMSD inhibition using compound I-17 or compound I-18 (5 μM) reduced the expression of profibrotic cytokine TGF-β, profibrotic chemokine CTGF, profibrotic gene Bcl-2 associated gene X (BAX), actin α2 (ACTA2), type 1 collagen α1 chain ColIa1, fibronectin, thrombospondin-1 (THBS-1) and tissue inhibitor of metalloproteinase 2 (TIMP2) in co-cultured primary hepatocytes and stellate cells after treatment with a free fatty acid mixture (after exposure to a mixture of palmitate (0.33 mM) and oleate (0.66 mM) for 6 hours).

[0068] Fig.19The anti-fibrotic effect of ACMSD inhibition of transforming growth factor β, TGF-β, was shown to be mediated by the TGFβ / SMAD pathway after TGF-β-induced fibrosis in HK2 cells, as shown by a dose-dependent decrease in maternal anti-hemiplegia homolog 3 (SMAD3) in both prophylactic and therapeutic treatment with compound 1-18.

[0069] Fig. 20 The anti-fibrotic effect of ACMSD inhibition was further demonstrated by the dose-dependent reduction of fibronectin and TIMP2 expression by compound 1-18.

[0070] Fig.21 It was shown that ACMSD inhibition using compounds 1-17 or 1-18 enhanced mitochondrial superoxide dismutase 2 (SOD2) activity in a dose-dependent manner in mouse primary hepatocytes after 24 hours of treatment.

[0071] Fig. 22 It was shown that ACMSD inhibition using compound 1-18 (100 μM) also enhanced the expression of SOD2 and mitochondrial dynamin-like 120 kDa protein (OPA-1) in HK-2 cells after cisplatin injury.

[0072] Fig.23 We showed that ACMSD inhibition using compound I-17 modulated cellular ROS generation and mitochondrial biogenesis (in various cell types) after cisplatin (100 μM) injury, enhanced expression of mitochondrial transcription factor A (TFAM) via SIRT-1 activation in primary hepatocytes, and enhanced expression of the mitochondrial fusion protein OPA-1 via SIRT-3 activation in rat kidney NRK52E cells.

[0073] Fig.24 It was shown that in primary hepatocytes, ACMSD inhibition using compound 1-17 increased the mRNA levels of fatty acid oxidation genes, medium chain acyl-CoA dehydrogenase (Mcad), carnitine palmitoyltransferase 1 (Cpt1α), hydroxyacyl-CoA dehydrogenase (Hadha1), hormone-sensitive lipase (Hsl), pyruvate dehydrogenase lipoamide kinase 4 (Pdk4), and succinate dehydrogenase (Sdha) after 6 hours of exposure to a mixture of palmitate (0.33 mM) and oleate (0.66 mM).

[0074] Fig.25It was shown that ACMSD inhibition using 100 μM of compound 1-18 increased the mRNA levels of mitochondrial and oxidative stress genes, citrate synthase (CS), NDAH ubiquinone oxidoreductase subunit 2 (Ndufa2), cytochrome c oxidase subunit 2 (Cox2), ATP synthase lipid-binding protein (Atp5g1), superoxide dismutase 1 (Sod1), and superoxide dismutase 2 (Sod2).

[0075] Fig.26 It was shown that ACMSD inhibition using compounds 1-17 and 1-18 increased the mRNA levels of mitochondrial genes, TFAM, Ndufa, ubiquinol-cytochrome c reductase core protein 1 (Uqcrc1), CytC, Atp5g1, and CS in mouse primary hepatocytes after 24 hours of treatment.

[0076] Fig. 27 It was shown that the increase in mRNA levels of mitochondrial genes, Sod1, Ndufa2, Cox2, and CytC in HK-2 cells after 24 h of treatment with the ACMSD inhibitor compound 1-18 was SIRT1-dependent and was blocked by inhibition of Sirt1 as shown by treatment with compound 1-18 combined with a SIRT1 inhibitor (EX527) at the indicated concentrations.

[0077] Fig.28 It was shown that administration of ACMSD inhibitor compounds I-17 and I-18 also induced the transcription of mitochondrial genes, medium chain acyl-CoA dehydrogenase (Mcad), carnitine palmitoyltransferase 1 (CptIa), NDAH ubiquinone oxidoreductase subunit 2 (Ndufa2), ATP synthase lipid binding protein (Atp5g1), and superoxide dismutase 2 (Sod2) in the liver, but the expression of the same genes in the kidney was not affected.

[0078] Fig.29 It was shown that ACMSD inhibition using compound 1-17 increased mitochondrial SOD2 expression in primary hepatocytes.

[0079] Fig.30 It was shown that mouse Kupffer cells treated with LPS and compound 1-18 showed a reduction in M1 phenotype gene markers, iNOS, IL-6, and TNFα.

[0080] Fig.31 Corresponding increases in M2 phenotype gene markers, arginase-1, mannose receptor (Mrc-2), and IL-10 were shown.

[0081] Fig.32 Shown are two different stimulations (LPS and IL-4) performed to assess the M2 phenotype. DETAILED DESCRIPTION

[0082] The following description lists many exemplary configurations, methods, parameters, etc. However, it should be recognized that such description is not intended as a limitation on the scope of the present invention, but is provided as a description of exemplary embodiments.

[0083] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by those of ordinary skill in the art to which the invention belongs. In the specification, unless the context clearly stipulates otherwise, the singular also includes the plural. Although methods and materials similar or equivalent to the methods and materials described herein can be used in the practice and testing of the present invention, suitable methods and materials are described below. All publications, patent applications, patents and other references mentioned herein are incorporated by reference. The references cited herein are not considered to be prior art claimed to be disclosed. In the event of a conflict, this specification, including definitions, will dominate. In addition, materials, methods and embodiments are illustrative only and are not intended to be limiting.

[0084] Other features and advantages of the invention will be apparent from the following detailed description, and from the claims.

[0085] The present invention relates to a method of treating an acute inflammatory disease in a subject, comprising administering to the subject a therapeutically effective amount of a pyrimidinone compound.

[0086] Compound

[0087] The present invention relates to compounds of formula (I):

[0088]

[0089] or a pharmaceutically acceptable salt or tautomer thereof,

[0090] in:

[0091] X is O or OH;

[0092] L is –(CH2)mCH2CH2-, –(CH2)mY(CH2)p-, –(CH2)mC(O)(CH2)p-, –(CH2)mC(O)O(CH2)p-, –(CH2)mC(O)NR 2 (CH2)p-, or -(CH2)mNR 2 C(O)(CH2)p;

[0093] Y is O, N or S(O)q;

[0094] R 1 It is C6-C 10 aryl or heteroaryl, wherein the aryl or heteroaryl is replaced by Ra and R b and optionally one or more R e replace;

[0095] R 2 Is H or C6-C 10 alkyl;

[0096] R a and R b One of them is hydrogen and the other is -(CH2)rCO2R x 、-OCH2CO2R x , -(CH2)r tetrazole, -(CH2)r oxadiazolone, -(CH2)r tetrazolone, -(CH2)r thiadiazolol, -(CH2)r isoxazol-3-ol, -(CH2)r P(O)(OH)OR x , -(CH2)rS(O)2OH, -(CH2)rC(O)NHCN, or -(CH2)rC(O)NHS(O)2alkyl;

[0097] R c H, C1-C6 alkyl, C1-C6 haloalkyl, halogen, –CN, –OR x 、-CO2R x , or NO2;

[0098] R d is methyl, optionally substituted 5- to 10-membered aryl, optionally substituted 5- or 6-membered heteroaryl, or optionally substituted 5- or 6-membered carbocyclic ring;

[0099] Each R x is independently at each occurrence hydrogen or C1-C6 alkyl;

[0100] Each R e are independently C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, halogen, -OR y , C1-C6 haloalkyl, -NHR z , -OH, or -CN;

[0101] R f It is H or not present;

[0102] Each R y and R z are independently hydrogen, C1-C6 alkyl, or C1-C6 haloalkyl;

[0103] Each m and p is independently 0, 1 or 2, where m+p<3;

[0104] q is 0, 1, or 2;

[0105] r is 0 or 1; and

[0106] Dashed lines are optional double bonds;

[0107] Additional conditions: when X is O, L is –SCH2-, and R d When R is an optionally substituted phenyl group, c is not hydrogen or –CN; when X is O, L is –SCH2-, and R d When it is methyl, R c is not C1-C6 alkyl; and when L is –SCH2- and R d When it is 2-furanyl, R c Not –CN.

[0108] In certain embodiments, the present invention relates to compounds of formula (I):

[0109]

[0110] or a pharmaceutically acceptable salt or tautomer thereof,

[0111] in:

[0112] X is O or OH;

[0113] L is –(CH2)mCH2CH2-, –(CH2)mY(CH2)p-, –(CH2)mC(O)(CH2)p-, –(CH2)mC(O)O(CH2)p-, –(CH2)mC(O)NR 2 (CH2)p-, or -(CH2)mNR 2 C(O)(CH2)p;

[0114] Y is O, N or S(O)q;

[0115] R 1 It is C6-C 10 aryl or heteroaryl, wherein the aryl or heteroaryl is replaced by R a and R b and optionally substituted by one or more R e replace;

[0116] R 2 Is H or C6-C 10 alkyl;

[0117] R a and R b One of them is hydrogen and the other is -(CH2)rCO2R x 、-OCH2CO2R x, -(CH2)r tetrazole, -(CH2)r oxadiazolone, -(CH2)r tetrazolone, -(CH2)r dihydrotetrazolylone, -(CH2)r thiadiazolol, -(CH2)r isoxazol-3-ol, -(CH2)r P(O)(OH)OR x , -(CH2)rS(O)2OH, -(CH2)rC(O)NHCN, or -(CH2)rC(O)NHS(O)2alkyl;

[0118] R c H, C1-C6 alkyl, C1-C6 haloalkyl, halogen, –CN, –OR x 、-CO2R x , or NO2;

[0119] R d is methyl, optionally substituted 5- to 10-membered aryl, optionally substituted 5- or 6-membered heteroaryl, or optionally substituted 5- or 6-membered carbocyclic ring;

[0120] Each R x is independently at each occurrence hydrogen or C1-C6 alkyl;

[0121] Each R e are independently C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, halogen, -OR y , C1-C6 haloalkyl, -NHR z , -OH, or -CN;

[0122] R f It is H or not present;

[0123] Each R y and R z are independently hydrogen, C1-C6 alkyl, or C1-C6 haloalkyl;

[0124] Each m and p is independently 0, 1 or 2, where m+p<3;

[0125] q is 0, 1, or 2;

[0126] r is 0 or 1; and

[0127] Dashed lines are optional double bonds;

[0128] Additional conditions: when X is O, L is –SCH2-, and R d When R is an optionally substituted phenyl group, c is not hydrogen or –CN; when X is O, L is –SCH2-, and R d When it is methyl, R c is not C1-C6 alkyl; and when L is –SCH2- and R dWhen it is 2-furanyl, R c Not –CN.

[0129] In some embodiments of Formula (I), X is O or OH. In other embodiments, X is O. In other embodiments, X is OH.

[0130] In some embodiments of Formula (I), L is -(CH2) m CH2CH2-, –(CH2) m Y(CH2) p -、-(CH2) m C(O)(CH2) p -、-(CH2) m C(O)O(CH2) p -、-(CH2) m C(O)NR 2 (CH2) p -, or -(CH2) m NR 2 C(O)(CH2) p In other embodiments, L is –CH2CH2-, –CH2CH2CH2-, –SCH2-, –SCH2CH2-, –CH2S-, –CH2SCH2-, –CH2CH2S-, –S(O)CH2-, –S(O)CH2CH2-, –CH2S(O)-, –CH2S(O)CH2-, –CH2CH2S(O)-, –S(O)2CH2-, S(O)2CH2CH2-, –CH2S(O)2-, –CH2S(O)2CH2-, –CH2CH2S(O)2-, –OCH2-, –OCH2CH2-, –CH2O-, –CH2OCH2-, –CH2CH2O-, –NR 2 CH2-, –CH2NR 2 -、-CH2NR 2 CH2-、-CH2CH2NR 2 -、–NR 2 CH2CH2-, -C(O)CH2-, -C(O)CH2CH2-, -C(O)O-, -C(O)OCH2-, -CH2C(O)O-, -C(O)NR 2 -、-C(O)NR 2 CH2-、-NR 2 C(O), -NR 2 C(O)CH2, or -CH2NR 2C(O). In other embodiments, L is –CH2CH2-, –CH2CH2CH2-, –SCH2-, –SCH2CH2-, –S(O)CH2-, –S(O)CH2CH2-, –S(O)2CH2-, –S(O)2CH2CH2-, –OCH2-, –OCH2CH2-, –NR 2 CH2-, –NR 2 CH2CH2-, -C(O)CH2-, -C(O)CH2CH2-, -C(O)O-, -C(O)OCH2-, -CH2C(O)O-, -C(O)NR 2 -、-C(O)NR 2 CH2-、-NR 2 C(O), or -NR 2 In other embodiments, L is -CH2CH2-, -CH2C(O)-, -C(O)CH2-, -NR 2 CH2-、-CH2N R2 -, -OCH2-, -CH2O-, -SCH2-, -CH2S-, -S(O)CH2-, -CH2S(O)-, -CH2S(O)2-, or -S(O)2CH2-.

[0131] In some embodiments of Formula (I), R 1 It is C6-C 10 aryl or heteroaryl, wherein the aryl and heteroaryl are R a and R b and optionally substituted by one or more R e In other embodiments, R 1 Is R a and R b and optionally substituted by one or more R e Substituted C6-C 10 In other embodiments, R 1 Is R a and R b and optionally substituted by one or more R e In a further embodiment, R 1 Is R a and R b and optionally substituted by one or more R e Substituted phenyl.

[0132] In some embodiments of Formula (I), R a Yes - (CH2) r CO2R x 、-OCH2CO2Rx 、-(CH2) r Tetrazolyl, -(CH2) r Oxadiazolone, -(CH2) r Tetrazodone, -(CH2) r Thiadiazole, -(CH2) r Isoxazol-3-ol, -(CH2) r P(O)(OH)OR x 、-(CH2) r S(O)2OH, -(CH2) r C(O)NHCN, or -(CH2) r C(O)NHS(O)2alkyl. In some embodiments of formula (I), R a Yes - (CH2) r CO2R x 、-OCH2CO2R x 、-(CH2) r Tetrazolyl, -(CH2) r Oxadiazolone, -(CH2) r Tetrazodone, -(CH2) r Dihydrotetrazodone, -(CH2) r Thiadiazole, -(CH2) r Isoxazol-3-ol, -(CH2) r P(O)(OH)OR x 、-(CH2) r S(O)2OH, -(CH2) r C(O)NHCN, or -(CH2) r C(O)NHS(O)2alkyl. In other embodiments of formula (I), R a Yes - (CH2) r CO2R x 、-OCH2CO2R x , tetrazole, -(CH2)tetrazole, oxadiazolone, -(CH2)oxadiazolone, tetrazolone, -(CH2)tetrazolone, thiadiazolol, -(CH2)thiadiazolol, isoxazol-3-ol, -(CH2)isoxazol-3-ol, -P(O)(OH)OR x 、-(CH2)P(O)(OH)OR x , -S(O)2OH, -(CH2)S(O)2OH, -C(O)NHCN, -(CH2)C(O)NHCN, -C(O)NHS(O)2alkyl, or -(CH2)C(O)NHS(O)2alkyl. In other embodiments, R a Hydrogen, CO2R x 、CH2CO2R x, tetrazole, or oxadiazolone. In a further embodiment, R a is hydrogen, CO2H, CH2CO2H, tetrazole, or 1,2,4-oxadiazol-5(4H)-one.

[0133] In some embodiments of Formula (I), R b Yes - (CH2) r CO2R x 、-OCH2CO2R x 、-(CH2) r Tetrazolyl, -(CH2) r Oxadiazolone, -(CH2) r Tetrazodone, -(CH2) r Thiadiazole, -(CH2) r Isoxazol-3-ol, -(CH2) r P(O)(OH)OR x 、-(CH2) r S(O)2OH, -(CH2) r C(O)NHCN, or -(CH2) r C(O)NHS(O)2alkyl. In other embodiments, R b Yes - (CH2) r CO2R x 、-OCH2CO2R x , tetrazole, -(CH2)tetrazole, oxadiazolone, -(CH2)oxadiazolone, tetrazolone, -(CH2)tetrazolone, thiadiazolol, -(CH2)thiadiazolol, isoxazol-3-ol, -(CH2)isoxazol-3-ol, -P(O)(OH)OR x 、-(CH2)P(O)(OH)OR x , -S(O)2OH, -(CH2)S(O)2OH, -C(O)NHCN, -(CH2)C(O)NHCN, -C(O)NHS(O)2alkyl, or -(CH2)C(O)NHS(O)2alkyl. In other embodiments, R b Hydrogen, CO2R x 、CH2CO2R x , tetrazole, or oxadiazolone. In a further embodiment, R b is hydrogen, CO2H, CH2CO2H, tetrazole, or 1,2,4-oxadiazol-5(4H)-one. In a further embodiment, R b It's hydrogen.

[0134] In some embodiments of Formula (I), R c H, C1-C6 alkyl, C1-C6 haloalkyl, halogen, –CN, –ORx 、-CO2R x , or NO2. In other embodiments, R c C1-C6 alkyl, C1-C6 haloalkyl, halogen, –CN, –OR x 、-CO2R x , or NO2. In other embodiments, R c Halogen, –CN, –OR x , or C1-C6 alkyl. In other embodiments, R c Halogen, –CN, –OR x , or C1-C3 alkyl. In other embodiments, R c is H, -CN, or halogen. In other embodiments, R c It is –CN or halogen.

[0135] In some embodiments of Formula (I), R d is methyl, optionally substituted 5 to 10 membered aryl, optionally substituted 5 or 6 membered heteroaryl, or optionally substituted 5 or 6 membered carbocyclic ring. d is methyl, optionally cyclohexyl, optionally substituted pyridyl, optionally substituted thiazolyl, optionally substituted phenyl, or optionally substituted thienyl. In other embodiments, R d is methyl, cyclohexyl, pyridyl, thiazolyl, phenyl, or thienyl, each of which is optionally substituted with one or more substituents independently selected from halogen, C1-C6 alkyl, C1-C6 hydroxyalkyl, C1-C6 alkoxy, C1-C6 haloalkyl, C1-C6 haloalkoxy, -OH, CN, and amino. d is cyclohexyl, pyridyl, thiazolyl, phenyl, or thienyl, each of which is optionally substituted with one or more substituents independently selected from halogen, C1-C6 alkyl, C1-C6 hydroxyalkyl, C1-C6 alkoxy, C1-C6 haloalkyl, and C1-C6 haloalkoxy. d is cyclohexyl, pyridyl, thiazolyl, phenyl, or thienyl, each of which is optionally substituted with one or more halogens. d is cyclohexyl, pyridyl, thiazolyl, phenyl, or thienyl. In other embodiments, R d is cyclohexyl, pyridyl, thiazolyl, phenyl, 4-chlorophenyl, 4-methylphenyl, or thienyl.

[0136] In some embodiments of Formula (I), each R e are independently C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, halogen, -OR y, C1-C6 haloalkyl, -NHR z In other embodiments, C1-C4 alkyl, C2-C4 alkenyl, C2-C4 alkynyl, halogen, -OR y , C1-C4 haloalkyl, -NHR z , -OH, or -CN.

[0137] In some embodiments of Formula (I), R f is H or absent. In other embodiments, R f is H. In other embodiments, when f When the connected N participates in the formation of a double bond, R f Does not exist.

[0138] In some embodiments of Formula (I), R x is hydrogen or C1-C6 alkyl. In other embodiments, R x is hydrogen or C1-C3 alkyl. In a further embodiment, R x is hydrogen, methyl, ethyl, n-propyl, or isopropyl.

[0139] In some embodiments of Formula (I), R y is independently hydrogen, C1-C6 alkyl or C1-C6 haloalkyl. y is hydrogen, C1-C3 alkyl, or C1-C3 haloalkyl.

[0140] In some embodiments of Formula (I), each R z are independently hydrogen, C1-C6 alkyl or C1-C6 haloalkyl. z is hydrogen, C1-C3 alkyl, or C1-C3 haloalkyl.

[0141] In some embodiments of Formula (I), m is 0, 1 or 2. In other embodiments, m is 0. In other embodiments, m is 1. In yet other embodiments, m is 2.

[0142] In some embodiments of Formula (I), p is 0, 1 or 2. In other embodiments, p is 0. In other embodiments, p is 1. In yet other embodiments, p is 2.

[0143] In some embodiments of Formula (I), m+p<3.

[0144] In some embodiments of Formula (I), q is 0, 1 or 2. In other embodiments, q is 0. In other embodiments, q is 1. In other embodiments, q is 2.

[0145] In some embodiments of Formula (I), r is 0 or 1. In other embodiments, r is 0. In other embodiments, r is 1.

[0146] In some embodiments of Formula (I), the dashed line is a single bond. In other embodiments, the dashed line is a double bond.

[0147] In some embodiments of Formula (I), R a and R b One of them is hydrogen and the other is CO2R x 、CH2CO2R x , tetrazole, or oxadiazolone. In other embodiments, R b is hydrogen and R a It is CH2CO2H, tetrazole, or (1,2,4-oxadiazol-5(4H)-one).

[0148] In some embodiments of Formula (I), R b is hydrogen, R c Yes – CN, R d is a thienyl group, and R a It is CH2CO2H, tetrazole, or (1,2,4-oxadiazol-5(4H)-one).

[0149] In some embodiments of Formula (I), R c is a halogen, R a is –CO2H, and R b is H. In other embodiments, R c Yes -Br, R a is –CO2H, and R b is H. In a further embodiment, R c Yes -Cl, R a is –CO2H, and R b It's H.

[0150] In some embodiments of Formula (I), R c is a halogen, R a is tetrazole, and R b is H. In other embodiments, R c Yes -Br, R a is tetrazole, and R b is H. In a further embodiment, R c Yes -Cl, R a is tetrazole, and R b It's H.

[0151] In some embodiments of Formula (I), R c is a halogen, R a is –CH2CO2H, and Rb is H. In other embodiments, R c Yes -Br, R a is –CH2CO2H, and R b is H. In a further embodiment, R c Yes -Cl, R a is –CH2CO2H, and R b It's H.

[0152] In some embodiments of Formula (I), R c is a halogen, R a is (1,2,4-oxadiazol-5(4H)-one), and R b is H. In other embodiments, R c Yes -Br, R a is (1,2,4-oxadiazol-5(4H)-one), and R b is H. In other embodiments, R c Yes -Cl, R a is (1,2,4-oxadiazol-5(4H)-one), and R b It's H.

[0153] In some embodiments of Formula (I), R c Yes-CN, R a is –CO2H, and R b is H. In other embodiments, R c Yes-CN, R a is –CH2CO2H, and R b is H. In other embodiments, R c Yes-CN, R a is tetrazole, and R b is H. In other embodiments, R c Yes-CN, R a is (1,2,4-oxadiazol-5(4H)-one), and R b It's H.

[0154] In some embodiments of Formula (I), R c is not hydrogen or –CN, and X is O, L is –SCH2-, and R d is an optionally substituted phenyl. In other embodiments, R c is not C1-C6 alkyl, and X is O, L is –SCH2-, and R d In other embodiments, R c is not –CN, and X is O, L is –SCH2-, and R d It is 2-furyl.

[0155] In some embodiments of Formula (I), when X is O, L is -SCH2-, and R d When R is an optionally substituted phenyl group, c Not hydrogen or –CN.

[0156] In some embodiments of Formula (I), when X is O, L is -SCH2-, and R d When it is methyl, R c Not a C1-C6 alkyl group.

[0157] In some embodiments of Formula (I), when X is O, L is -SCH2-, and R d When it is 2-furanyl, R c Not –CN.

[0158] In one embodiment, the compound of formula (I) is represented by formula (Ia):

[0159]

[0160] or a pharmaceutically acceptable salt or tautomer thereof,

[0161] in:

[0162] L is –(CH2) m CH2CH2-, –(CH2) m Y(CH2) p -、-(CH2) m C(O)(CH2) p -、-(CH2) m C(O)O(CH2) p -、-(CH2) m C(O)NR 2 (CH2) p -, or -(CH2) m NR 2 C(O)(CH2) p ;

[0163] Y is O, N or S(O) q ;

[0164] R 1 It is C6-C 10 aryl or heteroaryl, wherein the aryl or heteroaryl is replaced by R a and R b and optionally substituted by one or more R e replace;

[0165] R 2 Is H or C6-C 10 alkyl;

[0166] R a and R b One of them is hydrogen and the other is -(CH2)rCO2R x 、-OCH2CO2R x , -(CH2)r tetrazole, -(CH2)r oxadiazolone, -(CH2)r tetrazolone, -(CH2)r thiadiazolol, -(CH2)r isoxazol-3-ol, -(CH2)r P(O)(OH)OR x , -(CH2)rS(O)2OH, -(CH2)rC(O)NHCN, or -(CH2)rC(O)NHS(O)2alkyl;

[0167] R c H, C1-C6 alkyl, C1-C6 haloalkyl, halogen, –CN, –OR x 、-CO2R x , or NO2;

[0168] R d is methyl, optionally substituted 5- to 10-membered aryl, optionally substituted 5- or 6-membered heteroaryl, or optionally substituted 5- or 6-membered carbocyclic ring;

[0169] Each R x is independently at each occurrence hydrogen or C1-C6 alkyl;

[0170] Each R e are independently C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, halogen, -OR y , C1-C6 haloalkyl, -NHR z , -OH, or -CN;

[0171] Each R y and R z are independently hydrogen, C1-C6 alkyl, or C1-C6 haloalkyl;

[0172] Each m and p is independently 0, 1 or 2, where m+p<3;

[0173] q is 0, 1, or 2; and

[0174] r is 0 or 1;

[0175] Additional conditions: When L is –SCH2- and R d When R is an optionally substituted phenyl group c is not hydrogen or –CN, when L is –SCH2- and R d When it is methyl, R c is not C1-C6 alkyl, and when L is –SCH2- and R d When R is 2-furanylc Not –CN.

[0176] In some embodiments of Formula (Ia),

[0177] L is -CH2CH2-, -CH2C(O)-, -C(O)CH2-, -NR 2 CH2-、-CH2NR 2 -, -OCH2-, -CH2O-, -SCH2-, -CH2S-, -S(O)CH2-, -CH2S(O)-, -CH2S(O)2-, or -S(O)2CH2-;

[0178] Y is O, N or S(O) q ;

[0179] R 1 It is C6-C 10 aryl or heteroaryl, wherein the aryl or heteroaryl is replaced by R a and R b and optionally one or more R e replace;

[0180] R 2 Is H or C6-C 10 alkyl;

[0181] R a and R b One of them is hydrogen and the other is -(CH2)rCO2R x 、-OCH2CO2R x , -(CH2)r tetrazole, -(CH2)r oxadiazolone, -(CH2)r tetrazolone, -(CH2)r thiadiazolol, -(CH2)r isoxazol-3-ol, -(CH2)r P(O)(OH)OR x , -(CH2)rS(O)2OH, -(CH2)rC(O)NHCN, or -(CH2)rC(O)NHS(O)2alkyl;

[0182] R c C1-C6 alkyl, C1-C6 haloalkyl, halogen, –CN, –OR x 、-CO2R x , or NO2;

[0183] R d is methyl, optionally substituted 5- to 10-membered aryl, optionally substituted 5- or 6-membered heteroaryl, or optionally substituted 5- or 6-membered carbocyclic ring;

[0184] Each R x is independently at each occurrence hydrogen or C1-C6 alkyl;

[0185] Each R e are independently C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, halogen, -OR y , C1-C6 haloalkyl, -NHR z , -OH, or -CN;

[0186] Each R y and R z are independently hydrogen, C1-C6 alkyl, or C1-C6 haloalkyl;

[0187] Each m and p is independently 0, 1 or 2, where m+p<3;

[0188] q is 0, 1, or 2; and

[0189] r is 0 or 1;

[0190] Additional conditions: When L is –SCH2- and R d When R is an optionally substituted phenyl group, c Not –CN; when L is –SCH2- and R d When it is methyl, R c is not C1-C6 alkyl; and when L is –SCH2- and R d When it is 2-furanyl, R c Not –CN.

[0191] In some embodiments of Formula (Ia), L is -(CH2) m CH2CH2-, –(CH2) m Y(CH2) p -、-(CH2) m C(O)(CH2) p -、-(CH2) m C(O)O(CH2) p -、-(CH2) m C(O)NR 2 (CH2) p -, or -(CH2) m NR 2 C(O)(CH2) pIn other embodiments, L is –CH2CH2-, –CH2CH2CH2-, –SCH2-, –SCH2CH2-, –CH2S-, –CH2SCH2-, –CH2CH2S-, –S(O)CH2-, –S(O)CH2CH2-, –CH2S(O)-, –CH2S(O)CH2-, –CH2CH2S(O)-, –S(O)2CH2-, –S(O)2CH2CH2-, –CH2S(O)2-, –CH2S(O)2CH2-, –CH2CH2S(O)2-, –OCH2-, –OCH2CH2-, –CH2O-, –CH2OCH2-, –CH2CH2O-, –NR 2 CH2-, –CH2NR 2 -、-CH2NR 2 CH2-、-CH2CH2NR 2 -、–NR 2 CH2CH2-, -C(O)CH2-, -C(O)CH2CH2-, -C(O)O-, -C(O)OCH2-, -CH2C(O)O-, -C(O)NR 2 -、-C(O)NR 2 CH2-、-NR 2 C(O), -NR 2 C(O)CH2, or -CH2NR2C(O). In other embodiments, L is -CH2CH2-, -CH2CH2CH2-, -SCH2-, -SCH2CH2-, -S(O)CH2-, -S(O)CH2CH2-, -S(O)2CH2-, -S(O)2CH2CH2-, -OCH2-, -OCH2CH2-, -NR 2 CH2-, –NR 2 CH2CH2-, -C(O)CH2-, -C(O)CH2CH2-, -C(O)O-, -C(O)OCH2-, -CH2C(O)O-, -C(O)NR 2 -、-C(O)NR 2 CH2-、-NR 2 C(O), or –NR 2 In other embodiments, L is -CH2CH2-, -CH2C(O)-, -C(O)CH2-, -NR 2 CH2-、-CH2NR 2 -, -OCH2-, -CH2O-, -SCH2-, -CH2S-, -S(O)CH2-, -CH2S(O)-, -CH2S(O)2-, or -S(O)2CH2-.

[0192] In some embodiments of Formula (Ia), R 1 It is C6-C 10 Aryl or heteroaryl, wherein aryl and heteroaryl are replaced by R a and R b and optionally substituted by one or more R e In other embodiments, R 1 Is R a and R b and optionally substituted by one or more R e Substituted C6-C 10 In other embodiments, R 1 Is R a and R b and optionally substituted by one or more R e Substituted C6-C 10 In a further embodiment, R 1 Is R a and R b and optionally substituted by one or more R e Substituted phenyl.

[0193] In some embodiments of Formula (Ia), R a Yes - (CH2) r CO2R x 、-OCH2CO2R x 、-(CH2) r Tetrazole, -(CH2) r Oxadiazolone, -(CH2) r Tetrazodone, -(CH2) r Thiadiazole, -(CH2) r Isoxazol-3-ol, -(CH2) r P(O)(OH)OR x 、-(CH2) r S(O)2OH, -(CH2) r C(O)NHCN, or -(CH2) r C(O)NHS(O)2alkyl. In other embodiments, R a Yes - (CH2) r CO2R x 、-OCH2CO2R x , tetrazole, -(CH2)tetrazole, oxadiazolone, -(CH2)oxadiazolone, tetrazolone, -(CH2)tetrazolone, thiadiazolol, -(CH2)thiadiazolol, isoxazol-3-ol, -(CH2)isoxazol-3-ol, -P(O)(OH)OR x 、-(CH2)P(O)(OH)ORx , -S(O)2OH, -(CH2)S(O)2OH, -C(O)NHCN, -(CH2)C(O)NHCN, -C(O)NHS(O)2alkyl, or -(CH2)C(O)NHS(O)2alkyl. In other embodiments, R a Hydrogen, CO2R x 、CH2CO2R x , tetrazole, or oxadiazolone. In a further embodiment, R a is hydrogen, CO2H, CH2CO2H, tetrazole, or 1,2,4-oxadiazol-5(4H)-one.

[0194] In some embodiments of Formula (Ia), R b Yes - (CH2) r CO2R x 、-OCH2CO2R x 、-(CH2) r Tetrazole, -(CH2) r Oxadiazolone, -(CH2) r Tetrazodone, -(CH2) r Thiadiazole, -(CH2) r Isoxazol-3-ol, -(CH2) r P(O)(OH)OR x 、-(CH2) r S(O)2OH, -(CH2) r C(O)NHCN, or -(CH2) r C(O)NHS(O)2alkyl. In other embodiments, R b Yes - (CH2) r CO2R x 、-OCH2CO2R x , tetrazole, -(CH2)tetrazole, oxadiazolone, -(CH2)oxadiazolone, tetrazolone, -(CH2)tetrazolone, thiadiazolol, -(CH2)thiadiazolol, isoxazol-3-ol, -(CH2)isoxazol-3-ol, -P(O)(OH)OR x 、-(CH2)P(O)(OH)OR x , -S(O)2OH, -(CH2)S(O)2OH, -C(O)NHCN, -(CH2)C(O)NHCN, -C(O)NHS(O)2alkyl, or -(CH2)C(O)NHS(O)2alkyl. In other embodiments, R b Hydrogen, CO2R x 、CH2CO2R x , tetrazole, or oxadiazolone. In a further embodiment, R bis hydrogen, CO2H, CH2CO2H, tetrazole, or 1,2,4-oxadiazol-5(4H)-one. In a further embodiment, R b It's hydrogen.

[0195] In certain embodiments of Formula (Ia), R c H, C1-C6 alkyl, C1-C6 haloalkyl, halogen, –CN, –OR x 、-CO2R x , or NO2. In other embodiments, R c C1-C6 alkyl, C1-C6 haloalkyl, halogen, –CN, –OR x 、-CO2R x , or NO2. In other embodiments, R c Is halogen, –CN, –OR x , or C1-C6 alkyl. In other embodiments, R c Is halogen, –CN, –OR x , or C1-C3 alkyl. In other embodiments, R c is H, -CN, or halogen. In other embodiments, R c It is –CN or halogen.

[0196] In some embodiments of Formula (Ia), R d is methyl, optionally substituted 5 to 10 membered aryl, optionally substituted 5 or 6 membered heteroaryl, or optionally substituted 5 or 6 membered carbocyclic ring. d is methyl, optionally cyclohexyl, optionally substituted pyridyl, optionally substituted thiazolyl, optionally substituted phenyl, or optionally substituted thienyl. In other embodiments, R d is cyclohexyl, pyridyl, thiazolyl, phenyl, or thienyl, each of which is optionally substituted with one or more substituents independently selected from halogen, C1-C6 alkyl, C1-C6 hydroxyalkyl, C1-C6 alkoxy, C1-C6 haloalkyl, C1-C6 haloalkoxy, -OH, CN, and amino. d is cyclohexyl, pyridyl, thiazolyl, phenyl, or thienyl, each of which is optionally substituted with one or more substituents independently selected from halogen, C1-C6 alkyl, C1-C6 hydroxyalkyl, C1-C6 alkoxy, C1-C6 haloalkyl, and C1-C6 haloalkoxy. d is cyclohexyl, pyridyl, thiazolyl, phenyl, or thienyl, each of which is optionally substituted with one or more halogens. d is methyl, cyclohexyl, pyridyl, thiazolyl, phenyl, or thienyl. In other embodiments, Rd is cyclohexyl, pyridyl, thiazolyl, phenyl, or thienyl. In other embodiments, R d is cyclohexyl, pyridyl, thiazolyl, phenyl, 4-chlorophenyl, 4-methylphenyl, or thienyl.

[0197] In some embodiments of Formula (Ia), each R e are independently C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, halogen, -OR y , C1-C6 haloalkyl, -NHR z In other embodiments, C1-C4 alkyl, C2-C4 alkenyl, C2-C4 alkynyl, halogen, -OR y , C1-C4 haloalkyl, -NHR z , -OH, or –CN.

[0198] In some embodiments of Formula (Ia), R x is hydrogen or C1-C6 alkyl. In other embodiments, R x is hydrogen or C1-C3 alkyl. In a further embodiment, R x is hydrogen, methyl, ethyl, n-propyl, or isopropyl.

[0199] In some embodiments of Formula (Ia), R y R is independently hydrogen, C1-C6 alkyl, or C1-C6 haloalkyl. y is hydrogen, C1-C3 alkyl, or C1-C3 haloalkyl.

[0200] In some embodiments of Formula (Ia), each R z R is independently hydrogen, C1-C6 alkyl, or C1-C6 haloalkyl. z is hydrogen, C1-C3 alkyl, or C1-C3 haloalkyl.

[0201] In some embodiments of Formula (Ia), m is 0, 1, or 2. In other embodiments, m is 0. In other embodiments, m is 1. In yet other embodiments, m is 2.

[0202] In some embodiments of Formula (Ia), p is 0, 1, or 2. In other embodiments, p is 0. In other embodiments, p is 1. In yet other embodiments, p is 2.

[0203] In some embodiments of Formula (Ia), q is 0, 1, or 2. In other embodiments, q is 0. In other embodiments, q is 1. In other embodiments, q is 2.

[0204] In some embodiments of Formula (Ia), r is 0 or 1. In other embodiments, r is 0. In other embodiments, r is 1.

[0205] In some embodiments of Formula (Ia), R a and R b One of them is hydrogen and the other is CO2R x 、CH2CO2R x , tetrazole, or oxadiazolone. In other embodiments, R b is hydrogen and R a It is CH2CO2H, tetrazole, or (1,2,4-oxadiazol-5(4H)-one).

[0206] In some embodiments of Formula (Ia), R b is hydrogen, R c Yes – CN, R d is a thienyl group, and R a It is CH2CO2H, tetrazole, or (1,2,4-oxadiazol-5(4H)-one).

[0207] In some embodiments of Formula (Ia), R c is a halogen, R a is –CO2H, and R b is H. In other embodiments, R c Yes -Br, R a is –CO2H, and R b is H. In a further embodiment, R c Yes -Cl, R a is –CO2H, and R b It's H.

[0208] In some embodiments of Formula (Ia), R c is a halogen, R a is tetrazole, and R b is H. In other embodiments, R c Yes -Br, R a is tetrazole, and R b is H. In a further embodiment, R c Yes -Cl, R a is tetrazole, and R b It's H.

[0209] In some embodiments of Formula (Ia), R c is a halogen, R a is –CH2CO2H, and R b is H. In other embodiments, R c Yes -Br, Ra is –CH2CO2H, and R b is H. In a further embodiment, R c Yes -Cl, R a is –CH2CO2H, and R b It's H.

[0210] In some embodiments of Formula (Ia), R c is a halogen, R a is (1,2,4-oxadiazol-5(4H)-one), and R b is H. In other embodiments, R c Yes -Br, R a is (1,2,4-oxadiazol-5(4H)-one), and R b is H. In other embodiments, R c Yes -Cl, R a is (1,2,4-oxadiazol-5(4H)-one), and R b It's H.

[0211] In some embodiments of Formula (Ia), R c Yes-CN, R a is –CO2H, and R b is H. In other embodiments, R c Yes-CN, R a is –CH2CO2H, and R b is H. In other embodiments, R c Yes-CN, R a is tetrazole, and R b is H. In other embodiments, R c Yes-CN, R a is (1,2,4-oxadiazol-5(4H)-one), and R b It's H.

[0212] In some embodiments of Formula (Ia), R c is not hydrogen or –CN, L is –SCH2-, and R d is an optionally substituted phenyl. In other embodiments, R c is not a C1-C6 alkyl group, L is –SCH2-, and R d In other embodiments, R c is not –CN, L is –SCH2-, and R d It is 2-furyl.

[0213] In some embodiments of Formula (Ia), when L is -SCH2- and R d When R is an optionally substituted phenyl group,c Not hydrogen or –CN.

[0214] In some embodiments of Formula (Ia), when L is -SCH2- and R d When it is methyl, R c Not a C1-C6 alkyl group.

[0215] In some embodiments of Formula (Ia), when L is -SCH2- and R d When it is 2-furanyl, R c Not –CN.

[0216] In another embodiment, the compound of formula (I) is represented by formula (Ib):

[0217]

[0218] or a pharmaceutically acceptable salt or tautomer thereof,

[0219] in:

[0220] R a and R b is hydrogen and the other is -(CH2) r CO2R x 、-OCH2CO2R x 、-(CH2) r Tetrazolyl, -(CH2) r Oxadiazolone, -(CH2) r Tetrazodone, -(CH2) r Thiadiazole, -(CH2) r Isoxazol-3-ol, -(CH2) r P(O)(OH)OR x 、-(CH2) r S(O)2OH, -(CH2) r C(O)NHCN, or -(CH2) r C(O)NHS(O)2alkyl;

[0221] R c H, C1-C6 alkyl, C1-C6 haloalkyl, halogen, –CN, –OR x 、-CO2R x , or NO2;

[0222] R d is methyl, optionally substituted 5- to 10-membered aryl, optionally substituted 5- or 6-membered heteroaryl, or optionally substituted 5- or 6-membered carbocyclic ring;

[0223] Each R x is independently at each occurrence hydrogen or C1-C6 alkyl;

[0224] Each R e are independently C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, halogen, -OR y , C1-C6 haloalkyl, -NHR z , -OH, or -CN;

[0225] Each R y and R z are independently hydrogen, C1-C6 alkyl, or C1-C6 haloalkyl; and

[0226] n is 0, 1, 2, or 3;

[0227] The additional condition is: when R d When R is an optionally substituted phenyl group, c is not hydrogen or –CN; when R d When it is methyl, R c is not a C1-C6 alkyl group, and when R d When it is 2-furanyl, R c Not –CN.

[0228] In some embodiments of Formula (Ib),

[0229] R a and R b One of them is hydrogen and the other is -(CH2) r CO2R x 、-OCH2CO2R x 、-(CH2) r Tetrazole, -(CH2) r Oxadiazolone, -(CH2) r Tetrazodone, -(CH2) r Thiadiazole, -(CH2) r Isoxazol-3-ol, -(CH2) r P(O)(OH)OR x 、-(CH2) r S(O)2OH, -(CH2) r C(O)NHCN, or -(CH2) r C(O)NHS(O)2alkyl;

[0230] R c C1-C6 alkyl, C1-C6 haloalkyl, halogen, –CN, –OR x 、-CO2R x , or NO2;

[0231] R dis methyl, optionally substituted 5- to 10-membered aryl, optionally substituted 5- or 6-membered heteroaryl, or optionally substituted 5- or 6-membered carbocyclic ring;

[0232] Each R x is independently at each occurrence hydrogen or C1-C6 alkyl;

[0233] Each R e are independently C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, halogen, -OR y , C1-C6 haloalkyl, -NHR z , -OH, or -CN;

[0234] The additional condition is: when R d When R is an optionally substituted phenyl group, c is not hydrogen or –CN; when R d When it is methyl, R c is not a C1-C6 alkyl group; and when R d When it is 2-furanyl, R c Not –CN.

[0235] In some embodiments of Formula (Ib),

[0236] R a and R b One of them is hydrogen and the other is CO2R x 、CH2CO2R x , tetrazole, or oxadiazolone;

[0237] R c Is halogen, –CN, –OR x , or C1-C6 alkyl;

[0238] R d is methyl, optionally substituted 5- to 10-membered aryl, optionally substituted 5- or 6-membered heteroaryl, or optionally substituted 5- or 6-membered carbocyclic ring; and

[0239] R x is hydrogen or C1-C6 alkyl;

[0240] Each R e are independently C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, halogen, -OR y , C1-C6 haloalkyl, -NHR z , -OH, or -CN;

[0241] Each R y and R z are independently hydrogen, C1-C6 alkyl, or C1-C6 haloalkyl; and

[0242] n is 0, 1, 2, or 3;

[0243] The additional condition is: when R d When R is an optionally substituted phenyl group, c Not –CN; when R d When it is methyl, R c is not a C1-C6 alkyl group; and when R d When it is 2-furanyl, R c Not –CN.

[0244] In some embodiments of Formula (Ib), R a Yes - (CH2) r CO2R x 、-OCH2CO2R x 、-(CH2) r Tetrazole, -(CH2) r Oxadiazolone, -(CH2) r Tetrazodone, -(CH2) r Thiadiazole, -(CH2) r Isoxazol-3-ol, -(CH2) r P(O)(OH)OR x 、-(CH2) r S(O)2OH, -(CH2) r C(O)NHCN, or -(CH2) r C(O)NHS(O)2alkyl. In other embodiments, R a Yes - (CH2) r CO2R x 、-OCH2CO2R x , tetrazole, -(CH2)tetrazole, oxadiazolone, -(CH2)oxadiazolone, tetrazolone, -(CH2)tetrazolone, thiadiazolol, -(CH2)thiadiazolol, isoxazol-3-ol, -(CH2)isoxazol-3-ol, -P(O)(OH)OR x 、-(CH2)P(O)(OH)OR x , -S(O)2OH, -(CH2)S(O)2OH, -C(O)NHCN, -(CH2)C(O)NHCN, -C(O)NHS(O)2alkyl, or -(CH2)C(O)NHS(O)2alkyl. In other embodiments, R a Hydrogen, CO2R x 、CH2CO2R x , tetrazole, or oxadiazolone. In a further embodiment, R a is hydrogen, CO2H, CH2CO2H, tetrazole, or 1,2,4-oxadiazol-5(4H)-one.

[0245] In some embodiments of Formula (Ib), R b Yes - (CH2) r CO2R x 、-OCH2CO2R x 、-(CH2) r Tetrazole, -(CH2) r Oxadiazolone, -(CH2) r Tetrazodone, -(CH2) r Thiadiazole, -(CH2) r Isoxazol-3-ol, -(CH2) r P(O)(OH)OR x 、-(CH2) r S(O)2OH, -(CH2) r C(O)NHCN, or -(CH2) r C(O)NHS(O)2alkyl. In other embodiments, R b Yes - (CH2) r CO2R x 、-OCH2CO2R x , tetrazole, -(CH2)tetrazole, oxadiazolone, -(CH2)oxadiazolone, tetrazolone, -(CH2)tetrazolone, thiadiazolol, -(CH2)thiadiazolol, isoxazol-3-ol, -(CH2)isoxazol-3-ol, -P(O)(OH)OR x 、-(CH2)P(O)(OH)OR x , -S(O)2OH, -(CH2)S(O)2OH, -C(O)NHCN, -(CH2)C(O)NHCN, -C(O)NHS(O)2alkyl, or -(CH2)C(O)NHS(O)2alkyl. In other embodiments, R b Hydrogen, CO2R x 、CH2CO2R x , tetrazole, or oxadiazolone. In a further embodiment, R b is hydrogen, CO2H, CH2CO2H, tetrazole, or 1,2,4-oxadiazol-5(4H)-one. In a further embodiment, R b It's hydrogen.

[0246] In some embodiments of Formula (Ib), R c H, C1-C6 alkyl, C1-C6 haloalkyl, halogen, –CN, –OR x 、-CO2R x , or NO2. In other embodiments, R cC1-C6 alkyl, C1-C6 haloalkyl, halogen, –CN, –OR x 、-CO2R x , or NO2. In other embodiments, R c Is halogen, –CN, –OR x , or C1-C6 alkyl. In other embodiments, R c Is halogen, –CN, –OR x , or C1-C3 alkyl. In other embodiments, R c is H, -CN, or halogen. In other embodiments, R c It is –CN or halogen.

[0247] In some embodiments of Formula (Ib), R d is methyl, optionally substituted 5 to 10 membered aryl, optionally substituted 5 or 6 membered heteroaryl, or optionally substituted 5 or 6 membered carbocyclic ring. d is methyl, optionally cyclohexyl, optionally substituted pyridyl, optionally substituted thiazolyl, optionally substituted phenyl, or optionally substituted thienyl. In other embodiments, R d is cyclohexyl, pyridyl, thiazolyl, phenyl, or thienyl, each of which is optionally substituted with one or more substituents independently selected from halogen, C1-C6 alkyl, C1-C6 hydroxyalkyl, C1-C6 alkoxy, C1-C6 haloalkyl, C1-C6 haloalkoxy, -OH, CN, and amino. d is cyclohexyl, pyridyl, thiazolyl, phenyl, or thienyl, each of which is optionally substituted with one or more substituents independently selected from halogen, C1-C6 alkyl, C1-C6 hydroxyalkyl, C1-C6 alkoxy, C1-C6 haloalkyl, and C1-C6 haloalkoxy. d is cyclohexyl, pyridyl, thiazolyl, phenyl, or thienyl, each of which is optionally substituted with one or more halogens. d is methyl, cyclohexyl, pyridyl, thiazolyl, phenyl, or thienyl. In other embodiments, R d is cyclohexyl, pyridyl, thiazolyl, phenyl, or thienyl. In other embodiments, R d is cyclohexyl, pyridyl, thiazolyl, phenyl, 4-chlorophenyl, 4-methylphenyl, or thienyl.

[0248] In some embodiments of Formula (Ib), each R e are independently C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, halogen, -OR y , C1-C6 haloalkyl, -NHRz In other embodiments, C1-C4 alkyl, C2-C4 alkenyl, C2-C4 alkynyl, halogen, -OR y , C1-C4 haloalkyl, -NHR z , -OH, or –CN.

[0249] In some embodiments of Formula (Ib), R x is hydrogen or C1-C6 alkyl. In other embodiments, R x is hydrogen or C1-C3 alkyl. In a further embodiment, R x is hydrogen, methyl, ethyl, n-propyl, or isopropyl.

[0250] In some embodiments of Formula (Ib), R y R is independently hydrogen, C1-C6 alkyl, or C1-C6 haloalkyl. y is hydrogen, C1-C3 alkyl, or C1-C3 haloalkyl.

[0251] In some embodiments of Formula (Ib), each R z is independently hydrogen, C1-C6 alkyl, or C1-C6 haloalkyl. z is hydrogen, C1-C3 alkyl, or C1-C3 haloalkyl.

[0252] In some embodiments of Formula (Ib), n is 0, 1, 2, or 3. In other embodiments, n is 0 or 1. In further embodiments, n is 0.

[0253] In some embodiments of Formula (Ib), R a and R b One of them is hydrogen and the other is CO2R x 、CH2CO2R x , tetrazole, or oxadiazolone. In other embodiments, R b is hydrogen, R a It is CH2CO2H, tetrazole, or (1,2,4-oxadiazol-5(4H)-one).

[0254] In some embodiments of Formula (Ib), R b is hydrogen, R c Yes – CN, R d is a thienyl group, and R a It is CH2CO2H, tetrazole, or (1,2,4-oxadiazol-5(4H)-one).

[0255] In some embodiments of Formula (Ib), R c is a halogen, Ra is –CO2H, and R b is H. In other embodiments, R c Yes -Br, R a is –CO2H, and R b is H. In a further embodiment, R c Yes -Cl, R a is –CO2H, and R b It's H.

[0256] In some embodiments of Formula (Ib), R c is a halogen, R a is tetrazole, and R b is H. In other embodiments, R c Yes -Br, R a is tetrazole, and R b is H. In a further embodiment, R c Yes -Cl, R a is tetrazole, and R b It's H.

[0257] In some embodiments of Formula (Ib), R c is a halogen, R a is –CH2CO2H, and R b is H. In other embodiments, R c Yes -Br, R a is –CH2CO2H, and R b is H. In a further embodiment, R c Yes -Cl, R a is –CH2CO2H, and R b It's H.

[0258] In some embodiments of Formula (Ib), R c is a halogen, R a is (1,2,4-oxadiazol-5(4H)-one), and R b is H. In other embodiments, R c Yes -Br, R a is (1,2,4-oxadiazol-5(4H)-one), and R b is H. In other embodiments, R c Yes -Cl, R a is (1,2,4-oxadiazol-5(4H)-one), and R b It's H.

[0259] In some embodiments of Formula (Ib), R c Yes-CN, R a is –CO2H, and Rb is H. In other embodiments, R c Yes-CN, R a is –CH2CO2H, and R b is H. In other embodiments, R c Yes-CN, R a is tetrazole, and R b is H. In other embodiments, R c Yes-CN, R a is (1,2,4-oxadiazol-5(4H)-one), and R b It's H.

[0260] In some embodiments of Formula (Ib), R c Not hydrogen or –CN, R d is an optionally substituted phenyl. In other embodiments, R c Not C1-C6 alkyl, R d In other embodiments, R c No – CN, R d It is 2-furyl.

[0261] In some embodiments of Formula (Ib), when R d When R is an optionally substituted phenyl group, c Not hydrogen or –CN.

[0262] In some embodiments of Formula (Ib), when R d When it is methyl, R c Not a C1-C6 alkyl group.

[0263] In some embodiments of Formula (Ib), when R d When it is 2-furanyl, R c Not –CN.

[0264] In another embodiment, the compound of formula (I) is represented by formula (II):

[0265]

[0266] or a pharmaceutically acceptable salt or tautomer thereof,

[0267] in:

[0268] R c Halogen, –CN, –OR x , or C1-C6 alkyl;

[0269] R d is methyl, optionally substituted 5- to 10-membered aryl, optionally substituted 5- or 6-membered heteroaryl, or optionally substituted 5- or 6-membered carbocyclic ring; and

[0270] R x is hydrogen or C1-C6 alkyl

[0271] The additional condition is: when R d When R is an optionally substituted phenyl group, c Not –CN; when R d When it is methyl, R c is not a C1-C6 alkyl group; and when R d When it is 2-furanyl, R c Not –CN.

[0272] In some embodiments of Formula (II), R c Halogen, –CN, –OR x , or C1-C6 alkyl; R d is methyl, optionally substituted 5- to 10-membered aryl, optionally substituted 5- or 6-membered heteroaryl, or optionally substituted 5- or 6-membered carbocyclic ring; and R x is hydrogen or C1-C6 alkyl, with the additional condition that: when R d When it is methyl, R c is not a C1-C6 alkyl group; and when R d When it is 2-furanyl, R c Not –CN.

[0273] In some embodiments of Formula (II), R c Halogen, –CN, –OR x , or C1-C6 alkyl. In other embodiments, R c Halogen, –CN, –OR x , or C1-C3 alkyl. In a further embodiment, R c It is –CN or halogen.

[0274] In some embodiments of Formula (II), R d is methyl, optionally substituted 5 to 10 membered aryl, optionally substituted 5 or 6 membered heteroaryl, or optionally substituted 5 or 6 membered carbocyclic ring. d is cyclohexyl, pyridyl, thiazolyl, phenyl, or thienyl, each of which is optionally substituted with one or more substituents independently selected from halogen, C1-C6 alkyl, C1-C6 hydroxyalkyl, C1-C6 alkoxy, C1-C6 haloalkyl, C1-C6 haloalkoxy, -OH, CN, and amino. dis cyclohexyl, pyridyl, thiazolyl, phenyl, or thienyl, each of which is optionally substituted with one or more substituents independently selected from halogen, C1-C6 alkyl, C1-C6 hydroxyalkyl, C1-C6 alkoxy, C1-C6 haloalkyl, and C1-C6 haloalkoxy. d is cyclohexyl, pyridyl, thiazolyl, phenyl, or thienyl, each of which is optionally substituted with one or more halogens. In a further embodiment, R d is methyl, cyclohexyl, pyridyl, thiazolyl, phenyl, or thienyl.

[0275] In some embodiments of Formula (II), R b Hydrogen, CO2R x 、CH2CO2R x , tetrazole, or oxadiazolone. In other embodiments, R b is hydrogen, CO2H, CH2CO2H, tetrazole, or 1,2,4-oxadiazol-5(4H)-one. In a further embodiment, R b It's hydrogen.

[0276] In some embodiments of Formula (II), R a Hydrogen, CO2R x 、CH2CO2R x , tetrazole, or oxadiazolone. In a further embodiment, R a is hydrogen, CO2H, CH2CO2H, tetrazole, or 1,2,4-oxadiazol-5(4H)-one.

[0277] In some embodiments of Formula (II), each R e are independently C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, halogen, -OR y , C1-C6 haloalkyl, -NHR z , -OH, or –CN.

[0278] In some embodiments of Formula (II), each R y are independently hydrogen, C1-C6 alkyl, or C1-C6 haloalkyl.

[0279] In some embodiments of Formula (II), each R z are independently hydrogen, C1-C6 alkyl, or C1-C6 haloalkyl.

[0280] In some embodiments of Formula (II), n is 0, 1, 2, or 3. In other embodiments, n is 0 or 1. In further embodiments, n is 0.

[0281] In some embodiments of Formula (II), Ra and R b One of them is hydrogen and the other is CO2R x 、CH2CO2R x , tetrazole, or oxadiazolone. In other embodiments, R b is hydrogen, R a It is CH2CO2H, tetrazole, or (1,2,4-oxadiazol-5(4H)-one).

[0282] In some embodiments of Formula (II), R b is hydrogen, R c Yes – CN, R d is a thienyl group, and R a It is CH2CO2H, tetrazole, or (1,2,4-oxadiazol-5(4H)-one).

[0283] In some embodiments of Formula (II), R c is a halogen, R a is –CO2H, and R b is H. In other embodiments, R c Yes -Br, R a is –CO2H, and R b is H. In a further embodiment, R c Yes -Cl, R a is –CO2H, and R b It's H.

[0284] In some embodiments of Formula (II), R c is a halogen, R a is tetrazole, and R b is H. In other embodiments, R c Yes -Br, R a is tetrazole, and R b is H. In a further embodiment, R c Yes -Cl, R a is tetrazole, and R b It's H.

[0285] In some embodiments of Formula (II), R c is a halogen, R a is –CH2CO2H, and R b is H. In other embodiments, R c Yes -Br, R a is –CH2CO2H, and R b is H. In a further embodiment, R c Yes -Cl, R a is –CH2CO2H, and R bIt's H.

[0286] In some embodiments of Formula (II), R c is a halogen, R a is (1,2,4-oxadiazol-5(4H)-one), and R b is H. In other embodiments, R c Yes -Br, R a is (1,2,4-oxadiazol-5(4H)-one), and R b is H. In other embodiments, R c Yes -Cl, R a is (1,2,4-oxadiazol-5(4H)-one), and R b It's H.

[0287] In some embodiments of Formula (II), R c Yes-CN, R a is –CO2H, and R b is H. In other embodiments, R c Yes-CN, R a is –CH2CO2H, and R b is H. In other embodiments, R c Yes-CN, R a is tetrazole, and R b is H. In other embodiments, R c Yes-CN, R a is (1,2,4-oxadiazol-5(4H)-one), and R b It's H.

[0288] In some embodiments of Formula (I), (Ia), (Ib) and (II), R a or R b One of the molecules is a carboxylic acid or a carboxylic acid bioisostere.

[0289] In some embodiments of Formula (I), (Ia), (Ib) and (II), R a is -CO2H, -(CH2)CO2H, or -OCH2CO2H. In other embodiments, R a It is -CO2CH3, -CO2CH2CH3, -CO2CH2CH2CH3, -CO2CH(CH3)2, -(CH2)CO2CH3, -(CH2)CO2CH2CH3, -(CH2)CO2CH2CH2CH3, or -(CH2)CO2CH(CH3)2.

[0290] In some embodiments of Formula (I), (Ia), (Ib) and (II), R ais -P(O)(OH)OH, -(CH2)P(O)(OH)OH, -P(O)(OH)OCH3, -P(O)(OH)OCH2CH3, -P(O)(OH)OCH2CH2CH3, -P(O)(OH)OCH(C H3)2, -(CH2)P(O)(OH)OCH3, -(CH2)P(O)(OH)OCH2CH3, -(CH2)P(O)(OH)OCH2CH2CH3, or -(CH2)P(O)(OH)OCH(CH3)2.

[0291] In some embodiments of Formula (I), (Ia), (Ib) and (II), R a It is -S(O)2OH, -(CH2)S(O)2OH, -C(O)NHCN, or -(CH2)C(O)NHCN.

[0292] In some embodiments of Formula (I), (Ia), (Ib) and (II), R a is -C(O)NHS(O)2CH3, -C(O)NHS(O)2CH2CH3, -C(O)NHS(O)2CH2CH2CH3, -C(O)NHS(O)2CH(CH3)2, -(CH2)C(O) NHS(O)2CH3, -(CH2)C(O)NHS(O)2CH2CH3, -(CH2)C(O)NHS(O)2CH2CH2CH3, or -(CH2)C(O)NHS(O)2CH(CH3)2.

[0293] In some embodiments of Formula (I), (Ia), (Ib) and (II), R a yes

[0294]

[0295] In some embodiments of Formula (I), (Ia), (Ib) and (II), R a yes

[0296]

[0297] In some embodiments of Formula (I), (Ia), (Ib) and (II), R b is -CO2H, -(CH2)CO2H, or -OCH2CO2H. In other embodiments, R bIt is -CO2CH3, -CO2CH2CH3, -CO2CH2CH2CH3, -CO2CH(CH3)2, -(CH2)CO2CH3, -(CH2)CO2CH2CH3, -(CH2)CO2CH2CH2CH3, or -(CH2)CO2CH(CH3)2.

[0298] In some embodiments of Formula (I), (Ia), (Ib) and (II), R b is -P(O)(OH)OH, -(CH2)P(O)(OH)OH, -P(O)(OH)OCH3, -P(O)(OH)OCH2CH3, -P(O)(OH)OCH2CH2CH3, -P(O)(OH)OCH(C H3)2, -(CH2)P(O)(OH)OCH3, -(CH2)P(O)(OH)OCH2CH3, -(CH2)P(O)(OH)OCH2CH2CH3, or -(CH2)P(O)(OH)OCH(CH3)2.

[0299] In some embodiments of Formula (I), (Ia), (Ib) and (II), R b It is -S(O)2OH, -(CH2)S(O)2OH, -C(O)NHCN, or -(CH2)C(O)NHCN.

[0300] In some embodiments of Formula (I), (Ia), (Ib) and (II), R b is -C(O)NHS(O)2CH3, -C(O)NHS(O)2CH2CH3, -C(O)NHS(O)2CH2CH2CH3, -C(O)NHS(O)2CH(CH3)2, -(CH2)C(O) NHS(O)2CH3, -(CH2)C(O)NHS(O)2CH2CH3, -(CH2)C(O)NHS(O)2CH2CH2CH3, or -(CH2)C(O)NHS(O)2CH(CH3)2.

[0301] In some embodiments of Formula (I), (Ia), (Ib) and (II), R b yes

[0302] In some embodiments of Formula (I), (Ia), (Ib) and (II), R b yes

[0303] In some embodiments, the present invention provides a compound selected from the group consisting of:

[0304]

[0305]

[0306] or a pharmaceutically acceptable salt thereof.

[0307] In some embodiments, the present invention provides a compound selected from the group consisting of:

[0308]

[0309]

[0310]

[0311] or a pharmaceutically acceptable salt thereof.

[0312] In some embodiments, the present invention provides a compound, or a pharmaceutically acceptable salt or tautomer thereof, selected from the group consisting of:

[0313]

[0314] In some embodiments, the present invention provides a compound, or a pharmaceutically acceptable salt or tautomer thereof, selected from the group consisting of:

[0315]

[0316] In some embodiments, the present invention provides a compound, or a pharmaceutically acceptable salt or tautomer thereof, having the following chemical formula:

[0317]

[0318] In some embodiments, the present invention provides a compound, or a pharmaceutically acceptable salt or tautomer thereof, having the following chemical formula:

[0319]

[0320] In some embodiments, the present invention provides a compound, or a pharmaceutically acceptable salt or tautomer thereof, having the following chemical formula:

[0321]

[0322] In some embodiments, the present invention provides a compound, or a pharmaceutically acceptable salt or tautomer thereof, having the following chemical formula:

[0323]

[0324] The above definition of the compound of formula (I) is referred to herein as "the compound of formula (I)" or "the compound of formula (I)" for short, as defined herein. The above definition of the compound of formula (Ia) is referred to herein as "the compound of formula (Ia)" or "the compound of formula (Ia)" for short, as defined herein. The above definition of the compound of formula (Ib) is referred to herein as "the compound of formula (Ib)" or "the compound of formula (Ib)" for short, as defined herein. The above definition of the compound of formula (II) is referred to herein as "the compound of formula (II)" or "the compound of formula (II)" for short, as defined herein. It should be understood that these references are intended to include not only the above general formula, but also each and any of the embodiments discussed below, etc. It should also be understood that, unless otherwise stated, these references also include isomers, mixtures of isomers, pharmaceutically acceptable salts, solvates and prodrugs of the compounds of formula (I), formula (Ia), formula (Ib) and formula (II).

[0325] The term "alkyl" as used herein refers to a saturated straight or branched hydrocarbon chain. The hydrocarbon chain preferably contains 1 to 8 carbon atoms (C 1-8 -alkyl), more preferably 1 to 6 carbon atoms (C 1-6 -alkyl), especially 1 to 4 carbon atoms (C 1-4 -alkyl), including methyl, ethyl, propyl, isopropyl, butyl, isobutyl, sec-butyl, tert-butyl, pentyl, isopentyl, neopentyl, tert-pentyl, hexyl, isohexyl, heptyl, and octyl. In a preferred embodiment, "alkyl" represents C 1-4 -Alkyl groups may include, inter alia, methyl, ethyl, propyl, isopropyl, butyl, isobutyl, sec-butyl, and tert-butyl. Accordingly, the term "alkylene" refers to the corresponding diradical (-alkyl-).

[0326] The term "cycloalkyl" or "carbocycle" as used herein refers to a cyclic alkyl group, preferably containing 3 to 10 carbon atoms (C 3-10 -cycloalkyl or C 3-10 -carbon ring), for example 3 to 8 carbon atoms (C 3-8 -cycloalkyl or C 3-10 -carbocyclic ring), preferably 3 to 6 carbon atoms (C 3-6 -cycloalkyl or C 3-10-Carbocycle), including cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl and cyclooctyl. In addition, the term "cycloalkyl" used herein can also include polycyclic groups, such as bicyclo [2.2.2] octyl, bicyclo [2.2.1] heptyl, decyl and adamantyl. Accordingly, the term "cycloalkylidene" refers to the corresponding diradical (-cycloalkyl-). Alkyl and cycloalkyl groups can be optionally substituted with 1-4 substituents. The example of substituent on the alkyl group includes but is not limited to alkyl, alkenyl, alkynyl, halogen, haloalkyl, alkoxy, heteroaryl, aryl, carbocyclic radical, hydroxyl, carbamoyl, oxo, and -CN.

[0327] As used herein, the term "alkenyl" refers to a straight or branched hydrocarbon chain or cyclic hydrocarbon containing one or more double bonds, including dienes, trienes, and polyenes. Typically, an alkenyl group including at least one double bond comprises 2 to 8 carbon atoms (C 2-8 -alkenyl), for example 2 to 6 carbon atoms (C 2-6 -alkenyl), especially 2 to 4 carbon atoms (C 2-4 -alkenyl). Examples of alkenyl groups include vinyl; 1- or 2-propenyl; 1-, 2- or 3-butenyl, or 1,3-butadienyl; 1-, 2-, 3-, 4- or 5-hexenyl, or 1,3-hexadienyl, or 1,3,5-hexatrienyl; 1-, 2-, 3-, 4-, 5-, 6- or 7-octenyl, or 1,3-octadienyl, or 1,3,5-octatrienyl, or 1,3,5,7-octatetraenyl, or cyclohexenyl. Accordingly, the term "alkenylene" refers to the corresponding diradical (-alkenyl-). Alkenyl groups may be optionally substituted with 1-4 substituents. Examples of substituents on alkenyl groups include, but are not limited to, alkyl, alkenyl, alkynyl, halogen, haloalkyl, alkoxy, heteroaryl, aryl, carbocyclyl, hydroxyl, carbamoyl, oxo and -CN.

[0328] As used herein, the term "alkynyl" refers to a straight or branched hydrocarbon chain containing one or more triple bonds, including dialkynyl, trialkynyl, and polyalkynyl. Typically, an alkynyl group containing at least one triple bond contains 2 to 8 carbon atoms (C 2-8 -alkynyl), for example 2 to 6 carbon atoms (C 2-6 -alkynyl), especially 2 to 4 carbon atoms (C 2-4-alkynyl). Examples of preferred alkynyl groups include ethynyl; 1- or 2-propynyl; 1-, 2-, or 3-butynyl, or 1,3-butadiynyl; 1-, 2-, 3-, 4-, or 5-hexynyl, or 1,3-hexadiynyl, or 1,3,5-hexatriynyl; 1-, 2-, 3-, 4-, 5-, 6-, or 7-octynyl, or 1,3-octadiynyl, or 1,3,5-octatriynyl, or 1,3,5,7-octatetraynyl. Accordingly, the term "alkynylene" refers to the corresponding diradical (-alkynyl-). Alkynyl groups may be optionally substituted with 1-4 substituents. Examples of substituents on alkynyl groups include, but are not limited to, alkyl, alkenyl, alkynyl, halogen, haloalkyl, alkoxy, heteroaryl, aryl, carbocyclyl, hydroxy, carbamoyl, oxo, and -CN.

[0329] As used herein, the terms "halo" and "halogen" refer to fluorine, chlorine, bromine or iodine. Thus, a trihalomethyl group represents, for example, a trifluoromethyl group, or a trichloromethyl group. Preferably, the terms "halo" and "halogen" refer to fluorine or chlorine.

[0330] As used herein, the term "haloalkyl" refers to an alkyl group as defined herein, which is substituted one or more times with one or more halogens. Examples of haloalkyl groups include, but are not limited to, trifluoromethyl, difluoromethyl, pentafluoroethyl, trichloromethyl, and the like.

[0331] The term "alkoxy" as used herein refers to an "alkyl-O-" group, wherein alkyl is as defined above.

[0332] As used herein, the term "hydroxyalkyl" refers to an alkyl group (as defined above) wherein the alkyl group is substituted one or more times with a hydroxyl group. Examples of hydroxyalkyl groups include HO-CH2-, HO-CH2-CH2-, and CH3-CH(OH)-.

[0333] As used herein, the term "oxy" refers to a "-O-" group.

[0334] As used herein, the term "oxo" refers to a "=0" group.

[0335] As used herein, the term "amine" refers to primary amines (R-NH2, R≠H), secondary amines ((R)2-NH, (R)2≠H) and tertiary amines ((R)3-N, R≠H). Substituted amines are intended to refer to amines in which at least one hydrogen atom is replaced by a substituent.

[0336] The term "carbamyl" as used herein refers to a "H2N(C=O)-" group.

[0337] The term "aryl" as used herein, unless otherwise specified, includes carbocyclic aromatic ring systems derived from aromatic hydrocarbons and derived by removing hydrogen atoms. Aryl also includes bicyclic, tricyclic, and polycyclic ring systems. Examples of preferred aryl groups include phenyl, naphthyl, indenyl, indanyl, fluorenyl, biphenyl, indenyl, naphthyl, anthracenyl, phenanthrenyl, pentaenyl, azobenzenyl, and biphenylene. Unless otherwise specified, preferred "aryl" is phenyl, naphthyl or indanyl, particularly phenyl. Any aryl used can be optionally substituted. Accordingly, the term "arylene" refers to the corresponding diradical (-aryl). The aryl group can be optionally substituted by 1-4 substituents. Examples of substituents on the aryl group include, but are not limited to, alkyl, alkenyl, alkynyl, halogen, haloalkyl, alkoxy, heteroaryl, aryl, carbocyclyl, hydroxyl, and -CN.

[0338] The term "heteroaryl" as used herein refers to an aromatic group containing one or more heteroatoms selected from O, S and N, preferably 1 to 4 heteroatoms, more preferably 1 to 3 heteroatoms. Heteroaryl also includes bicyclic, tricyclic and polycyclic groups, wherein at least one ring of the group is aromatic and at least one ring contains heteroatoms selected from O, S and N. Heteroaryl also includes ring systems substituted with one or more oxo groups. Examples of preferred heteroaryl groups include N-hydroxytetrazolyl, N-hydroxytriazolyl, N-hydroxyimidazolyl, furanyl, triazolyl, pyranyl, thiadiazinyl, benzothiophenyl, dihydrobenzo[b]thiophenyl, xanthenyl, isoindanyl, acridinyl, benzisoxazolyl, quinolyl, isoquinolyl, pteridinyl, azepinyl, diazepinyl, imidazolyl, thiazolyl, carbazolyl, pyridinyl, pyridazinyl, pyrimidinyl, pyrazolyl, pyrazinyl, tetrazolyl, furanyl, thienyl, isoxazolyl, oxazolyl, isothiazolyl, pyrrolyl, indolyl, , benzimidazolyl, benzofuranyl, cinnolinyl, indazolyl, indolizinyl, phthalazinyl, triazinyl, isoindolyl, purinyl, oxadiazolyl, thiadiazolyl, furazanyl, benzofurazanyl, benzothiophenyl, benzotriazolyl, benzothiazolyl, benzoxazolyl, quinazolinyl, quinoxalinyl, naphthyridinyl, dihydroquinolinyl, tetrahydroquinolinyl, dihydroisoquinolinyl, tetrahydroisoquinolinyl, benzofuranyl, furapyridinyl, pyrrolidinyl, azaindolyl, pyrazolinyl, 1,2,4-oxadiazole-5 (4H) -one and pyrazolidinyl. Non-limiting examples of partially hydrogenated derivatives are 1,2,3,4-tetrahydronaphthyl, 1,4-dihydronaphthyl and 1-octahydronaphthalene. Accordingly, the term "heteroaryl" refers to the corresponding diradical (-heteroaryl-). The heteroaryl group may be optionally substituted with 1 to 4 substituents. Examples of substituents on the heteroaryl group include, but are not limited to, alkyl, alkenyl, alkynyl, halogen, haloalkyl, alkoxy, heteroaryl, aryl, carbocyclyl, hydroxyl, and -CN.

[0339] The term "heterocyclyl" as used herein refers to a cyclic non-aromatic group containing one or more heteroatoms selected from O, S and N, preferably 1 to 4 heteroatoms, more preferably 1 to 3 heteroatoms. Heterocyclyl also includes bicyclic, tricyclic and polycyclic non-aromatic groups, and at least one ring contains heteroatoms selected from O, S and N. Heterocyclyl also includes ring systems substituted with one or more oxo groups. Examples of heterocyclic groups are oxetane, pyrrolidinyl, pyrrolyl, 3H-pyrrolyl, tetrahydrofuranyl, furanyl, tetrahydrothiophenyl, thienyl, pyrazolyl, pyrazolidinyl, imidazolyl, imidazolidinyl, 3H-pyrazolyl, 1,2-oxazolyl, 1,3-oxazolyl, 1,2-thiazolyl, 1,3-thiazolyl, 1,2,5-oxadiazolyl, piperidinyl, pyridyl, tetrahydropyranyl (oxanyl), 2-H-pyranyl, 4-H-pyranyl, thiopyranyl, 2H-thiopyranyl, pyridazinyl, 1,2-diazinyl, pyrimidinyl, 1,3-dioxadiazolyl, 1.4-dioxaline, 1.4-dioxanyl, 1.3-diazinyl, 1.4-oxazinyl, morpholinyl, thiomorpholinyl, 1.4-thioxanyl, benzofuranyl, isobenzofuranyl, indazolyl, benzimidazolyl, quinolyl, isoquinolyl, chromanyl, isochromanyl, 4H-chromene, 1H-isochromene, cinnolinyl, quinazolinyl, quinoxalinyl, phthalazinyl, purinyl, naphthyridinyl, pteridinyl, indolizinyl, 1H-pyrrolizinyl, 4H-quinolyl and aza-8-bicyclo[3.2.1]octane. Accordingly, the term "heterocyclylene" refers to the corresponding diradical (-heterocyclyl-). The heterocyclyl group can be optionally substituted with 1-4 substituents. Examples of substituents on the heterocyclyl group include, but are not limited to, alkyl, alkenyl, alkynyl, halogen, haloalkyl, alkoxy, heteroaryl, aryl, carbocyclyl, hydroxy, and -CN.

[0340] As used herein, the term "N-heterocycle" refers to a heterocyclic or heteroaryl group as defined above, having at least one nitrogen atom and bonded through the nitrogen atom. Examples of such N-heterocycles are pyrrolidinyl, pyrrolyl, 3H-pyrrolyl, pyrazolyl, pyrazolidinyl, imidazolyl, imidazolidinyl, 3H-pyrazolyl, 1,2-oxazolyl, 1,2-thiazolyl, 1,3-thiazolyl, piperidinyl, pyridinyl, pyridazinyl, pyrazinyl, piperazinyl, morpholinyl, pyridinyl, pyridazinyl, pyrimidinyl, pyrazolyl, pyrazinyl, tetrazolyl, and the like.

[0341] In this specification, for convenience, the structural formula of the compound is represented as a specific isomer in some cases, but the present invention includes all isomers, such as geometric isomers, optical isomers based on asymmetric carbons, stereoisomers, tautomers, etc. Therefore, it should be understood that the definition of the compound of formula (I), (Ia), (Ib) and (II) includes each independent isomer corresponding to the chemical formula: formula (I), (Ia), (Ib) and (II), including cis-trans isomers, stereoisomers and tautomers, as well as racemic mixtures of these isomers and pharmaceutically acceptable salts thereof. Therefore, the definition of the compound of formula (I), (Ia), (Ib) and (II) is also intended to include all R- and S-isomers of the chemical structure in any proportion, for example, where one possible isomer is enriched (i.e., enantiomeric excess or diastereomeric excess) and the proportion of other isomers is correspondingly smaller. In addition, the compounds represented by formula (I), (Ia), (Ib) and (II) may exist in crystalline polymorphs. It should be noted that any crystalline form, crystalline form mixture or its anhydride or hydrate is included in the scope of the present invention. In addition, the so-called metabolites produced by the degradation of the present compound in vivo are also included in the scope of the present invention.

[0342] "Isomers" refers to compounds that have the same molecular formula but differ in the bonding sequence of their atoms or the arrangement of their atoms in space. Isomers whose atoms differ in the arrangement of space are termed "stereoisomers." Stereoisomers that are not mirror images of one another are termed "diastereomers," and stereoisomers that are non-superimposable mirror images of one another are termed "enantiomers," or sometimes optical isomers. A mixture containing equal amounts of individual enantiomers of opposite chirality is termed a "racemic mixture."

[0343] A carbon atom bonded to four non-identical substituents is called a "chiral center."

[0344] "Chiral isomer" refers to a compound with at least one chiral center. Compounds with more than one chiral center can exist as individual diastereomers, or as a mixture of diastereomers, called a "diastereomeric mixture." When one chiral center is present, the stereoisomer can be characterized by the absolute configuration (R or S) of that chiral center. The absolute configuration refers to the arrangement in space of the substituents attached to the chiral center. The substituents attached to the chiral center under consideration are ordered according to the ordering rules of Cahn, Ingold, and Prelog. (Cahn et al., Angew. Chem. Inter. Edit. 1966, 5, 385; errata 511; Cahn et al., Angew. Chem. 1966, 78, 413; Cahn and Ingold, J. Chem. Soc. 1951 (London), 612; Cahn et al., Experientia 1956, 12, 81; Cahn, J. Chem. Educ. 1964, 41, 116).

[0345] Diastereoisomers, i.e., non-superimposable stereochemical isomers, can be separated by conventional methods, such as chromatography, distillation, crystallization or sublimation. Optical isomers can be obtained by resolution of racemic mixtures in a conventional manner, such as by treatment with optically active acids or bases to form diastereomeric salts. Examples of suitable acids include, but are not limited to, tartaric acid, diacetyltartaric acid, dibenzoyltartaric acid, ditoluoyltartaric acid, and camphorsulfonic acid. Diastereomeric mixtures can be separated by crystallization and then the optically active base is released from these salts. An alternative method for separation of optical isomers includes the use of a chiral chromatographic column optimized to maximize the separation of enantiomers. There is another method available, including the synthesis of covalent diastereomeric molecules by reacting a compound of formula (I), (Ia), (Ib) or (II) with an activated form of an optically pure acid or an optically pure isocyanate. The synthesized diastereomers can be separated by conventional methods, such as chromatography, distillation, crystallization or sublimation, and then hydrolyzed to obtain enantiomerically pure compounds. Optically active compounds of formula (I), (Ia), (Ib) and (II) can also be obtained by using optically active starting materials and / or by using chiral catalysts. These isomers can be in the form of free acids, free bases, esters or salts. Examples of chiral separation techniques are given in Chiral Separation Techniques, A Practical Approach, by G. Subramanian, Wiley-VCH, 2001, 2nd edition.

[0346] "Geometric isomers" are diastereomers whose presence hinders rotation about a double bond. These configurations are distinguished in their names by the prefixes cis and trans, or Z and E, which indicate that the groups are located on the same or opposite sides of the double bond in the molecule according to the Cahn-Ingold-Prelog rules.

[0347] In addition, the structures and other compounds discussed in this invention include all atropisomers thereof. An "atropisomer" is a stereoisomer in which the atoms of the two isomers are arranged differently in space. Atropisomers have limited rotation due to their presence, which is caused by the hindered rotation of large groups around the central bond. Such atropisomers usually exist as a mixture, but due to recent advances in chromatographic techniques, it has become possible to separate mixtures of two atropisomers in certain circumstances.

[0348] A "tautomer" is one of two or more structural isomers that are in equilibrium and readily convertible from one isomeric form to another. This conversion results in a formal migration of hydrogen atoms with a concomitant switch of adjacent conjugated double bonds. Tautomers exist as a mixture of tautomeric groups in solution. In solid form, one tautomer usually predominates. In solutions where tautomerism is possible, the tautomers will be in chemical equilibrium. The exact ratio of tautomers depends on several factors, including temperature, solvent, and pH. The concept of tautomers that are interconvertible through tautomerism is called tautomerism.

[0349] Among the various possible tautomerisms, there are two common tautomerisms. In keto-enol tautomerism, electrons and hydrogen atoms are transferred simultaneously. Ring-chain tautomerism is caused by the reaction of the aldehyde group (-CHO) in the sugar chain molecule with a hydroxyl group (-OH) in the same molecule to give it a cyclic (ring-shaped) form as exhibited by glucose.

[0350] Common tautomer pairs include: keto-enol, amide-nitrile, lactam-lactam, amide-imidic acid tautomers in heterocycles (e.g., in nucleic acid bases, such as guanine, thymine and cytosine), amine-enamine and enamine-enamine. It should be understood that the compounds of the present invention can be described as different tautomers. It should also be understood that when a compound has a tautomeric form, all tautomeric forms are intended to be included within the scope of the present invention, and the naming of the compound does not exclude any tautomeric form.

[0351] The term "crystal polymorph", "polymorph", or "crystalline form" refers to a crystal structure in which a compound (or its salt or solvate) can crystallize in different crystal packing arrangements, all of which have the same elemental composition. Different crystal forms typically have different X-ray diffraction patterns, infrared spectra, melting points, density hardness, crystal shape, optical and electrical properties, stability and solubility. Recrystallization solvent, rate of crystallization, storage temperature and other factors may lead to one crystal form being dominant. Crystal polymorphs of a compound can be prepared by crystallization under different conditions.

[0352] In addition, the compounds of the present invention, for example, salts of the compounds, can exist in a hydrated or non-hydrated (anhydrous) form, or as a solvate with other solvent molecules. Non-limiting examples of hydrates include monohydrates, dihydrates, etc. Non-limiting examples of solvates include ethanol solvates, acetone solvates, etc.

[0353] "Solvate" refers to a form of a substance containing a stoichiometric or non-stoichiometric amount of solvent added. Some compounds tend to trap a fixed molar ratio of solvent molecules in the crystalline solid state, thus forming a solvate. If the solvent is water, the solvate formed is a hydrate; if the solvent is an alcohol, the solvate formed is an alcoholate. Hydrates are formed by the combination of one or more water molecules with a molecule of a substance, where the water remains in its molecular state as H2O.

[0354] The present invention is intended to include all isotopes of atoms present in the present compounds. Isotopes include those atoms having the same atomic number but different mass numbers. By way of general example and non-limiting manner, isotopes of hydrogen include tritium and deuterium, and isotopes of carbon include C-13 and C-14.

[0355] Throughout the description and claims of this specification, the words "include" and "contain" and variations of these words, such as "comprising" and "comprises", all mean "including but not limited to", and do not exclude other parts, additives, components, integers or steps. Throughout the description and claims of this specification, unless the context requires otherwise, the singular encompasses the plural. In particular when the indefinite article is used, the specification should be understood to contemplate the plural as well as the singular, unless the context requires otherwise.

[0356] All references cited in this specification, including any patents or patent applications, are hereby incorporated by reference. No admission is made that any reference constitutes prior art. Further, no admission is made that any prior art constitutes part of the common general knowledge in the art.

[0357] Process for preparing compounds of formula (I), (Ia), (Ib) and (II)

[0358] The compounds of the present invention (e.g., compounds of Formula (I), Formula (Ia), Formula (Ib), and Formula (II)) can be prepared by a variety of methods well known to those skilled in the art of organic synthesis. By way of example, the compounds of the present invention can be synthesized using the methods described below, as well as synthetic methods known in the art of organic chemical synthesis, or variations thereof known to those skilled in the art. Preferred methods include, but are not limited to, the methods described below. The final products of the reactions described herein can be separated by conventional techniques, for example, by extraction, crystallization, distillation, chromatography, and the like.

[0359] The compounds of the present invention can be synthesized according to the steps outlined in General Schemes A to E, which include different orders of assembling intermediates Ia-Ih and Ij-Io. The starting materials can be obtained commercially, or prepared by known processes of reported literature or as shown. Useful steps that may be used in the preparation steps of the compounds will be known to the technician. The following methods are given as non-limiting examples of how to prepare the compounds.

[0360] General Plan A

[0361]

[0362] Where R 1 , R c , R d and L are as defined in formula (I).

[0363] The general method for preparing compounds of formula (I) by using intermediates Ia and Ib is summarized in General Scheme A. Ia and Ib are optionally coupled at elevated temperatures using a base (i.e. potassium carbonate (K2CO3)) in a solvent (i.e. acetonitrile (CH3CN)) to provide production of the desired formula (I). Useful bases include, but are not limited to, sodium carbonate (Na2CO3), potassium carbonate (K2CO3), N,N-diisopropylethylamine (DIPEA) and triethylamine. The solvent used in the coupling reaction can be a polar or non-polar solvent. For example, the solvent can be acetonitrile (CH3CN), acetone, or dimethyl sulfoxide (DMSO).

[0364] General Plan B

[0365]

[0366] Where X is a good leaving group, i.e., Cl, Br, -SCH3, or S(O)2CH3, and R 1 , R 2 , R c , R d and p are as defined in formula (I).

[0367] Alternatively, compounds of formula (I) can be prepared using intermediates Ic and Id as outlined in general scheme B. Intermediate Ic is aminated with Ie using a base (i.e. sodium hydroxide (NaOH), potassium hydroxide (KOH), etc.) in a solvent (i.e. methanol (MeOH), ethanol (EtOH), water (H2O), etc.) to provide compounds of formula (I).

[0368] General Solution C

[0369]

[0370] Where X is a good leaving group, i.e., Cl, Br, -SCH3, or S(O)2CH3, and R 1 , R 2 , R c , R d and p are as defined in formula (I).

[0371] Compounds of formula (I) can also be prepared using intermediates Ie and If as outlined in General Scheme C. Intermediate Ie is aminated with If using a base (i.e. sodium hydroxide (NaOH), potassium hydroxide (KOH), etc.) in a solvent (i.e. methanol (MeOH), ethanol (EtOH), water (H2O), etc.) to provide compounds of formula (I).

[0372] General Solution D

[0373]

[0374] Where R 1 , R c and R d As defined in formula (I).

[0375] Alternatively, compounds of formula (I) can also be prepared using intermediates Ig, Ih, Ij, Ik and Im as outlined in General Scheme D. Intermediate Ig is olefinated using a base (i.e. potassium carbonate (KCO) and diethyl (cyanomethyl)phosphonate) in a solvent (i.e. tetrahydrofuran (THF), water (HO), optionally at elevated temperature) to provide intermediate Ih. Ih is hydrogenated using a metal catalyst (i.e. palladium on carbon (Pd / C), platinum dioxide (PtO), etc.) and hydrogen (H) in a solvent (i.e. ethanol (EtOH) and / or tetrahydrofuran (THF)) to provide intermediate Ij. Intermediate Ij is treated with an acid (i.e. hydrochloric acid (HCl)) in a solvent (i.e. ethanol (EtOH), dichloromethane (CHCl), etc.) followed by subsequent treatment with a base (i.e. ammonia (NH)) to provide intermediate Ik. Intermediates Ik and Im are cyclized using a base (ie, sodium hydroxide (NaOH), potassium hydroxide (KOH), etc.) in a solvent (ie, dimethylacetamide (DMA)), optionally at elevated temperature, to afford compounds of formula (I).

[0376] General Scheme E

[0377]

[0378] Where R 1 , R c and R d As defined in formula (I).

[0379] Alternatively, compounds of formula (I) can be prepared using intermediates In and Io as outlined in General Scheme D. Intermediate In is acylated with Io using a base (i.e., sodium hydroxide (NaOH), potassium hydroxide (KOH), etc.) in a solvent (i.e., methanol (MeOH), ethanol (EtOH), water (H2O), etc.) to provide compounds of formula (I).

[0380] Depending on the nature of the separation, the mixtures of enantiomers, diastereomers, cis / trans isomers obtained by the above process can be separated into their single components by chiral salt techniques, chromatography using normal phase, reverse phase or chiral columns.

[0381] It should be understood that in the descriptions and formulas presented above, unless otherwise specified, R 1 , R 2 , X, L, Y, R a , R b , R c , R d , R e , R f , R x , R y , R zThe various groups m, n, p, q, r and other variables are as defined above. In addition, for synthetic purposes, the compounds of General Schemes AE are merely representative selection groups to illustrate the general synthetic methods of compounds of Formula (I) as defined herein.

[0382] Treatment

[0383] The present invention provides a method of treating an acute inflammatory disease in a subject comprising administering a compound of Formula (I), Formula (Ia), Formula (Ib) or Formula (II).

[0384] Inflammation is a collection of changes that express a response to damage to cellular and vascularized tissue. When tissue damage occurs, whether it is caused by bacteria, trauma, chemicals, heat, or any other phenomenon, histamine substances and other humoral substances are released by the damaged tissue into the surrounding body fluids. This is a protective attempt by the body to eliminate the harmful stimulus and initiate the healing process.

[0385] The main features of the inflammatory response are vasodilation, the expansion of blood vessels to increase blood flow to the site of infection; increased vascular permeability to allow diffusible components to enter the site; cellular infiltration by chemotaxis; or the directed movement of inflammatory cells through the vessel wall into the site of injury; changes in the biosynthetic, metabolic, and catabolic profiles of many organs; and activation of immune system cells and complex enzyme systems in the plasma. However, uncontrolled inflammation can lead to many diseases, including acute hepatitis, acute pancreatitis, acute kidney disease, inflammatory bowel disease, inflammatory liver disease, rheumatoid arthritis, autoimmune diseases, sepsis, SIRS, and atherosclerosis.

[0386] Acute inflammation is the body's initial response to noxious stimuli and is achieved by increased movement of plasma and leukocytes from the blood that flow into injured tissues. Acute inflammation can be divided into several stages. The earliest event in the inflammatory response is transient vasoconstriction, a narrowing of the blood vessels caused by contraction of the smooth muscles in the vessel walls, which can be seen as whitening of the skin (blanching). The next few stages occur after minutes, hours, and days. The first is an acute vascular response within seconds of tissue injury and lasts for several minutes. This is due to changes in the vascular endothelium that lead to vasodilation and increased capillary permeability, resulting in increased blood flow (congestion), redness (erythema) and the entry of fluid into the tissues (edema).

[0387] The acute cellular response may be followed by an acute vascular response, which occurs within the next few hours. This phase is characterized by the presence of granulocytes, particularly neutrophils, in the tissues. These cells first attach themselves to the endothelial cells within the blood vessels (margination) and then penetrate into the surrounding tissues (diapedesis). During this phase, red blood cells may also infiltrate the tissues and bleeding may occur. If a blood vessel is damaged, fibrinogen and fibronectin are deposited at the site of injury, platelets aggregate and become activated, and red blood cells pile together in so-called "rouleaux" to help stop bleeding and aid clot formation. Dead and dying cells lead to pus formation. If the injury is severe enough, a chronic cellular response may develop over the next few days. This phase of inflammation is characterized by the presence of a mononuclear infiltrate consisting of macrophages and lymphocytes. Macrophages are involved in microbial killing, clearance of cells and tissue debris, and tissue remodeling.

[0388] Acute inflammation occurs immediately after injury and is a relatively short-term process, lasting a few days at most, in which cytokines and chemokines promote the migration of neutrophils and macrophages to the site of inflammation.

[0389] Liver-resident macrophages (Kupffer cells) are the first innate immune cells and protect the liver from bacterial infections. Under pathological conditions, they are activated by different components and can differentiate into M1-like (pro-inflammatory) or M2-like (anti-inflammatory) macrophages.

[0390] Kupffer cells can be activated to produce a variety of cytokines, eicosanoids, nitric oxide, and oxygen free radicals, and play different roles in tissue injury and tissue repair. Once the acute injury is controlled, Kupffer cells and other macrophages play a role in suppressing inflammation and initiating wound repair by clearing debris and producing growth factors and mediators to provide nutritional support to the tissues in which they reside.

[0391] Kupffer cell activation is involved in the liver's response to infection or injury; the resulting inflammatory response protects against infection and limits cellular and organ damage to the host.

[0392] However, in other types of liver injury, Kupffer cells cannot be properly controlled or deactivated. Control and proper resolution of inflammation are essential features of the innate immune response. This failure to deactivate Kupffer cells contributes to many chronic inflammatory diseases of the liver.

[0393] M1 and M2 macrophage populations differ in their ability to respond to different stimuli and in the chemokine / cytokine and receptor repertoires they express after activation. However, both become active macrophages with high synthesis and secretion of inflammatory mediators, including cytokines, superoxide, nitric oxide, eicosanoids, chemokines, and lysosomal and proteolytic enzymes. In addition, they exhibit high phagocytic and secretory activity.

[0394] Under physiological conditions, Kupffer cells are the first innate immune cells and protect the liver from bacterial infections. Under pathological conditions, they are activated by different components and can differentiate into M1-like (classical) or M2-like (alternative) macrophages. The metabolism of classically or alternatively activated Kupffer cells will determine their function in liver damage.

[0395] Kupffer cells are derived from monocytes and differentiate into liver-resident macrophages.

[0396] Liver-resident Kupffer cells initiate inflammation and help recruit blood-derived monocytes; both differentiate into proinflammatory macrophages and further promote NAFLD development.

[0397] Although Kupffer cells display M1-like features in acute liver injury, with ongoing chronic inflammation, M2-like macrophages appear due to the exhaustion of M1-like macrophages and immune cells, and secrete protective cytokines such as IL-4, IL-10, and TGF-β under chronic cytotoxic stimulation.

[0398] The direct effect of liver damage is the increase of hepatocyte necrosis, which is one of the main sources of Kupffer cell activators.

[0399] Chronic inflammation refers to inflammation that persists for months or years. Macrophages, lymphocytes, and plasma cells predominate in chronic inflammation, whereas neutrophils predominate in acute inflammation. Examples of diseases mediated by chronic inflammation include diabetes, cardiovascular disease, allergies, and chronic obstructive pulmonary disease (COPD).

[0400] Inflammatory cytokines can be divided into two categories: those involved in acute inflammation and those causing chronic inflammation. Those involved in acute inflammation include, for example, IL-1, TNF-α, IL-6, IL-11, IL-8, and other chemokines G-CSF and GM-CSF. Cytokines in chronic inflammation can be subdivided into cytokines that mediate humoral responses, such as IL-4, IL-5, IL-6, IL-7, and IL-13, and those that mediate cellular responses, such as IL-1, IL-2, IL-3, IL-4, IL-7, IL-9, IL-10, IL-12, interferon, transforming growth factor-β, tumor necrosis factor α and β. Some cytokines cause both acute and chronic inflammation.

[0401] As used herein, "cytokines" are molecules released by cells in response to infection or injury that stimulate inflammation or healing responses. Cytokines are produced by various cells of the body. The cytokine superfamily includes interleukins, chemokines, colony stimulating factors (CSFs), interferons, and the transforming growth factor (TNF) and tumor necrosis factor (TGF) families.

[0402] Cytokines are small secreted proteins released by cells that have specific effects on cell-to-cell interactions and communication. Subclasses of cytokines include lymphokines (cytokines produced by lymphocytes), monokines (cytokines produced by monocytes), chemokines (cytokines with chemotactic activity), and interleukins (cytokines produced by one type of white blood cell and acting on other white blood cells). Cytokines can act on the cell that secretes them (autocrine action), on neighboring cells (paracrine action), or in some cases on distant cells (endocrine action). There are two types of cytokines: pro-inflammatory cytokines and anti-inflammatory cytokines.

[0403] A variety of cytokines are known to induce chemotaxis. A subset of cytokines is known as chemokines. These factors represent a family of low molecular weight secretory proteins that play a major role in the activation and migration of leukocytes, although some of them also have a variety of other functions. Chemokines have conserved cysteine ​​residues that allow them to be divided into four categories: CC chemokines (RANTES, monocyte chemoattractant protein or MCP-1, monocyte inflammatory protein or MIP-1α and MIP-1β), CXC chemokines (IL-8, also known as growth-related oncogenes or GRO / KC), C chemokines (lymphocyte chemoattractant) and CXXXC chemokines (fractal chemokines).

[0404] The net effect of an inflammatory response can be determined by the balance between pro-inflammatory cytokines and anti-inflammatory cytokines. Pro-inflammatory cytokines are cytokines that promote inflammation. Pro-inflammatory cytokines are primarily produced by activated macrophages and are involved in the upregulation of inflammatory responses. Anti-inflammatory cytokines are a series of immunomodulatory molecules that control the response of pro-inflammatory cytokines. Cytokines come into contact with certain cytokine inhibitors and soluble cytokine receptors to modulate the body's immune response.

[0405] Proinflammatory cytokines are cytokines that promote inflammation. The main proinflammatory cytokines that play a role in the early response are IL-1α, IL-1β, IL-6, and TNF-α. Other proinflammatory mediators include IL-20 family members, IL-33LIF, IFN-γ, OSM, CNTF, TGF-β, GM-CSF, IL-11, IL-12, IL-17, IL-18, IL-8, and a variety of other chemokines that attract inflammatory cells. These cytokines act either as endogenous pyrogens (IL-1, IL-6, TNF-α), upregulating the synthesis of secondary mediators and proinflammatory cytokines by both macrophages and mesenchymal cells (including fibroblasts, epithelial cells, and endothelial cells), stimulating the production of acute phase proteins, or attracting inflammatory cells.

[0406] Anti-inflammatory cytokines are a family of immunomodulatory molecules that control pro-inflammatory cytokine responses. The major anti-inflammatory cytokines include interleukin (IL)-1 receptor antagonist, IL-4, IL-10, IL-11, and IL-13. Leukemia inhibitory factor, interferon-α, IL-6, and TGF-β are classified as anti-inflammatory or pro-inflammatory cytokines in different contexts.

[0407] Among anti-inflammatory cytokines, IL-10 is a cytokine with anti-inflammatory properties that inhibits the expression of inflammatory cytokines by activated macrophages, such as TNF-α, IL-6, and IL-1. In addition, IL-10 can upregulate endogenous anti-cytokines and downregulate pro-inflammatory cytokine receptors.

[0408] IL-6 is produced at sites of inflammation and plays a role in the acute phase response as defined by a variety of clinical and biological features, such as the production of acute phase proteins. Furthermore, IL-6 binding to its soluble receptor sIL-6Rα can determine the transition from acute to chronic inflammation by changing the nature of the leukocyte infiltrate (from polymorphonuclear neutrophils to monocytes / macrophages).

[0409] In certain embodiments, the method can reduce pro-inflammatory cytokines or increase anti-inflammatory cytokines.

[0410] In certain embodiments, the proinflammatory cytokine is IL-1β, IL-6, IL-18, TNF-α, or TGF-β. In certain embodiments, the proinflammatory cytokine is IL-18 or TNF-α. In certain embodiments, the proinflammatory cytokine is IL-6. In certain embodiments, the proinflammatory cytokine is TGF-β or TNF-α. In certain embodiments, the proinflammatory cytokine is IL-1β, IL-6, or TNF-α.

[0411] M1 macrophages, also known as classically activated macrophages, can respond to stimuli such as LPS or IFN-γ and are producers of pro-inflammatory cytokines. M2 macrophages, also known as alternatively activated macrophages, can respond to stimuli such as IL-4 or IL-13 and are producers of anti-inflammatory cytokines.

[0412] In certain embodiments, the proinflammatory cytokine is MCP-1, TNF-α, or IL-1β, and the proinflammatory cytokine is reduced.

[0413] In certain embodiments, the proinflammatory cytokine is IL-6 and the proinflammatory cytokine is reduced.

[0414] In certain embodiments, the anti-inflammatory cytokine is IL-10 (interleukin 10), and the anti-inflammatory cytokine is increased.

[0415] SIRT1, a known key metabolic regulator, can reprogram inflammation by altering histones and transcription factors such as NFκB and AP1. Accumulating evidence supports that inflammation sequentially links immune, metabolic, and mitochondrial bioenergetics networks; longevity factors are essential regulators of these networks.

[0416] In some embodiments, the expression of the longevity factor-1 regulatory gene increases. In some embodiments, the expression of the longevity factor-1 regulatory gene in the liver increases. In some embodiments, the expression of the longevity factor-1 regulatory gene sod2, tfam or dda1 increases. In some embodiments, the expression of the longevity factor-1 regulatory gene sod2, tfam or dda1 increases in the liver.

[0417] Inflammation is a cascade of events involving many cells and humoral mediators. On the one hand, the inhibition of inflammatory responses can make the subject immunocompromised. However, if left unchecked, inflammation can lead to serious complications, including chronic inflammatory diseases (such as asthma, psoriasis, arthritis, rheumatoid arthritis and multiple sclerosis, etc.), septic shock and multiple organ failure. These different diseases all share common inflammatory mediators, such as cytokines, chemokines, inflammatory cells and other mediators secreted by these cells.

[0418] Inflammation can be systemic, or it can affect one tissue.

[0419] In certain embodiments, the acute inflammatory disease is a systemic inflammatory disease. A systemic inflammatory disease refers to a disease or disorder involving at least two organ systems.

[0420] In one embodiment, systemic inflammatory diseases include SIRS and sepsis. In certain embodiments, systemic inflammatory diseases are one or more of SIRS and sepsis. In certain embodiments, systemic inflammatory diseases are one or more of SIRS, abdominal sepsis, and pulmonary sepsis. In certain embodiments, systemic inflammatory diseases may be associated with various infections, including bacterial, viral, or fungal infections. In certain embodiments, systemic inflammatory diseases may be associated with viral infections, such as COVID.

[0421] Systemic inflammatory response syndrome (SIRS) is a systemic inflammatory response syndrome without signs of infection. This disorder may also be referred to as "non-infectious SIRS" or "SIRS without infection." SIRS is characterized by the presence of at least two of the following four clinical symptoms: fever or hypothermia (temperature 38.0°C (100.4°F) or above, or temperature 36.0°C (96.8°F) or below); tachycardia (at least 90 breaths per minute); tachypnea (at least 20 breaths per minute or PaCC>2 less than 4.3 kPa (32.0 mmHg) or requiring mechanical ventilation); altered white blood cell (WBC) count, 12×10 6 cells / mL or more, or altered WBC count, 4×10 6 cells / mL or less, or the presence of more than 10% of band cells (immature neutrophils).

[0422] Sepsis refers to a systemic inflammatory disease caused by infection. The focus of infection is defined as represented by (i) an organism growing in the blood or a sterile site; or (ii) an abscess or infected tissue (e.g., pneumonia, peritonitis, urinary tract, vascular line infection, soft tissue). In one embodiment, the infection may be a bacterial infection. The presence of sepsis is characterized by the presence of at least two of the four criteria for the systemic inflammatory response syndrome (SIRS) defined above.

[0423] Cytokine storm or hypercytokinemia is a potentially fatal immune response and involves a positive feedback loop between cytokines and immune cells, which leads to greatly elevated levels of various cytokines in the body. Cytokine storms typically involve elevated concentrations of cytokines such as interferons, interleukins, chemokines, colony stimulating factors, and tumor necrosis factors. This immune dysregulation may be the underlying factor in many infections leading to death.

[0424] Catastrophic antiphospholipid syndrome is a potentially life-threatening condition characterized by diffuse vascular thrombosis leading to multi-organ failure in a short period of time in the presence of positive antiphospholipid antibodies (aPL). Its onset is acute, with thrombocytopenia in most cases and less frequently hemolytic anemia and disseminated intravascular coagulation. The syndrome is caused by antiphospholipid antibodies directed against a group of proteins associated with phospholipids in the body. These antibodies activate endothelial cells, platelets, and immune cells, ultimately causing a massive inflammatory immune response and widespread coagulation.

[0425] Graft versus host disease (GVHD) is a syndrome characterized by inflammation of various organs, with specificity for epithelial cell apoptosis and crypt shedding. GVHD is commonly associated with bone marrow transplants, stem cell transplants, and other forms of transplanted tissue (e.g., solid organ transplants). White blood cells from the donor's immune system that remain within the donor tissue (graft) recognize the recipient (host) as foreign (non-self). The white blood cells present within the transplanted tissue then attack cells within the recipient, which results in GVHD.

[0426] In certain embodiments, the acute inflammatory disease is systemic inflammatory response syndrome (SIRS), shock, sepsis, cytokine storm or hypercytokineemia, catastrophic antiphospholipid syndrome, or graft-versus-host disease (GVHD).

[0427] Inflammatory diseases include inflammatory lung diseases. Some inflammatory lung diseases include infection-induced lung diseases, including those lung diseases related to virus, bacteria, fungi, parasites or prion infections. Inflammatory diseases also include community-acquired pneumonia, hospital-acquired pneumonia, ventilator-associated pneumonia, sepsis, viral pneumonia, influenza infection, parainfluenza infection, rotavirus infection, human metapneumovirus infection, respiratory syncytial virus infection and aspergillus or other fungal infections. Some inflammatory diseases related to infection can include viral or bacterial pneumonia (including severe pneumonia) and acute respiratory distress syndrome (ARDS). These infection-related diseases can relate to multiple infections, such as primary viral infection and secondary bacterial infection.

[0428] In certain embodiments, the acute inflammatory disease is acute respiratory distress syndrome (ARDS), severe acute respiratory distress syndrome (SARS), a viral infection, a bacterial infection, a fungal infection, influenza, or pneumonia.

[0429] In certain embodiments, the acute inflammatory disease is cytokine storm or hypercytokineemia, systemic inflammatory response syndrome (SIRS), graft-versus-host disease (GVHD), acute respiratory distress syndrome (ARDS), severe acute respiratory distress syndrome (SARS), catastrophic antiphospholipid syndrome, viral infection, bacterial infection, fungal infection, influenza, pneumonia, shock, or sepsis.

[0430] In certain embodiments, the acute inflammatory disorder is an organ-specific or tissue-specific disease. Certain tissues affected are the pancreas, liver tissue, respiratory tract, lung, gastrointestinal tract, small intestine, large intestine, colon, rectum, cardiovascular system, heart tissue, blood vessels, joints, bone and synovial tissue, cartilage, epithelium, endothelium, or adipose tissue.

[0431] In certain embodiments, the acute inflammatory disease is acute pancreatitis, hepatitis, respiratory disease, or enterocolitis.

[0432] Pharmaceutical composition

[0433] The compounds of Formula (I), Formula (Ia), Formula (Ib) or Formula (II) may be provided in any form suitable for the intended administration, including in particular pharmaceutically acceptable salts, solvates and prodrugs of the compounds of Formula (I), Formula (Ia), Formula (Ib) or Formula (II).

[0434] Pharmaceutically acceptable salts refer to salts of compounds of formula (I), (Ia), (Ib) or (II) that are considered acceptable for clinical and / or veterinary use. Typical pharmaceutically acceptable salts include those prepared by reacting compounds of formula (I), (Ia), (Ib) or (II) with mineral or organic acids or organic or inorganic bases. Such salts are referred to as acid addition salts and base addition salts, respectively. It can be considered that the specific counter ion that forms part of any salt is not critical, as long as the salt as a whole is pharmaceutically acceptable and as long as the counter ion does not produce undesirable properties to the salt as a whole. These salts can be prepared by methods known to technicians. Pharmaceutically acceptable salts are, for example, those described and discussed in Remington's Pharmaceutical Sciences, 17. Ed. Alfonso R. Gennaro (Ed.), Mack Publishing Company, Easton, PA, USA, 1985 and the most recent edition of Encyclopedia of Pharmaceutical Technology.

[0435] Examples of pharmaceutically acceptable addition salts include those with inorganic acids (e.g., hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, hydroiodic acid, metaphosphoric acid or phosphoric acid) and organic acids (e.g., succinic acid, maleic acid, acetic acid, fumaric acid, citric acid, tartaric acid, benzoic acid, trifluoroacetic acid, malic acid, lactic acid, formic acid, propionic acid, glycolic acid, gluconic acid, camphorsulfonic acid, isothiocyanic acid, mucic acid, gentisic acid, isonicotinic acid, uronic acid, glucuronic acid, furoic acid, glutamic acid, ascorbic acid, anthranilic acid, salicylic acid, The invention relates to pharmaceutically acceptable salts of the present invention, wherein the pharmaceutically acceptable salts are selected from the group consisting of phenylacetic acid, mandelic acid, pamoic acid (pamoic acid), ethanesulfonic acid, pantothenic acid, stearic acid, p-aminobenzenesulfonic acid, alginic acid and galacturonic acid; and arylsulfonic acids, such as benzenesulfonic acid, p-toluenesulfonic acid, methanesulfonic acid or naphthalenesulfonic acid) acid addition salts; alkali metal and alkaline earth metal bases (such as N, N-dibenzylethylenediamine, chloroprocaine, choline, diethanolamine, ethylenediamine, meglumine (N-methylglucamine), lysine and procaine) base addition salts, and internally formed salts. It should be understood that all references to pharmaceutically acceptable salts include solvent addition forms (solvates) or crystal forms (polymorphs) of the same salt as defined herein.

[0436] The compound of formula (I), formula (Ia), formula (Ib) or formula (II), or a pharmaceutically acceptable salt thereof, can be provided in a soluble or insoluble form together with a pharmaceutically acceptable solvent (e.g., water, ethanol, etc.). The soluble form can also include a hydrated form, such as a monohydrate, a dihydrate, a hemihydrate, a trihydrate, a tetrahydrate, etc.

[0437] The compounds of formula (I), (Ia), (Ib) or (II), or pharmaceutically acceptable salts thereof, may be provided as prodrugs. As used herein, the term "prodrug" is intended to refer to compounds that, when exposed to certain physiological conditions, will release the compounds of formula (I), (Ia), (Ib) or (II), or pharmaceutically acceptable salts thereof, which are then able to exhibit the desired biological effect. Typical examples are unstable carbamates of amines.

[0438] Because known prodrugs can improve many desired properties (such as solubility, bioavailability, manufacturability, etc.) of drugs, the compounds of the present invention can be delivered in prodrug form. Therefore, the present invention is intended to cover the prodrug of the compound of the present claim, the method for delivering the prodrug and the composition containing the prodrug." prodrug" is intended to include any covalently linked carriers, and when these prodrugs are applied to a subject, these carriers release the active parent drug of the present invention in vivo. The prodrug of the present invention is prepared by modifying the functional group present in the compound, and these modifications are cleaved into parent compounds in conventional operations or in vivo in this way. Prodrugs include compounds of the present invention, wherein hydroxyl, amino, sulfhydryl, carboxyl or carbonyl are bonded to any group that can be cleaved in vivo, to form free hydroxyl, free amino, free sulfhydryl, free carboxyl, or free carbonyl respectively.

[0439] Examples of prodrugs include, but are not limited to, esters of hydroxy functional groups (e.g., acetate, dialkylaminoacetate, formates, phosphates, sulfates, and benzoate derivatives) and carbamates (e.g., N,N-dimethylaminocarbonyl), esters of carboxyl functional groups (e.g., C 1-6 Alkyl esters, such as methyl ester, ethyl ester, 2-propyl ester, phenyl ester, 2-aminoethyl ester, morpholinoethanol ester, etc.), N-acyl derivatives of amino functional groups (such as N-acetyl), N-Mannich bases, Schiff bases and enamino ketones, oximes, acetals, ketals and enol esters of ketone and aldehyde functional groups in the compounds of the present invention, etc. See Bundegaard, H., Design of Prodrugs, p1-92, Elesevier, New York-Oxford (1985).

[0440] The compound or its pharmaceutically acceptable salt, ester or prodrug is administered orally, nasally, transdermally, pulmonary, inhaled, buccal, sublingually, intraperitoneally, subcutaneously, intramuscularly, intravenously, rectally, intrapleurally, intrathecally and parenterally. In one embodiment, the compound is administered orally. Those skilled in the art will recognize the advantages of certain routes of administration.

[0441] The dosage regimen for using the compound is selected based on various factors, including the type, species, age, weight, sex and physical condition of the patient; the severity of the disease to be treated; the route of administration; the renal and liver function of the patient; and the specific compound or salt thereof used. An ordinary skilled physician or veterinarian can readily determine and prescribe the effective amount of the drug required to prevent, counter or arrest the progress of the disease.

[0442] The preparation and administration techniques of the compounds disclosed in the present invention can be found in Remington: the Science and Practice of Pharmacy, 19 th edition, Mack Publishing Co., Easton, PA (1995). In one embodiment, the compounds described herein, and pharmaceutically acceptable salts thereof, are combined with pharmaceutically acceptable carriers or diluents for use in pharmaceutical preparations. Suitable pharmaceutically acceptable carriers include inert solid fillers or diluents and sterile aqueous or organic solutions. The content of the compound in such pharmaceutical compositions is sufficient to provide the desired dosage within the range described herein.

[0443] In one aspect of the invention, a pharmaceutical composition is provided, comprising at least one compound of formula (I), formula (Ia), formula (Ib) or formula (II) as defined herein, or a pharmaceutically acceptable salt thereof, as an active ingredient, and optionally one or more pharmaceutically acceptable excipients, diluents and / or carriers. The compound of formula (I), formula (Ia), formula (Ib) or formula (II) or a pharmaceutically acceptable salt thereof can be administered alone or in combination with a pharmaceutically acceptable carrier, diluent or excipient in a single dose or multiple doses. Suitable pharmaceutically acceptable carriers, diluents and excipients include inert solid diluents or fillers, sterile aqueous solutions and various organic solvents.

[0444] A "pharmaceutical composition" is a preparation containing a compound of the invention in a form suitable for administration to a subject. The pharmaceutical composition can be formulated with a pharmaceutically acceptable carrier or diluent and any other known adjuvants and excipients according to conventional techniques, such as those disclosed in Remington: The Science and Practice of Pharmacy, 21st Edition, 2000, Lippincott Williams & Wilkins.

[0445] As used herein, the phrase "pharmaceutically acceptable" refers to those compounds, materials, compositions, carriers and / or dosage forms which are, within the scope of sound medical judgment, suitable for use in contact with the tissues of human beings and animals without excessive toxicity, irritation, allergic response, or other problems or complications, and are commensurate with a reasonable benefit / risk ratio.

[0446] "Pharmaceutically acceptable excipient" refers to an excipient useful in preparing a pharmaceutical composition, which is generally safe, non-toxic, and has no adverse effects biologically or otherwise, and includes excipients acceptable for veterinary use as well as human pharmaceutical use. "Pharmaceutically acceptable excipient" as used in the specification and claims includes one or more such excipients.

[0447] The pharmaceutical composition formed by combining a compound of formula (I), formula (Ia), formula (Ib) or formula (II) as defined herein or a pharmaceutically acceptable salt thereof with a pharmaceutically acceptable carrier, diluent or excipient can be conveniently administered in a variety of dosage forms (e.g., tablets, powders, lozenges, syrups, suppositories, injections, etc.). In powders, the carrier is a finely divided solid, such as talc or starch, which is mixed with the finely divided active ingredient. In tablets, the active ingredient is mixed with a carrier having the necessary binding properties in appropriate proportions and compressed into the desired shape and size.

[0448] The pharmaceutical composition can be specially prepared for administration by any suitable route, such as oral and parenteral (including subcutaneous, intramuscular, intrathecal, intravenous and intradermal) routes. It will be appreciated that the preferred route will depend on the general condition and age of the subject to be treated, the nature of the disease to be treated and the active ingredient selected.

[0449] Pharmaceutical compositions for oral administration include solid dosage forms such as capsules, tablets, dragees, pills, lozenges, powders and granules. Where appropriate, they may be prepared using coatings such as enteric coatings, or they may be prepared according to methods well known in the art to provide controlled release of the active ingredient, such as sustained release or extended release.

[0450] For oral administration in tablet or capsule form, a compound of formula (I), formula (Ia), formula (Ib) or formula (II) as defined herein, or a pharmaceutically acceptable salt thereof, may be suitably combined with an oral, non-toxic, pharmaceutically acceptable carrier (e.g., ethanol, glycerol, water, etc.). In addition, suitable binders, lubricants, disintegrants, flavoring agents and coloring agents may be added to the mixture as appropriate. Suitable binders include, for example, lactose, glucose, starch, gelatin, acacia gum, tragacanth gum, sodium alginate, carboxymethyl cellulose, polyethylene glycol, wax, etc. Lubricants include, for example, sodium oleate, sodium stearate, magnesium stearate, sodium benzoate, sodium acetate, sodium chloride, etc. Disintegrants include, for example, starch, methylcellulose, agar, bentonite, xanthan gum, sodium starch glycolate, cross-linked polyvinylpyrrolidone, cross-linked sodium carboxymethyl cellulose, etc. Other excipients for capsules include macrogranular gelatin or lipids.

[0451] For the preparation of solid compositions, such as tablets, the active compound of formula (I), formula (la), formula (lb) or formula (II) or a pharmaceutically acceptable salt thereof is mixed with one or more excipients (such as those described above) and other pharmaceutical diluents (such as water) to prepare a solid preformulation composition containing a homogeneous mixture of the compound of formula (I), formula (la), formula (lb) or formula (II) or a pharmaceutically acceptable salt thereof. The term "homogeneous" is understood to mean that the compound of formula (I), formula (la), formula (lb) or formula (II) or a pharmaceutically acceptable salt thereof is uniformly dispersed throughout the composition so that the composition can be easily subdivided into equally effective unit dosage forms, such as tablets or capsules.

[0452] Liquid compositions of formula (I), formula (Ia), formula (Ib) or formula (II) compounds or their pharmaceutically acceptable salts for oral or parenteral administration include, for example, aqueous solutions, syrups, elixirs, aqueous or oily suspensions, and emulsions with edible oils (e.g., cottonseed oil, sesame oil, coconut oil or peanut oil). Suitable dispersants or suspending agents for aqueous suspensions include synthetic or natural gums, such as tragacanth, alginate, acacia gum, dextran, sodium carboxymethylcellulose, gelatin, methylcellulose, or polyvinylpyrrolidone.

[0453] Pharmaceutical compositions for parenteral administration include sterile aqueous and non-aqueous injection solutions, dispersions, suspensions or emulsions, and sterile powders to be reconstituted in sterile injection solutions or dispersions before use.

[0454] For intravenous administration, suitable carriers include physiological saline, bacteriostatic water, Cremophor EL TM (BASF, Parsippany, NJ) or phosphate buffered saline (PBS). In all cases, the composition must be sterile and the fluidity should be such that it is easy to inject. It must be stable under production and storage conditions and must prevent the contaminating effects of microorganisms (e.g., bacteria and fungi). The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyols (e.g., glycerol, propylene glycol, and liquid polyethylene glycol, etc.) and suitable mixtures thereof. For example, suitable fluidity can be maintained by using a coating such as lecithin, by maintaining the desired particle size under dispersion conditions, and by using a surfactant. The protective effect of microorganisms can be achieved by various antibacterial and antifungal agents (e.g., parabens, chlorobutanol, phenol, ascorbic acid, thimerosal, etc.). In many cases, it is preferred to include isotonic agents such as sugars, polyols (e.g., mannitol, sorbitol), and sodium chloride in the composition. Prolonged absorption of the injection composition can be brought about by including an agent that delays absorption in the composition, such as aluminum monostearate and gelatin.

[0455] The preparation of all these solutions under sterile conditions is readily accomplished by standard pharmaceutical techniques well known to those skilled in the art.

[0456] For example, sterile injections can be prepared by adding the required amount of active compound and the combination of one or more ingredients listed above to an appropriate solvent as required, and then filtering and sterilizing. Typically, dispersions are prepared by adding the active compound to a sterile solvent containing a basic dispersion medium and other required ingredients selected from those listed above. In the case of sterile powders for the preparation of sterile injections, the preparation method is vacuum drying and freeze drying to obtain a powder of the active ingredient and any other required ingredients from its previous sterile filtered solution. Long-acting injection compositions are also considered to belong to the scope of the present invention.

[0457] For parenteral administration, solutions containing a compound of Formula (I), (Ia), (Ib) or (II) or a pharmaceutically acceptable salt thereof in sesame or peanut oil, propylene glycol in water or in a sterile aqueous solution may be used. If necessary, these aqueous solutions should be appropriately buffered and the liquid diluent first rendered isotonic with sufficient saline or glucose. These particular aqueous solutions are particularly suitable for intravenous, intramuscular, subcutaneous and intraperitoneal administration. Oily solutions are suitable for intraarticular, intramuscular and subcutaneous injection applications.

[0458] In addition to the above ingredients, the composition of the compound of formula (I), formula (Ia), formula (Ib) or formula (II), or a pharmaceutically acceptable salt thereof, may include one or more additional ingredients, such as diluents, buffers, flavoring agents, colorants, surfactants, thickeners, preservatives such as methyl hydroxybenzoate (including antioxidants), emulsifiers, etc.

[0459] As used herein, the term "therapeutically effective amount" refers to an amount of drug used to treat, improve or prevent an established disease, disorder or symptom, or to exhibit a detectable therapeutic or inhibitory effect. The effect can be detected by any detection method known in the art. The exact effective amount for a subject depends on the subject's weight, size and health; the nature and extent of the disease; and the treatment method or combination of treatments selected for administration. The therapeutically effective amount for a given situation can be determined by routine experimentation and is within the skill and judgment of the clinician. In a preferred aspect, the disease or disorder to be treated is a disease or disorder associated with alpha-amino-beta-carboxymuconate-epsilon-semialdehyde decarboxylase (ACMSD) dysfunction. In a preferred aspect, the disease or disorder is treated by inhibiting alpha-amino-beta-carboxymuconate-epsilon-semialdehyde decarboxylase (ACMSD). In certain embodiments, the disease or disorder is an acute inflammatory disease.

[0460] For any compound, the therapeutically effective amount can be estimated initially in cell culture assays (e.g., cells) or in animal models (usually rats, mice, rabbits, dogs, or pigs). Animal models can also be used to determine appropriate concentration ranges and routes of administration. This information can then be used to determine useful doses and routes of administration for humans. Therapeutic / prophylactic effects and toxicity can be determined by standard pharmaceutical procedures in cell cultures or experimental animals, such as ED 50 (the therapeutic dose effective in 50% of the population) and LD 50 (lethal dose for 50% of the population). The dose ratio between toxic and therapeutic effects is the therapeutic index, which can be expressed as LD 50 / ED 50The ratio of . Pharmaceutical compositions that exhibit a larger therapeutic index are preferred. The dosage can vary within this range, depending on the dosage form used, the sensitivity of the patient and the route of administration.

[0461] Dosage and administration are adjusted to provide sufficient levels of active agent or to maintain the desired effect. Factors that may be incorporated include the severity of the disease state, the general health of the subject, the age, weight and sex of the subject, diet, dosing time and frequency, drug combination, reaction sensitivity, and tolerance / response to treatment. Long-acting pharmaceutical compositions can be administered once every 3 to 4 days, weekly, or every two weeks, depending on the half-life and clearance rate of the particular formulation.

[0462] The appropriate dosage of a compound of formula (I), formula (Ia), formula (Ib) or formula (II), or a pharmaceutically acceptable salt thereof will depend on the age and condition of the patient, the severity of the disease to be treated, and other factors known to practitioners. For example, the compound can be administered orally, parenterally, or topically according to different dosing regimens (e.g., daily or at intervals, e.g., one week apart). Typically, a single dose is within the range of 0.01 to 500 mg / kg body weight, preferably about 0.05 to 100 mg / kg body weight, more preferably between 0.1 to 50 mg / kg body weight, and most preferably between 0.1 to 25 mg / kg body weight. The compound can be administered as a single dose (i.e., a one-time administration of the entire daily dose) or twice or more per day in divided doses. Changes based on the above dosage range can be made by a physician with ordinary skills, taking into account known factors, such as the weight, age and condition of the person being treated, the severity of the disease, and a specific route of administration.

[0463] As used herein, a "subject" or "subject in need thereof" is a subject suffering from a disease or disorder associated with an acute inflammatory disease. In other embodiments, the subject suffers from a disease or disorder associated with the regulation of α-amino-β-carboxymuconate-ε-semialdehyde decarboxylase (ACMSD). In other embodiments, the subject suffers from a disease or disorder associated with NAD + A "subject" includes a mammal. The mammal can be, for example, any mammal, such as a human, a primate, a bird, a mouse, a rat, a poultry, a dog, a cat, a cow, a horse, a goat, a camel, a sheep or a pig. Preferably, the mammal is a human.

[0464] Formula (I), formula (Ia), formula (Ib) or formula (II) compound, or its pharmaceutically acceptable salt can also be prepared into pharmaceutical composition, it comprises one or more other single active substances, or with pharmaceutically acceptable carrier, diluent or excipient in single dose or multiple dose combination. Suitable pharmaceutically acceptable carrier, diluent and excipient are as described above, and described one or more other active substances can be any active substance, or preferably as described in the "combination therapy" section below.

[0465] Exemplary Embodiments

[0466] Embodiment I-1a. A method of treating an acute inflammatory disease in a subject, comprising administering to the subject a therapeutically effective amount of a compound represented by formula (I):

[0467]

[0468] or a pharmaceutically acceptable salt or tautomer thereof,

[0469] in:

[0470] X is O or OH;

[0471] L is –(CH2)mCH2CH2-, –(CH2)mY(CH2)p-, –(CH2)mC(O)(CH2)p-, –(CH2)mC(O)O(CH2)p-, –(CH2)mC(O)NR 2 (CH2)p-, or -(CH2)mNR 2 C(O)(CH2)p;

[0472] Y is O, N or S(O)q;

[0473] R 1 It is C6-C 10 aryl or heteroaryl, wherein the aryl or heteroaryl is replaced by R a and R b and optionally one or more R e replace;

[0474] R 2 Is H or C6-C 10 alkyl;

[0475] R a and R b One of them is hydrogen and the other is -(CH2) r CO2R x 、-OCH2CO2R x 、-(CH2) r Tetrazolyl, -(CH2) rOxadiazolone, -(CH2) r Tetrazodone, -(CH2) r Dihydrotetrazodone, -(CH2) r Thiadiazole, -(CH2) r Isoxazol-3-ol, -(CH2) r P(O)(OH)OR x 、-(CH2) r S(O)2OH, -(CH2) r C(O)NHCN, or -(CH2) r C(O)NHS(O)2alkyl;

[0476] R c H, C1-C6 alkyl, C1-C6 haloalkyl, halogen, –CN, –OR x 、-CO2R x , or NO2;

[0477] R d is methyl, optionally substituted 5- to 10-membered aryl, optionally substituted 5- or 6-membered heteroaryl, or optionally substituted 5- or 6-membered carbocyclic ring;

[0478] Each R x is independently at each occurrence hydrogen or C1-C6 alkyl;

[0479] Each R e are independently C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, halogen, -OR y , C1-C6 haloalkyl, -NHR z , -OH, or -CN;

[0480] R f It is H or not present;

[0481] Each R y and R z are independently hydrogen, C1-C6 alkyl, or C1-C6 haloalkyl;

[0482] Each m and p is independently 0, 1 or 2, where m+p<3;

[0483] q is 0, 1, or 2;

[0484] r is 0 or 1; and

[0485] Dashed lines are optional double bonds;

[0486] Additional conditions: when X is O, L is –SCH2-, and R d When R is an optionally substituted phenyl group, cis not hydrogen or –CN, when X is O, L is –SCH2-, and R d When it is methyl, R c is not C1-C6 alkyl, and when X is O, L is –SCH2- and R d When it is 2-furanyl, R c Not –CN.

[0487] Embodiment I-1a. A method of treating an acute inflammatory disease in a subject, comprising administering to the subject a therapeutically effective amount of a compound represented by formula (I):

[0488]

[0489] or a pharmaceutically acceptable salt or tautomer thereof,

[0490] in:

[0491] X is O or OH;

[0492] L is –(CH2)mCH2CH2-, –(CH2)mY(CH2)p-, –(CH2)mC(O)(CH2)p-, –(CH2)mC(O)O(CH2)p-, –(CH2)mC(O)NR 2 (CH2)p-, or -(CH2)mNR 2 C(O)(CH2)p;

[0493] Y is O, N or S(O)q;

[0494] R 1 It is C6-C 10 aryl or heteroaryl, wherein the aryl or heteroaryl is replaced by R a and R b and optionally one or more R e replace;

[0495] R 2 Is H or C6-C 10 alkyl;

[0496] R a and R b One of them is hydrogen and the other is -(CH2) r CO2R x 、-OCH2CO2R x 、-(CH2) r Tetrazolyl, -(CH2) r Oxadiazolone, -(CH2) r Tetrazodone, -(CH2) r Dihydrotetrazodone, -(CH2) rThiadiazole, -(CH2) r Isoxazol-3-ol, -(CH2) r P(O)(OH)OR x 、-(CH2) r S(O)2OH, -(CH2) r C(O)NHCN, or -(CH2) r C(O)NHS(O)2alkyl;

[0497] R c H, C1-C6 alkyl, C1-C6 haloalkyl, halogen, –CN, –OR x 、-CO2R x , or NO2;

[0498] R d is methyl, optionally substituted 5- to 10-membered aryl, optionally substituted 5- or 6-membered heteroaryl, or optionally substituted 5- or 6-membered carbocyclic ring;

[0499] Each R x is independently at each occurrence hydrogen or C1-C6 alkyl;

[0500] Each R e are independently C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, halogen, -OR y , C1-C6 haloalkyl, -NHR z , -OH, or -CN;

[0501] R f It is H or not present;

[0502] Each R y and R z are independently hydrogen, C1-C6 alkyl, or C1-C6 haloalkyl;

[0503] Each m and p is independently 0, 1 or 2, where m+p<3;

[0504] q is 0, 1, or 2;

[0505] r is 0 or 1; and

[0506] Dashed lines are optional double bonds;

[0507] Additional conditions: when X is O, L is –SCH2-, and R d When R is an optionally substituted phenyl group, c is not hydrogen or –CN, when X is O, L is –SCH2-, and R d When it is methyl, R c is not C1-C6 alkyl, and when X is O, L is –SCH2- and Rd When it is 2-furanyl, R c Not –CN.

[0508] Embodiment I-2. The method of embodiment I-1, wherein the compound is represented by formula (Ia):

[0509]

[0510] or a pharmaceutically acceptable salt or tautomer thereof.

[0511] Embodiment I-3. The method of embodiment I-1 or I-2, wherein the compound is represented by formula (Ib):

[0512]

[0513] or a pharmaceutically acceptable salt thereof, wherein n is 0, 1, 2 or 3.

[0514] Embodiment I-4. The method of any one of Embodiments I-1 to I-3,

[0515] in:

[0516] R a and R b One of them is hydrogen and the other is CO2R x 、CH2CO2R x , tetrazole, or oxadiazolone;

[0517] R c Halogen, –CN, –OR x , or C1-C6 alkyl;

[0518] R d is methyl, optionally substituted 5- to 10-membered aryl, optionally substituted 5- or 6-membered heteroaryl, or optionally substituted 5- or 6-membered carbocyclic ring; and

[0519] R x is hydrogen or C1-C6 alkyl;

[0520] Each R e are independently C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, halogen, -OR y , C1-C6 haloalkyl, -NHR z , -OH, or -CN;

[0521] Each R y and R z are independently hydrogen, C1-C6 alkyl, or C1-C6 haloalkyl; and

[0522] n is 0, 1, 2, or 3;

[0523] The additional condition is: when R d When R is an optionally substituted phenyl group, c is not hydrogen or –CN, when R d When it is 2-furanyl, R c Not –CN.

[0524] Embodiment I-5. The method of any one of Embodiments I-1 to I-3, wherein the compound is represented by formula (II):

[0525]

[0526] or a pharmaceutically acceptable salt thereof.

[0527] Embodiment I-6. The method of embodiment I-5, wherein R c Is halogen, –CN, –OR x or C1-C6 alkyl, R d is methyl, optionally substituted 5- to 10-membered aryl, optionally substituted 5- or 6-membered heteroaryl, or optionally substituted 5- or 6-membered carbocyclic ring, and R x It is hydrogen or C1-C6 alkyl.

[0528] Embodiment I-7. The method of any one of Embodiments I-1 to I-6, wherein R c It is –CN or halogen.

[0529] Embodiment I-8. The method of any one of Embodiments I-1 to I-7, wherein R d is methyl, cyclohexyl, pyridyl, thiazolyl, phenyl, or thienyl.

[0530] Embodiment I-9. The method of any one of Embodiments I-1 to I-7, wherein R d is methyl, cyclohexyl, pyridyl, thiazolyl, thienyl, or optionally substituted phenyl.

[0531] Embodiment I-10. The method of any one of Embodiments I-1 to I-4, wherein R a is hydrogen, CH2CO2H, tetrazole, or oxadiazolone (1,2,4-oxadiazol-5(4H)-one).

[0532] Embodiment I-11. The method of any one of Embodiments I-1 to I-4, wherein R b is hydrogen, CH2CO2H, tetrazole, or oxadiazolone (1,2,4-oxadiazol-5(4H)-one).

[0533] Embodiment I-12. The method of any one of Embodiments I-1 to I-4, wherein n is 0.

[0534] Embodiment I-13. The method of embodiment I-1, wherein the compound is selected from the group consisting of:

[0535]

[0536] or a pharmaceutically acceptable salt thereof.

[0537] Embodiment I-14. The method of embodiment I-1, wherein the compound is selected from the group consisting of:

[0538]

[0539]

[0540] or a pharmaceutically acceptable salt thereof.

[0541] Embodiment I-15. The method of embodiment I-1, wherein the compound is selected from the group consisting of:

[0542]

[0543] or a pharmaceutically acceptable salt thereof.

[0544] Embodiment I-16. The method of embodiment I-1, wherein the compound is

[0545] or a pharmaceutically acceptable salt thereof.

[0546] Embodiment I-17. The method of embodiment I-1, wherein the compound is

[0547] or a pharmaceutically acceptable salt thereof.

[0548] Embodiment I-18. The method of embodiment I-1, wherein the compound is

[0549] or a pharmaceutically acceptable salt thereof.

[0550] Embodiment I-19. The method of embodiment I-1, wherein the compound is

[0551]

[0552] or a pharmaceutically acceptable salt thereof.

[0553] Embodiment I-20. The method of any one of Embodiments I-1 to I-19, wherein the acute inflammatory disease is a systemic inflammatory disease.

[0554] Embodiment I-21. The method of any one of Embodiments I-1 to I-19, wherein the acute inflammatory disease is an organ-specific disease.

[0555] Embodiment I-22. The method of any one of embodiments I-1 to I-19, wherein the acute inflammatory disease is cytokine storm or hypercytokineemia, systemic inflammatory response syndrome (SIRS), graft-versus-host disease (GVHD), acute respiratory distress syndrome (ARDS), severe acute respiratory distress syndrome (SARS), catastrophic antiphospholipid syndrome, viral infection, bacterial infection, fungal infection, influenza, pneumonia, shock, or sepsis.

[0556] Embodiment I-23. The method of any one of embodiments I-1 to I-19, wherein the acute inflammatory disease is acute pancreatitis, hepatitis, respiratory disease, or enterocolitis.

[0557] Embodiment I-24. The method of any one of embodiments I-1 to I-23, wherein the method reduces pro-inflammatory cytokines or increases anti-inflammatory cytokines.

[0558] Embodiment I-25. The method of embodiment I-24, wherein the proinflammatory cytokine is IL-1β, IL-6, IL-18, TNF-α, or TGF-β.

[0559] Embodiment 1-26. The method of embodiment 1-24, wherein the proinflammatory cytokine is MCP-1, TNF-α, or IL-1β.

[0560] Embodiment 1-27. The method of embodiment 1-24, wherein the proinflammatory cytokine is IL-6.

[0561] Embodiment 1-28. The method of embodiment 1-24, wherein the anti-inflammatory cytokine is IL-10.

[0562] Embodiment I-29. The method of any one of embodiments I-1 to I-23, wherein the expression of the longevity factor-1 regulatory genes sod2, tfam and ddal genes in the liver is increased.

[0563] Embodiment I-30. A compound represented by formula (I):

[0564]

[0565] or a pharmaceutically acceptable salt or tautomer thereof,

[0566] in:

[0567] X is O or OH;

[0568] L is –(CH2) m CH2CH2-, –(CH2) m Y(CH2) p -、-(CH2) m C(O)(CH2) p -、-(CH2) m C(O)O(CH2) p -、-(CH2) m C(O)NR 2 (CH2) p -, or -(CH2) m NR 2 C(O)(CH2) p ;

[0569] Y is O, N or S(O) q ;

[0570] R 1 It is C6-C 10 aryl or heteroaryl, wherein the aryl and heteroaryl are R a and R b and optionally substituted by one or more R e replace;

[0571] R 2 is H or C1-C6 alkyl;

[0572] R a and R b One of them is hydrogen and the other is -(CH2) r CO2R x 、-OCH2CO2R x 、-(CH2) r Tetrazole, -(CH2) r Oxadiazolone, -(CH2) r Tetrazodone, -(CH2) r Dihydrotetrazodone, -(CH2) r Thiadiazole, -(CH2) r Isoxazol-3-ol, -(CH2) r P(O)(OH)OR x 、-(CH2) r S(O)2OH, -(CH2) r C(O)NHCN, or -(CH2) r C(O)NHS(O)2alkyl;

[0573] R c H, C1-C6 alkyl, C1-C6 haloalkyl, halogen, –CN, –OR x、-CO2R x , or NO2;

[0574] R d is methyl, optionally substituted 5- to 10-membered aryl, optionally substituted 5- or 6-membered heteroaryl, or optionally substituted 5- or 6-membered carbocyclic ring;

[0575] Each R x is independently at each occurrence hydrogen or C1-C6 alkyl;

[0576] Each R e are independently C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, halogen, -OR y , C1-C6 haloalkyl, -NHR z , -OH, or -CN;

[0577] R f It is H or not present;

[0578] Each R y and R z are independently hydrogen, C1-C6 alkyl, or C1-C6 haloalkyl;

[0579] Each m and p is independently 0, 1 or 2, where m+p<3;

[0580] q is 0, 1, or 2;

[0581] r is 0 or 1; and

[0582] Dashed lines are optional double bonds;

[0583] Additional conditions: when X is O, L is –SCH2-, and R d When R is an optionally substituted phenyl group, c is not hydrogen or –CN, when X is O, L is –SCH2-, and R d When it is methyl, R c is not C1-C6 alkyl, and when X is O, L is –SCH2- and R d When it is 2-furanyl, R c Not – CN;

[0584] Used to treat acute inflammatory diseases.

[0585] Embodiment I-31. Compounds for use in Embodiment I-30, wherein the compound is represented by Formula (Ia):

[0586]

[0587] or a pharmaceutically acceptable salt or tautomer thereof.

[0588] Embodiment I-32. Compounds for use in Embodiments I-30 or I-31, wherein the compound is represented by Formula (Ib):

[0589]

[0590] or a pharmaceutically acceptable salt thereof, wherein n is 0, 1, 2 or 3.

[0591] Embodiment I-33. A compound used in any one of Embodiments I-30 to I-32,

[0592] in:

[0593] R a and R b One of them is hydrogen and the other is CO2R x 、CH2CO2R x , tetrazole, or oxadiazolone;

[0594] R c Is halogen, –CN, –OR x , or C1-C6 alkyl;

[0595] R d is methyl, optionally substituted 5- to 10-membered aryl, optionally substituted 5- or 6-membered heteroaryl, or optionally substituted 5- or 6-membered carbocyclic ring; and

[0596] R x is hydrogen or C1-C6 alkyl;

[0597] Each R e are independently C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, halogen, -OR y , C1-C6 haloalkyl, -NHR z , -OH, or -CN;

[0598] Each R y and R z are independently hydrogen, C1-C6 alkyl, or C1-C6 haloalkyl; and

[0599] n is 0, 1, 2, or 3;

[0600] The additional condition is: when R d When R is an optionally substituted phenyl group, c is not hydrogen or –CN, and when R d When it is 2-furanyl, R c Not –CN.

[0601] Embodiment I-34. A compound for use in any one of Embodiments I-30 to I-32, wherein the compound is represented by formula (II):

[0602]

[0603] or a pharmaceutically acceptable salt thereof.

[0604] Embodiment I-35. Compounds for use in Embodiment I-34, wherein R c Halogen, –CN, –OR x or C1-C6 alkyl, R d is methyl, optionally substituted 5- to 10-membered aryl, optionally substituted 5- or 6-membered heteroaryl, or optionally substituted 5- or 6-membered carbocyclic ring, and R x It is hydrogen or C1-C6 alkyl.

[0605] Embodiment I-36. Compounds for use in any one of Embodiments I-30 to I-35, wherein R c It is –CN or halogen.

[0606] Embodiment I-37. Compounds for use in any one of Embodiments I-30 to I-36, wherein R d is methyl, cyclohexyl, pyridyl, thiazolyl, phenyl, or thienyl.

[0607] Embodiment I-38. Compounds for use in any one of Embodiments I-30 to I-36, wherein R d is methyl, cyclohexyl, pyridyl, thiazolyl, thienyl, or optionally substituted phenyl.

[0608] Embodiment I-39. Compounds for use in any one of Embodiments I-30 to I-33, wherein R a is hydrogen, CH2CO2H, tetrazole, or oxadiazolone (1,2,4-oxadiazol-5(4H)-one).

[0609] Embodiment I-40. Compounds for use in any one of Embodiments I-30 to I-33, wherein R b is hydrogen, CH2CO2H, tetrazole, or oxadiazolone (1,2,4-oxadiazol-5(4H)-one).

[0610] Embodiment I-41. Compounds for use in any one of embodiments I-30 to I-33, wherein n is 0.

[0611] Embodiment I-42. Compounds for use in Embodiment I-30, wherein the compound is selected from the group consisting of:

[0612]

[0613]

[0614] or a pharmaceutically acceptable salt thereof.

[0615] Embodiment I-43. A compound for use in Embodiment I-30, wherein the compound is selected from the group consisting of:

[0616] or a pharmaceutically acceptable salt thereof.

[0617] Embodiment I-44. A compound for use in Embodiment I-30, wherein the compound is selected from the group consisting of:

[0618]

[0619] or a pharmaceutically acceptable salt thereof.

[0620] Embodiment I-45. Compounds for use in Embodiment I-30, wherein the compound is

[0621]

[0622] or a pharmaceutically acceptable salt thereof.

[0623] Embodiment I-46. Compounds for use in Embodiment I-30, wherein the compound is

[0624]

[0625] or a pharmaceutically acceptable salt thereof.

[0626] Embodiment I-47. Compounds for use in Embodiment I-30, wherein the compound is

[0627]

[0628] or a pharmaceutically acceptable salt thereof.

[0629] Embodiment I-48. Compounds for use in Embodiment I-30, wherein the compound is

[0630]

[0631] or a pharmaceutically acceptable salt thereof.

[0632] Embodiment 1-49. The compound for use in any one of embodiments 1-30 to 1-48, wherein the acute inflammatory disease is a systemic inflammatory disease.

[0633] Embodiment I-50. The compound for use in any one of Embodiments I-30 to I-48, wherein the acute inflammatory disease is an organ-specific disease.

[0634] Embodiment I-51. A compound for use in any one of embodiments I-30 to I-48, wherein the acute inflammatory disease is cytokine storm or hypercytokineemia, systemic inflammatory response syndrome (SIRS), graft-versus-host disease (GVHD), acute respiratory distress syndrome (ARDS), severe acute respiratory distress syndrome (SARS), catastrophic antiphospholipid syndrome, viral infection, bacterial infection, fungal infection, influenza, pneumonia, shock, or sepsis.

[0635] Embodiment 1-52. The compound for use in any one of Embodiments 1-30 to 1-48, wherein the acute inflammatory disease is acute pancreatitis, hepatitis, respiratory disease, or enterocolitis.

[0636] Embodiment 1-53. The compound for use in any one of embodiments 1-30 to 1-52, wherein pro-inflammatory cytokines are reduced or anti-inflammatory cytokines are increased.

[0637] Embodiment I-54. A compound for use in embodiment I-53, wherein the proinflammatory cytokine is IL-1β, IL-6, IL-18, TNF-α, or TGF-β.

[0638] Embodiment 1-55. The compound for use in embodiment 1-53, wherein the proinflammatory cytokine is MCP-1, TNF-α, or IL-1β.

[0639] Embodiment 1-56. The compound for use in embodiment 1-53, wherein the proinflammatory cytokine is IL-6.

[0640] Embodiment 1-57. A compound for use in embodiment 1-53, wherein the anti-inflammatory cytokine is IL-10.

[0641] Embodiment I-58. The compound for use in any one of embodiments I-30 to I-52, wherein the expression of the longevity factor-1 regulatory genes sod2, tfam and ddal genes in the liver is increased.

[0642] Embodiment I-59. Use of a compound represented by formula (I):

[0643]

[0644] or a pharmaceutically acceptable salt or tautomer thereof,

[0645] in:

[0646] X is O or OH;

[0647] L is –(CH2) m CH2CH2-, –(CH2)m Y(CH2) p -、-(CH2) m C(O)(CH2) p -、-(CH2) m C(O)O(CH2) p -、-(CH2) m C(O)NR 2 (CH2) p -, or -(CH2) m NR 2 C(O)(CH2) p ;

[0648] Y is O, N or S(O) q ;

[0649] R 1 It is C6-C 10 aryl or heteroaryl, wherein the aryl and heteroaryl are R a and R b and optionally one or more R e replace;

[0650] R 2 is H or C1-C6 alkyl;

[0651] R a and R b One of them is hydrogen and the other is -(CH2) r CO2R x 、-OCH2CO2R x 、-(CH2) r Tetrazolyl, -(CH2) r Oxadiazolone, -(CH2) r Tetrazodone, -(CH2) r Dihydrotetrazodone, -(CH2) r Thiadiazole, -(CH2) r Isoxazol-3-ol, -(CH2) r P(O)(OH)OR x 、-(CH2) r S(O)2OH, -(CH2) r C(O)NHCN, or -(CH2) r C(O)NHS(O)2alkyl;

[0652] R c H, C1-C6 alkyl, C1-C6 haloalkyl, halogen, –CN, –OR x 、-CO2R x , or NO2;

[0653] R d is methyl, optionally substituted 5- to 10-membered aryl, optionally substituted 5- or 6-membered heteroaryl, or optionally substituted 5- or 6-membered carbocyclic ring;

[0654] Each R x is independently at each occurrence hydrogen or C1-C6 alkyl;

[0655] Each R e are independently C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, halogen, -OR y , C1-C6 haloalkyl, -NHR z , -OH, or -CN;

[0656] R f It is H or not present;

[0657] Each R y and R z are independently hydrogen, C1-C6 alkyl, or C1-C6 haloalkyl;

[0658] Each m and p is independently 0, 1 or 2, where m+p<3;

[0659] q is 0, 1, or 2;

[0660] r is 0 or 1; and

[0661] Dashed lines are optional double bonds;

[0662] Additional conditions: when X is O, L is –SCH2- and R d When R is an optionally substituted phenyl group, c is not hydrogen or –CN, when X is O, L is –SCH2- and R d When it is methyl, R c is not C1-C6 alkyl, and when X is O, L is –SCH2- and R d When it is 2-furanyl, R c Not – CN;

[0663] Used to treat acute inflammatory diseases.

[0664] Embodiment I-60. The use of embodiment I-59, wherein the compound is represented by formula (Ia)

[0665]

[0666] or a pharmaceutically acceptable salt or tautomer thereof.

[0667] Embodiment I-61. The use of embodiment I-59 or I-60, wherein the compound is represented by formula (Ib):

[0668]

[0669] or a pharmaceutically acceptable salt thereof, wherein n is 0, 1, 2 or 3.

[0670] Embodiment I-62. The use of any one of embodiments I-59 to I-61,

[0671] in:

[0672] R a and R b One of them is hydrogen and the other is CO2R x 、CH2CO2R x , tetrazole, or oxadiazolone;

[0673] R c Is halogen, –CN, –OR x , or C1-C6 alkyl;

[0674] R d is methyl, optionally substituted 5- to 10-membered aryl, optionally substituted 5- or 6-membered heteroaryl, or optionally substituted 5- or 6-membered carbocyclic ring; and

[0675] R x is hydrogen or C1-C6 alkyl;

[0676] Each R e are independently C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, halogen, -OR y , C1-C6 haloalkyl, -NHR z , -OH, or -CN;

[0677] Each R y and R z are independently hydrogen, C1-C6 alkyl, or C1-C6 haloalkyl; and

[0678] n is 0, 1, 2, or 3;

[0679] The additional condition is: when R d When R is an optionally substituted phenyl group, c is not hydrogen or –CN, and when R d When it is 2-furanyl, R c Not –CN.

[0680] Embodiment I-63. The use of any one of embodiments I-59 to I-61, wherein the compound is represented by formula (II):

[0681]

[0682] or a pharmaceutically acceptable salt thereof.

[0683] Embodiment I-64. The use of embodiment I-63, wherein R c Is halogen, –CN, –OR x , or C1-C6 alkyl, R d is methyl, optionally substituted 5- to 10-membered aryl, optionally substituted 5- or 6-membered heteroaryl, or optionally substituted 5- or 6-membered carbocyclic ring, and R x It is hydrogen or C1-C6 alkyl.

[0684] Embodiment I-65. The use of any one of embodiments I-59 to I-64, wherein R c It is –CN or halogen.

[0685] Embodiment I-66. The use of any one of embodiments I-59 to I-65, wherein R d is methyl, cyclohexyl, pyridyl, thiazolyl, phenyl, or thienyl.

[0686] Embodiment I-67. The use of any one of embodiments I-59 to I-65, wherein R d is methyl, cyclohexyl, pyridyl, thiazolyl, thienyl, or optionally substituted phenyl.

[0687] Embodiment I-68. The use of any one of embodiments I-59 to I-62, wherein R a is hydrogen, CH2CO2H, tetrazole, or oxadiazolone (1,2,4-oxadiazol-5(4H)-one).

[0688] Embodiment I-69. The use of any one of embodiments I-59 to I-62, wherein R b is hydrogen, CH2CO2H, tetrazole, or oxadiazolone (1,2,4-oxadiazol-5(4H)-one).

[0689] Embodiment I-70. The use of any one of embodiments I-59 to I-62, wherein n is 0.

[0690] Embodiment I-71. The use of embodiment I-59, wherein the compound is selected from the group consisting of:

[0691]

[0692]

[0693] or a pharmaceutically acceptable salt thereof.

[0694] Embodiment I-72. The use of embodiment I-59, wherein the compound is selected from the group consisting of

[0695] or a pharmaceutically acceptable salt thereof.

[0696] Embodiment I-73. The use of embodiment I-59, wherein the compound is selected from the group consisting of

[0697]

[0698] or a pharmaceutically acceptable salt thereof.

[0699] Embodiment I-74. The use of embodiment I-59, wherein the compound is

[0700]

[0701] or a pharmaceutically acceptable salt thereof.

[0702] Embodiment I-75. The use of embodiment I-59, wherein the compound is

[0703]

[0704] or a pharmaceutically acceptable salt thereof.

[0705] Embodiment I-76. The use of embodiment I-59, wherein the compound is

[0706]

[0707] or a pharmaceutically acceptable salt thereof.

[0708] Embodiment I-77. The use of embodiment I-59, wherein the compound is

[0709]

[0710] or a pharmaceutically acceptable salt thereof.

[0711] Embodiment I-78. The use of any one of embodiments I-59 to I-77, wherein the acute inflammatory disease is a systemic inflammatory disease.

[0712] Embodiment I-79. The use of any one of embodiments I-59 to I-77, wherein the acute inflammatory disease is an organ-specific disease.

[0713] Embodiment I-80. The use of any one of embodiments I-59 to I-77, wherein the acute inflammatory disease is cytokine storm or hypercytokineemia, systemic inflammatory response syndrome (SIRS), graft-versus-host disease (GVHD), acute respiratory distress syndrome (ARDS), severe acute respiratory distress syndrome (SARS), catastrophic antiphospholipid syndrome, viral infection, bacterial infection, fungal infection, influenza, pneumonia, shock, or sepsis.

[0714] Embodiment I-81. The use of any one of embodiments I-59 to I-77, wherein the acute inflammatory disease is acute pancreatitis, hepatitis, respiratory disease, or enterocolitis.

[0715] Embodiment I-82. The use of any one of embodiments I-59 to I-81, wherein pro-inflammatory cytokines are reduced or anti-inflammatory cytokines are increased.

[0716] Embodiment I-83. The use of embodiment I-82, wherein the proinflammatory cytokine is IL-1β, IL-6, IL-18, TNF-α, or TGF-β.

[0717] Embodiment I-84. The use of embodiment I-82, wherein the proinflammatory cytokine is MCP-1, TNF-α, or IL-1β.

[0718] Embodiment I-85. The use of embodiment I-82, wherein the proinflammatory cytokine is IL-6.

[0719] Embodiment I-86. The use of embodiment I-82, wherein the anti-inflammatory cytokine is IL-10.

[0720] Embodiment I-87. The use of any one of embodiments I-59 to I-81, wherein the expression of the longevity factor-1 regulatory genes sod2, tfam and dda1 genes in the liver is increased.

[0721] Embodiment I-88. A compound represented by formula (I):

[0722]

[0723] or a pharmaceutically acceptable salt or tautomer thereof,

[0724] in:

[0725] X is O or OH;

[0726] L is –(CH2) m CH2CH2-, –(CH2) m Y(CH2) p-、-(CH2) m C(O)(CH2) p -、-(CH2) m C(O)O(CH2) p -、-(CH2) m C(O)NR 2 (CH2) p -, or -(CH2) m NR 2 C(O)(CH2) p ;

[0727] Y is O, N or S(O) q ;

[0728] R 1 It is C6-C 10 aryl or heteroaryl, wherein the aryl and heteroaryl are R a and R b and optionally one or more R e replace;

[0729] R 2 is H or C1-C6 alkyl;

[0730] R a and R b One of them is hydrogen and the other is -(CH2) r CO2R x 、-OCH2CO2R x 、-(CH2) r Tetrazolyl, -(CH2) r Oxadiazolone, -(CH2) r Tetrazodone, -(CH2) r Dihydrotetrazodone, -(CH2) r Thiadiazole, -(CH2) r Isoxazol-3-ol, -(CH2) r P(O)(OH)OR x 、-(CH2) r S(O)2OH, -(CH2) r C(O)NHCN, or -(CH2) r C(O)NHS(O)2alkyl;

[0731] R c H, C1-C6 alkyl, C1-C6 haloalkyl, halogen, –CN, –OR x 、-CO2R x , or NO2;

[0732] R dis methyl, optionally substituted 5- to 10-membered aryl, optionally substituted 5- or 6-membered heteroaryl, or optionally substituted 5- or 6-membered carbocyclic ring;

[0733] Each R x is independently at each occurrence hydrogen or C1-C6 alkyl;

[0734] Each R e are independently C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, halogen, -OR y , C1-C6 haloalkyl, -NHR z , -OH, or -CN;

[0735] R f It is H or not present;

[0736] Each R y and R z are independently hydrogen, C1-C6 alkyl, or C1-C6 haloalkyl;

[0737] Each m and p is independently 0, 1 or 2, where m+p<3;

[0738] q is 0, 1, or 2;

[0739] r is 0 or 1; and

[0740] Dashed lines are optional double bonds;

[0741] Additional conditions: when X is O, L is –SCH2- and R d When R is an optionally substituted phenyl group, c is not hydrogen or –CN, when X is O, L is –SCH2- and R d When it is methyl, R c is not C1-C6 alkyl, and when X is O, L is –SCH2- and R d When it is 2-furanyl, R c Not – CN;

[0742] Use in preparing medicines for treating acute inflammatory diseases.

[0743] Embodiment I-89. The use of embodiment I-88, wherein the compound is represented by formula (Ia)

[0744]

[0745] or a pharmaceutically acceptable salt or tautomer thereof.

[0746] Embodiment I-90. The use of embodiment I-88 or I-89, wherein the compound is represented by formula (Ib):

[0747]

[0748] or a pharmaceutically acceptable salt thereof, wherein n is 0, 1, 2 or 3.

[0749] Embodiment I-91. The use of any one of embodiments I-88 to I-90,

[0750] in:

[0751] R a and R b One of them is hydrogen and the other is CO2R x 、CH2CO2R x , tetrazole, or oxadiazolone;

[0752] R c Halogen, –CN, –OR x , or C1-C6 alkyl;

[0753] R d is methyl, optionally substituted 5- to 10-membered aryl, optionally substituted 5- or 6-membered heteroaryl, or optionally substituted 5- or 6-membered carbocyclic ring; and

[0754] R x is hydrogen or C1-C6 alkyl;

[0755] Each R e are independently C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, halogen, -OR y , C1-C6 haloalkyl, -NHR z , -OH, or -CN;

[0756] Each R y and R z are independently hydrogen, C1-C6 alkyl, or C1-C6 haloalkyl; and

[0757] n is 0, 1, 2, or 3;

[0758] The additional condition is: when R d When R is an optionally substituted phenyl group, c is not hydrogen or –CN, and when R d When it is 2-furanyl, R c Not –CN.

[0759] Embodiment I-92. The use of any one of embodiments I-88 to I-90, wherein the compound is represented by formula (II):

[0760]

[0761] or a pharmaceutically acceptable salt thereof.

[0762] Embodiment I-93. The use of embodiment I-92, wherein R c Halogen, –CN, –OR x , or C1-C6 alkyl, R d is methyl, optionally substituted 5- to 10-membered aryl, optionally substituted 5- or 6-membered heteroaryl, or optionally substituted 5- or 6-membered carbocyclic ring, and R x It is hydrogen or C1-C6 alkyl.

[0763] Embodiment I-94. The use of any one of embodiments I-88 to I-93, wherein R c It is –CN or halogen.

[0764] Embodiment I-95. The use of any one of embodiments I-88 to I-94, wherein R d is methyl, cyclohexyl, pyridyl, thiazolyl, phenyl, or thienyl.

[0765] Embodiment I-96. The use of any one of embodiments I-88 to I-94, wherein R d is methyl, cyclohexyl, pyridyl, thiazolyl, thienyl, or optionally substituted phenyl.

[0766] Embodiment I-97. The use of any one of embodiments I-88 to I-91, wherein R a is hydrogen, CH2CO2H, tetrazole, or oxadiazolone (1,2,4-oxadiazol-5(4H)-one).

[0767] Embodiment I-98. The use of any one of embodiments I-88 to I-91, wherein R b is hydrogen, CH2CO2H, tetrazole, or oxadiazolone (1,2,4-oxadiazol-5(4H)-one).

[0768] Embodiment I-99. The use of any one of embodiments I-88 to I-91, wherein n is 0.

[0769] Embodiment I-100. The use of embodiment I-88, wherein the compound is selected from the group consisting of:

[0770]

[0771]

[0772] or a pharmaceutically acceptable salt thereof.

[0773] Embodiment I-101. The use of embodiment I-88, wherein the compound is selected from the group consisting of

[0774] or a pharmaceutically acceptable salt thereof.

[0775] Embodiment I-102. The use of embodiment I-88, wherein the compound is selected from the group consisting of

[0776]

[0777] or a pharmaceutically acceptable salt thereof.

[0778] Embodiment I-103. The use of embodiment I-88, wherein the compound is

[0779]

[0780] or a pharmaceutically acceptable salt thereof.

[0781] Embodiment I-104. The use of embodiment I-88, wherein the compound is

[0782]

[0783] or a pharmaceutically acceptable salt thereof.

[0784] Embodiment I-105. The use of embodiment I-88, wherein the compound is

[0785]

[0786] or a pharmaceutically acceptable salt thereof.

[0787] Embodiment I-106. The use of embodiment I-88, wherein the compound is

[0788]

[0789] or a pharmaceutically acceptable salt thereof.

[0790] Embodiment I-107. The use of any one of embodiments I-88 to I-106, wherein the acute inflammatory disease is a systemic inflammatory disease.

[0791] Embodiment I-108. The use of any one of embodiments I-88 to I-106, wherein the acute inflammatory disease is an organ-specific disease.

[0792] Embodiment I-109. The use of any one of embodiments I-88 to I-106, wherein the acute inflammatory disease is cytokine storm or hypercytokineemia, systemic inflammatory response syndrome (SIRS), graft-versus-host disease (GVHD), acute respiratory distress syndrome (ARDS), severe acute respiratory distress syndrome (SARS), catastrophic antiphospholipid syndrome, viral infection, bacterial infection, fungal infection, influenza, pneumonia, shock, or sepsis.

[0793] Embodiment I-110. The use of any one of embodiments I-88 to I-106, wherein the acute inflammatory disease is acute pancreatitis, hepatitis, respiratory disease, or enterocolitis.

[0794] Embodiment I-111. The use of any one of embodiments I-88 to I-110, wherein pro-inflammatory cytokines are reduced or anti-inflammatory cytokines are increased.

[0795] Embodiment I-112. The use of embodiment I-111, wherein the proinflammatory cytokine is IL-1β, IL-6, IL-18, TNF-α, or TGF-β.

[0796] Embodiment I-113. The use of embodiment I-111, wherein the proinflammatory cytokine is MCP-1, TNF-α, or IL-1β.

[0797] Embodiment I-114. The use of embodiment I-111, wherein the proinflammatory cytokine is IL-6.

[0798] Embodiment I-115. The use of embodiment I-111, wherein the anti-inflammatory cytokine is IL-10.

[0799] Embodiment I-116. The use of any one of embodiments I-88 to I-110, wherein the expression of the longevity factor-1 regulatory genes sod2, tfam and ddal genes in the liver is increased.

[0800] Unless otherwise stated, all percentages and ratios used herein are by weight. Other features and advantages of the present invention will become apparent from different embodiments. The provided embodiments illustrate different components and methodologies useful in implementing the present invention. In general, the present invention can be extended to any novel material or any novel combination of the features disclosed in this specification (including the attached claims and drawings). The embodiments do not limit the claimed present invention. Therefore, the features, integers, characteristics, compounds or chemical molecules described in conjunction with specific aspects, embodiments or embodiments of the present invention should be understood to be applicable to any other aspects, embodiments or embodiments described herein, unless incompatible therewith. According to the present invention, a skilled person can identify and adopt other components and methodologies useful for implementing the present invention. In addition, unless otherwise stated, any feature disclosed herein can be replaced by an alternative feature having the same or similar purpose.

[0801] The present invention will now be described, by way of example only, with reference to the following examples:

[0802] Example

[0803] I. Compound preparation

[0804] General methods and materials

[0805] All chemicals were purchased from Sigma-Aldrich, AlfaAesar. The following deuterated solvents were used and the wavelengths were recorded at 200 and 400 MHz. 1 HNMR spectra, and recorded at 100.6 and 50.3 MHz 13 C NMR spectrum. TLC was performed on aluminum backed silica plates (silica gel 60F254). All reactions were performed under nitrogen using distilled solvents. All test compounds had a purity of >95% after HPLC analysis. HPLC grade water was obtained from a tandem Milli-Ro / Milli-Q instrument. HPLC analysis was performed on a Shimadzu LC-20A Prominence equipped with a CBM-20A communication bus module, two LC-20AD dual plunger pumps, a SPD-M20A photodiode array detector, and a Rheodyne 7725i injector with a 20 μL stainless steel loop.

[0806] Scheme 1: Preparation of intermediate 1.4

[0807]

[0808] Example 1: Preparation of intermediate 1.4

[0809] To a stirred solution of compounds 1.1 (0.52 ml, 4.9 mmol), 1.2 (372 mg, 4.9 mmol) and 1.3 (0.5 mL, 0.83 mL, 4.9 mmol) in ethanol (25 ml) was added K2CO3 (812 mg, 5.88 mmol). Stirring was continued overnight under reflux. After cooling, a pale yellow solid was collected, extracted with boiling water and filtered again. The aqueous phase was acidified to pH 5 with AcOH (15 drops), the precipitate was filtered and dried in vacuo. The title compound 1.4 (500 g, 2.18 mmol) was obtained as a pale yellow solid. The yield was 44%.

[0810] Scheme 2: Preparation of intermediate 2.2

[0811]

[0812] Example 2: Preparation of intermediate 2.2

[0813] To a stirred solution of compounds 1.1 (0.96 g, 8.8 mmol), 1.2 (672 mg, 8.8 mmol) and 2.1 (1 g, 0.83 mL) in ethanol (55 mL) was added K2CO3 (1.57 g, 11.44 mmol). Stirring was continued overnight under reflux. After cooling, a pale yellow solid was collected, extracted with hot water and filtered again. The aqueous phase was acidified to pH 1, the precipitate was filtered and dried in vacuo. The title compound 2.2 (1 g, 4.25 mmol) was obtained as a pale yellow solid. The yield was 49%. 1 H NMR (200MHz, DMSO) δ7.22 (m, 1H), 7.68 (m, 1H), 7.85 (d, J = 4.8Hz, 1H), 8.05 (s, 1H).

[0814] Scheme 3: Preparation of intermediate 3.2

[0815]

[0816] Example 3: Preparation of Intermediate 3.2

[0817] To a stirred solution of compounds 1.1 (0.96 mL, 8.8 mmol), 1.2 (672 mg, 8.8 mmol) and 3.1 (1 g, 1.29 mL) in ethanol (55 mL) was added K2CO3 (1.57 g, 11.44 mmol). Stirring was continued overnight under reflux. After cooling, a pale yellow solid was collected, extracted with hot water and filtered again. The aqueous phase was acidified to pH 1, the precipitate was filtered and dried in vacuo. The title compound 3.2 (1 g, 4.25 mmol) was obtained as a pale yellow solid. The yield was 49%.

[0818] Scheme 4: Preparation of intermediate 4.2

[0819]

[0820] Example 4: Preparation of Intermediate 4.2

[0821] To a stirred solution of compound 1.1 (1.42 mL, 13.37 mmol), 1.2 (1.01 g, 13.3 mmol) and 4.1 (1.62 mL, 13.3 mL) in ethanol (50 mL) was added piperidine (2.64 mL, 26.7 mmol). Stirring was continued overnight under reflux. After cooling, the solid was collected, extracted with hot water and filtered again. The aqueous phase was acidified to pH 1 and extracted with EtOAc (3 x 25 mL). The organic phase was washed with brine and dried over Na2SO4. The crude reaction product was purified by flash chromatography (CHCl3 / MeOH as gradient, 0% to 2% product) to obtain the title compound 4.2 (930 mg, 3.95 mmol) as a white solid. The yield was 30%.

[0822] Scheme 5: Preparation of intermediate 5.2

[0823]

[0824] Example 5: Preparation of Intermediate 5.2

[0825] To a stirred solution of compounds 1.1 (0.49 mL, 4.67 mmol), 1.2 (355 mg, 4.67 mmol) and 5.1 (0.44 mL, 4.67 mmol) in ethanol (25 mL) was added K2CO3 (773 mg, 5.6 mmol). Stirring was continued overnight under reflux. After cooling, the white solid was collected and used in the next step after vacuum drying without further purification. The title compound 5.2 (300 mg, 1.3 mmol) was obtained as a white solid. The yield was 29%. 1 H NMR (400MHz, DMSO) δ7.64 (d, J = 4.7 Hz, 2H), 8.78 (d, J = 4.7 Hz, 2H), 12.98 (s, 1H).

[0826] Scheme 6: Preparation of intermediate 6.2

[0827]

[0828] Example 6: Preparation of Intermediate 6.2

[0829] Compound 6.1 (500 mg, 2.73 mmol) and 1.2 (207 mg, 2.73 mmol) were added to a stirred solution of NaOEt (1.02 mL, 2.73 mmol) in anhydrous ethanol (20 mL). Stirring was continued for 4 h under reflux conditions and volatiles were removed in vacuo. The crude reaction product was extracted with water and acidified with AcOH. The precipitate was collected, dissolved in water, and washed with a mixture of CHCl3 and MeOH. The aqueous phase was extracted with EtOAc (3 x 20 mL). The collected organic phase was washed with brine and dried over Na2SO4. The title compound 6.2 (250 mg, 1.49 mmol) was obtained as a white solid. The yield was 55%.

[0830] Scheme 7: Preparation of intermediate 7.3

[0831]

[0832] Example 7a: Preparation of intermediate 7.2

[0833] To a stirred solution of compounds 1.1 (0.14 mL, 1.3 mmol) and 7.1 (150 mg, 1.3 mmol) in EtOH (5 mL) was added piperidine (1 drop). Stirring was continued at room temperature overnight. The solvent was removed in vacuo. The crude reaction product was purified by flash chromatography to give the title compound 7.2 (160 mg, 0.77 mmol) as a light yellow solid. Yield 58%.

[0834] Example 7b: Preparation of intermediate 7.3

[0835] To a stirred suspension of compound 7.2 (150 mg, 0.72 mmol) and compound 1.2 (55 mg, 0.72 mmol) in EtOH (5 mL) was added K2CO3 (99 mg, 0.72 mmol). Stirring was continued overnight under reflux. The white precipitate was collected and used in the next step without further purification. The title compound 7.3 (150 mg, 0.48 mmol) was obtained as a pale yellow solid dipotassium salt. The yield was 67%.

[0836] Scheme 8: Preparation of intermediate 8.5

[0837]

[0838] Example 8a: Preparation of intermediate 8.2

[0839] To a stirred aqueous solution of NH2OH*HCl and NaHCO3 (7 mL) was gradually added a solution of m-methylbenzonitrile (8.1) (2 mL, 17.0 mmol) in EtOH (13.3 mL). Stirring was continued at 80°C for 4 h. Volatiles were removed in vacuo. The crude reaction product was extracted with water and extracted with EtOAc (3 x 25 mL. The organic phase was collected, washed with brine, and dried over Na2SO4 to give the title compound 8.2 (1.5 g, 9 mmol) as a white solid. Yield 59%.

[0840] Example 8b: Preparation of intermediate 8.3

[0841] To a solution of compound 8.2 (1 g, 6 mmol) in dry acetone (5 mL) was added dropwise EtOCOCl (0.63 mL, 6.6 mmol) at 0°C. Stirring was continued at this temperature for 1 h. A 5% NaOH solution was then added to the mixture. Stirring was continued for an additional 1 h. The solvent was removed in vacuo. The crude reaction product was poured into water and extracted with EtOAc (3 x 50 mL). The collected organic phase was washed with brine and dried over Na2SO4. The title compound 8.3 (600 mg, 2.7 mmol) was obtained as a white solid. The yield was 45%.

[0842] Example 8c: Preparation of intermediate 8.4

[0843] To a solution of compound 8.3 (300 mg, 1.35 mmol) in anhydrous ethanol (5 mL) was added sodium (50 mg) in portions. Stirring was continued at room temperature for an additional 4 h. MeOH was added to quench the reaction. The solvent was removed under reduced pressure and the crude product was purified by flash chromatography. The title compound 8.4 (150 mg, 0.85 mmol) was obtained as a white solid. The yield was 63%.

[0844] Example 8d: Preparation of intermediate 8.5

[0845] AIBN (60.7 mg, 0.37 mmol) and NBS (493 mg, 2.77 mmol) were added to a suspension of compound 8.4 (326 mg, 1.85 mmol) in CCl4 (10 mL). Stirring was continued overnight under reflux. The solvent was removed under reduced pressure. The reaction was extracted with water, extracted with EtOAc (3 x 20 mL), washed with brine and dried over Na2SO4. The crude product was purified by flash chromatography, eluted with petroleum ether (Pet.Ether) / EtOAc (30% product) to give the title compound 8.5 (280 mg, 1.09 mmol) as a white solid. The yield was 59%.

[0846] Scheme 9: Preparation of intermediate 9.2

[0847]

[0848] Example 9: Preparation of Intermediate 9.2

[0849] AIBN (41 mg, 0.25 mmol) and NBS (933.7 mg, 5.24 mmol) were added to a suspension of compound 9.1 (750 mg, 5 mmol) in CCl4 (15 mL). Stirring was continued overnight under reflux. The solvent was removed under reduced pressure. The reaction was extracted with water, extracted with EtOAc (3 x 20 mL), washed with brine, and dried over Na2SO4. The crude product was purified by flash chromatography, eluted with CH2Cl2 / MeOH (3% product), to give the title compound 9.2 (800 mg, 3.49 mmol) as a white solid. The yield was 70%.

[0850] Scheme 10: Preparation of intermediate 10

[0851]

[0852] Example 10a: Preparation of intermediate 10.2

[0853] A mixture of compound 10.1 (1.02 mL, 8.54 mmol), NaN3 (832 mg, 12.8 mmol) and Et3N*HCl (1.76 g, 12.8 mmol) was heated under reflux for 4 h. The solvent was removed in vacuo. The crude product was poured into water, acidified to pH 1 with 3N HCl, and extracted with EtOAc (3 x 20 mL). The organic phase was washed with brine, dried over Na2SO4, and concentrated under reduced pressure. The title compound 10.2 (1.22 g, 7.6 mmol) was obtained as a white solid. The yield was 89%.

[0854] Example 10b: Preparation of intermediate 10.3

[0855] AIBN (31 mg, 0.18 mmol) and NBS (333 mg, 1.87 mmol) were added to a suspension of compound 10.2 (300 mg, 1.87 mmol) in CH3CN (15 mL). Stirring was continued overnight under reflux. The solvent was removed under reduced pressure. The reaction was extracted with water, extracted with EtOAc (3 x 20 mL), washed with brine, and dried over Na2SO4. The crude product was purified by flash chromatography, eluting with CH2Cl2 / MeOH (7% product) to give the title compound 10.3 (150 mg, 0.62 mmol) as a light yellow solid. Yield 34%.

[0856] Scheme 11: Preparation of intermediate 11.3

[0857]

[0858] Example 11: Preparation of intermediate 11.3

[0859] To a solution of compound 11.1 (2.5 g, 23 mmol) in CH2Cl2 (25 mL) was added pyridine (1.63 mL, 20.3 mmol) and compound 11.2 (1.68 mL, 20.3 mmol). Stirring was continued at room temperature overnight. The solvent was removed under reduced pressure. The reaction was extracted with water, extracted with CH2Cl2 (3 x 30 mL), washed with brine, and dried over Na2SO4. The crude product was purified by flash chromatography, eluted with petroleum ether / EtOAc (25% product), to give the title compound 11.3 (735 mg, 3.19 mmol) as a brown solid. The yield was 14%.

[0860] Scheme 12: Preparation of intermediate 12.2

[0861]

[0862] Example 12: Preparation of intermediate 12.2

[0863] To a solution of compound 12.1 (2 g, 10.41 mmol) in EtOH (15 mL) was added EtONa (7 mL, 18.7 mmol) and compound 1.2 (1.18 g, 15.61 mmol). Stirring was continued overnight under reflux conditions. The solvent was removed under reduced pressure. The reaction was extracted with water, acidified to pH 3, extracted with EtOAc (3 x 20 mL), washed with brine, and dried over Na2SO4. The crude product was purified by flash chromatography, eluted with CH2Cl2 / MeOH (2.5% product) to give the title compound 12.2 (500 mg, 2.44 mmol) as a white solid. The yield was 24%.

[0864] Scheme 13: Preparation of intermediate 13.2

[0865]

[0866] Example 13a: Preparation of intermediate 13.2

[0867] At 0°C, n-butyl lithium (21.6 mL) was added to a stirred solution of DIPA (7.6 mL, 54 mmol) in THF (53 mL). Stirring was continued at this temperature for 10 minutes. The mixture was then cooled to -78°C and EtOAc (2.4 mL, 27 mmol) was added dropwise. Stirring was continued at this temperature for 30 minutes. Afterwards, a solution of compound 13.1 (3 mL, 27 mmol) in THF (20 mL) was added dropwise. The reaction was warmed to room temperature and stirred overnight. The crude reaction product was poured into water and extracted with EtOAc (3x 30 mL). The collected organic phase was washed with brine, dried over Na2SO4, and concentrated in vacuo. The title compound 13.2 (4.8 g, 24.3 mmol) was obtained as a brown oil. The yield was 90%.

[0868] Example 13b: Preparation of intermediate 13.3

[0869] To a solution of intermediate 13.2 (2 g, 10 mmol) in EtOH (15 mL) was added EtONa (21% wt / wt in EtOH) (7.5 mL, 20 mmol) and compound 1.2 (1.15 g, 15.1 mmol). Stirring was continued overnight under reflux conditions. The solvent was removed under reduced pressure. The reaction was extracted with water. Unreacted starting material was recovered at pH 10. The mixture was then acidified to pH 5, extracted with EtOAc (3 x 20 mL), washed with brine, and dried over Na2SO4. The crude product was purified by flash chromatography, eluted with CH2Cl2 / MeOH (7% product) to give the title compound 13.3 (435 mg, 2.06 mmol) as a yellow solid. Yield 21%.

[0870] Scheme 14: Preparation of Compound 1

[0871]

[0872] Example 14: Preparation of Compound 1

[0873] 3-(Chloromethyl)benzoic acid (1.19 g, 6.98 mmol) was added to a stirred suspension of intermediate 1.4 (1.6 g, 6.98 mmol) and K2CO3 (2.88 g, 20.9 mmol) in CH3CN (80 mL). Stirring was continued overnight under reflux. Volatiles were removed in vacuo. The crude product was extracted with water, acidified to pH 5, and washed with EtOAc to remove impurities. The pH was then adjusted to 3 / 4, and the mixture was extracted with EtOAc (3x 50 mL). Titration with hot acetone gave compound 1 (936 mg, 2.78 mmol) as a pale yellow solid. Yield 40%. 1H NMR (400MHz, DMSO) δ4.58 (s, 2H), 7.44 (t, J = 7.5Hz, 1H), 7.54-7.61 (m, 3H), 7.67 (d, J=7.1Hz,1H),7.83(d,J=7.5Hz,1H),7.91(d,J=7.27Hz,2H),8.04(s,1H),13(s,1H); 13 C NMR (100MHz, DMSO) δ33.5,93.2,115.6,128.2,128.4,128.4,128.5,128.5,128. 6,129.7,130.8,131.5,133.3,135.1,137.4,165.4,166.8,167.3. HPLC: 96.3%.

[0874] Scheme 15: Preparation of Compound 4

[0875]

[0876] Example 15: Preparation of Compound 4

[0877] To a stirred suspension of intermediate 2.2 (250 mg, 1.06 mmol) and K2CO3 (440 mg, 3.18 mmol) in CH3CN (15 mL) was added 3-(chloromethyl)benzoic acid (180 mg, 1.06 mmol). Stirring was continued overnight under reflux. Volatiles were removed in vacuo. The crude product was extracted with water, washed with EtOAc, acidified to pH 1, and extracted with EtOAc (3 x 50 mL). Titration with hot acetone gave compound 4 (45 mg, 0.12 mmol) as a pale yellow solid. Yield 12%. 1 H NMR (400MHz, DMSO) δ4.62(s,2H),7.33(t,J=4.3Hz,1H),7.44(t,J=7.6Hz,1H),7.72(d, J=7.5Hz,1H),7.82(d,J=7.5Hz,1H),8.05(m,2H),8.26(d,J=3.8Hz,1H),12.99(s,1H); 13 C NMR(100MHz,DMSO)δ33.9,88.7,116.5,128.8,129.3,129.9,130.2,131.5,1 32.1, 133.7, 135.4, 137.9, 139.7, 159.0, 161.2, 165.3, 167.4. HPLC: 97.2%.

[0878] Scheme 16: Preparation of compound 3

[0879]

[0880] Example 16: Preparation of Compound 3

[0881] To a stirred suspension of intermediate 3.2 (250 mg, 1.06 mmol) and K2CO3 (440 mg, 3.18 mmol) in CH3CN (15 mL) was added 3-(chloromethyl)benzoic acid (180 mg, 1.06 mmol). Stirring was continued overnight under reflux. Volatiles were removed in vacuo. The crude product was extracted with water, washed with EtOAc, acidified to pH 1, and extracted with EtOAc (3 x 50 mL). Titration with a mixture of Et2O / acetone gave compound 3 (260 mg, 0.7 mmol) as a pale yellow solid. Yield 70%. 1 H NMR (400MHz, DMSO) δ4.63 (s, 2H), 7.44 (t, J = 7.6Hz, 1H), 7.69 (d, J = 7.7Hz, 1H), 7. 74(dd,J=5Hz,J=2.9Hz,1H),7.84(m,2H),8.05(s,1H),8.58(m,1H),13.0(s,1H); 13 CNMR(100MHz,DMSO)δ35.3,90.1,118.0,130.2,130.7,131.3,131.6,132.9, 133.5, 135.1, 136.8, 139.3, 141.1, 160.4, 162.7, 166.7, 168.8. HPLC: 95.0%.

[0882] Scheme 17: Preparation of Compound 6

[0883]

[0884] Example 17: Preparation of Compound 6

[0885] To a stirred suspension of intermediate 4.2 (250 mg, 1.18 mmol) and K2CO3 (495 mg, 3.56 mmol) in CH3CN (15 mL) was added 3-(chloromethyl)benzoic acid (202 mg, 1.18 mmol). Stirring was continued overnight under reflux. Volatiles were removed in vacuo. The crude product was extracted with water, washed with EtOAc, acidified to pH 1, and extracted with EtOAc (3 x 50 mL). Titration with Et2O gave compound 6 (90 mg, 0.24 mmol) as a white solid. Yield 21%. 1H NMR (400MHz, DMSO) δ1.24(m,3H),1.60(m,7H),2.74(m,1H),4.52(s,2H),7.45(t,J=7 .18Hz,1H),7.67(d,J=6.83Hz,1H),7.82(d,J=7.17Hz,1H),8.04(s,1H),13.0(s,1H). 13 C NMR (100MHz, DMSO) δ25.4,25.7,25.7,30.3,30.3,33.8,44.9,94.1,115.3,128. 6,129.2,130.1,131.3,133.6,138.5,161.1,166.2,167.4,177.9. HPLC: 98.1%.

[0886] Scheme 18: Preparation of Compound 7

[0887]

[0888] Example 18: Preparation of Compound 7

[0889] To a stirred suspension of intermediate 5.2 (220 mg, 0.95 mmol) and DIPEA (0.18 mL, 1.05 mmol) in DMSO (5 mL) was added 3-(chloromethyl)benzoic acid (178 mg, 1.05 mmol). Stirring was continued overnight at room temperature. The pale yellow solid was collected, washed with crushed ice and water, and dried in vacuo. Grinding with hot EtOAc gave compound 7 (180 mg, 0.49 mmol) as a pale yellow solid. Yield 53%. 1 HNMR (400MHz, DMSO) δ4.55 (s, 2H), 7.44 (m, 1H), 7.66 (d, J = 6Hz, 1H), 7.81 (m, 3H), 8.02 (s, 1H), 8.80 (s, 2H), 13.1 (s, 1H); 13 C NMR (100MHz, DMSO) δ34.1,94.8,115.8,122.8,122.8,128.7,129.2,130.4,131. 3,133.9,138.1,143.1,150.5,150.5,161.8,165.7,167.4,167.4. HPLC: 95.1%.

[0890] Scheme 19: Preparation of compound 11

[0891]

[0892] Example 19a: Preparation of Compound 14

[0893] To a stirred suspension of intermediate 12.2 (100 mg, 0.43 mmol) and K2CO3 (178 mg, 1.29 mmol) in CH3CN (15 mL) was added 3-(chloromethyl)benzoic acid (74 mg, 0.43 mmol). Stirring was continued overnight under reflux. Volatiles were removed in vacuo. The crude product was extracted with water, washed with EtOAc, acidified to pH 3, and extracted with EtOAc (3x 50 mL). Titration with a mixture of Et2O / acetone gave compound 14 (30 mg, 0.088 mmol) as a white solid. Yield 21%. 1 H NMR (400MHz, DMSO) δ4.59 (s, 2H), 6.69 (s, 1H), 7.41 (m, 1H), 7.46 (m, 3H), 7.71 (d, J = 7.5Hz, 1H), 7.81 (d, J = 7.74Hz, 1H), 8.06 (m, 3H), 12.85 (s, 2H). 13 C NMR (100MHz, DMSO) δ33.8,127.3,127.3,128.5,129.1,129.2,130.1,131.0,131.3,131.5,133.6,136.3,138.8,167.5.

[0894] Example 19b: Preparation of Compound 11

[0895] Lead dioxide (77.2 mg, 0.32 mmol) and bromine (0.02 mL, 0.32 mmol) were added to a stirred solution of compound 14 (100 mg, 0.29 mmol) in acetic acid (5 mL). Stirring was continued at room temperature for 6 hours. The mixture was poured into a Na2S2O5 solution and extracted with EtOAc (3 x 20 mL). The collected organic phase was washed with water and brine, then dried with Na2SO4. Titration with a mixture of Et2O / acetone gave compound 11 (40 mg, 0.09 mmol) as a white solid. Yield 33%. 1 H NMR (400MHz, DMSO) δ4.44(s,2H),7.42(t,J=7.6Hz,1H),7.48(m,3H),7.61-7.65(m,3H),7.82(d,J=7.5Hz,1H),8.0(s,1H),13.1(m,2H). 13 C NMR (100MHz, DMSO) δ 33.9, 128.4, 128.6, 129.14, 129.3, 129.3, 129.3, 130.1, 130.2, 131.3, 133.9, 138.1, 138.4, 167.5. HPLC: 94.2%.

[0896] Scheme 20: Preparation of compound 12

[0897]

[0898] Example 20a: Preparation of Compound 15

[0899] To a stirred suspension of intermediate 13.3 (235 mg, 1.11 mmol) and K2CO3 (460 mg, 3.33 mmol) in CH3CN (15 mL) was added 3-(chloromethyl)benzoic acid (190 mg, 1.11 mmol). Stirring was continued overnight under reflux. Volatiles were removed in vacuo. The crude product was extracted with water, washed with EtOAc, acidified to pH 3, and extracted with EtOAc (3 x 50 mL). Titration with a mixture of Et2O / acetone gave compound 15 (150 mg, 0.44 mmol) as a white solid. Yield 39%. 1 H NMR (400MHz, DMSO) δ4.55(s,2H),6.64(s,1H),7.19(dd,J=4.9Hz,J=3.8Hz,1H),7.43(t,J=7.7Hz,1H),7.74(d ,J=7.6Hz,1H),7.77(d,J=4.9Hz,1H),7.81(d,J=7.8Hz,1H),7.90(d,J=3.6Hz,1H),8.08(s,1H),12.80(s,2H). 13 C NMR (100MHz, DMSO) δ33.5,101.6,128.1,128.6,129.1,129.1,130.1,131.1,131.4,133.7,138.9,141.7,167.4.

[0900] Example 20b: Preparation of Compound 12

[0901] Lead dioxide (102mg, 0.42mmol) and bromine (0.022mL, 0.42mmol) were added to the stirred solution of compound 15 (134mg, 0.39mmol) in acetic acid (5mL). Stirring was continued for 6 hours at room temperature. The mixture was poured into a Na2S2O5 solution and extracted with EtOAc (3x 20mL). The collected organic phase was washed with water and brine, and then dried over Na2SO4. The crude reaction product was purified by flash chromatography and eluted with CH2Cl2 / MeOH (10% product). Compound 12 (45mg, 0.11mmol) was obtained as a white solid. The yield was 27%. 1H NMR (400MHz, DMSO) δ4.56(s,2H),7.27(t,J=3.5Hz,1H),7.44(t,J=7.6Hz,1H),7.72(d,J=7.5Hz ,1H),7.82(d,J=7.7Hz,1H),7.92(d,J=4.5Hz),8.07(s,1H),8.33(d,J=2.9Hz,1H),13.1(m,2H). 13 C NMR (100MHz, DMSO) δ33.8,128.6,128.7,128.7,129.2,130.1,131.4,132.3,132.8,133.6,138.3,141.1,152.1,158.5,159.6,167.4. HPLC: 95.2%.

[0902] Scheme 21: Preparation of compound 13

[0903]

[0904] Example 21: Preparation of Compound 13

[0905] Lead dioxide (55.8 mg, 0.35 mmol) and N-chlorosuccinimide (47 mg, 0.35 mmol) were added to a stirred solution of compound 14 (100 mg, 0.29 mmol) in acetic acid (5 mL). Stirring was continued at room temperature for 6 hours. The mixture was poured into water and extracted with EtOAc (3 x 20 mL). The collected organic phase was washed with water and brine, then dried over Na2SO4. Titration with a mixture of Et2O / acetone gave compound 13 (40 mg, 0.1 mmol) as a white solid. Yield 37%. 1 H NMR (400MHz, DMSO) δ4.47 (s, 2H), 7.43 (t, J = 7.7Hz, 1H), 7.49 (m, 3H), 7.64 (d, J = 7.2 Hz,1H),7.71(m,2H),7.83(d,J=7.5Hz,1H),8.02(s,1H),13.1(s,1H),13.25(s,1H); 13 C NMR (100MHz, DMSO) δ 33.9, 128.4, 128.4, 128.6, 129.1, 129.4, 130.2, 131.3, 131.3, 133.8, 136.5, 138.3, 167.5. HPLC: 95.3%.

[0906] Scheme 22: Preparation of Compound 22

[0907]

[0908] Example 22: Preparation of Compound 22

[0909] The stirred suspension of compound 1 (160 mg, 0.44 mmol) and POCl3 (3 mL) was heated at 70 ° C for 6 h. The white suspension turned red. The excess POCl3 was carefully destroyed with crushed ice and then with water. The mixture was extracted with EtOAc (3x20 mL). The collected organic phase was washed with brine, dried over Na2SO4 and evaporated. Flash chromatography purification (gradient CH2Cl2 / MeOH) gave the title compound 22 (60 mg, 0.16 mmol) as a white solid. Yield 36%. 1 HNMR(400MHz,DMSO)δ4.58(s,2H),7.44(t,J=7.7Hz,1H),7.58-7.62(m,2H),7.66(d,J=7.17Hz,1H ),7.70(d,J=7.7Hz,1H),7.82(d,J=7.7Hz,1H),7.94(d,J=7.1Hz,2H),8.08(s,1H),12.98(s,1H); 13 C NMR(100MHz,DMSO)δ34.9,102.5,115.2,128.7,129.2,129.2,129.6,129.6,130 .4,131.4,132.7,133.9,134.7,138.0,162.9,167.5,169.0,174.3. HPLC: 98.8%.

[0910] Scheme 23: Preparation of compound 10

[0911]

[0912] Example 23: Preparation of Compound 10

[0913] To a stirred suspension of intermediate 6.2 (145 mg, 0.86 mmol) and K2CO3 (599 mg, 4.33 mmol) in CH3CN (15 mL) was added 3-(chloromethyl)benzoic acid (148 mg, 0.86 mmol). Stirring was continued overnight under reflux. Volatiles were removed in vacuo. The crude product was extracted with water, washed with EtOAc, acidified to pH 3, and extracted with EtOAc (3 x 50 mL). The reaction crude product was purified by flash chromatography, eluted with (CH2Cl2 / MeOH+ACOH 3%) to give the title compound 10 (60 mg, 0.2 mmol) as a white solid. Yield 23%. 1H NMR (400MHz, DMSO) δ2.44(s,3H),4.49(s,2H),7.45(t,J=7.6Hz,1H),7.68(d,J=7.4Hz,1H),7.82(d,J=7.6Hz,1H),8.05(m,1H),13.1(s,1H); 13 C NMR (100MHz, DMSO) δ 23.3, 33.9, 95.3, 115.6, 128.7, 129.1, 130.6, 131.2, 134.1, 138.0, 161.1, 165.7, 167.4, 170.9. HPLC 96.5%.

[0914] Scheme 24: Preparation of Compound 5

[0915]

[0916] Example 24: Preparation of Compound 5

[0917] 3-(Chloromethyl)benzoic acid (217 mg, 1.27 mmol) was added to a stirred suspension of intermediate 7.3 (414 mg, 1.27 mmol) and K2CO3 (526 mg, 3.81 mmol) in CH3CN (20 mL). Stirring was continued overnight under reflux. Volatiles were removed in vacuo. The crude product was extracted with water, washed with EtOAc, acidified to pH 3, and extracted with EtOAc (3x 50 mL). After titration with a mixture of Et2O / acetone, the title compound 5 (260 mg, 0.7 mmol) was obtained as a pure light yellow solid. Yield 55%. 1 HNMR (400MHz, DMSO) δ4.62(s,2H),7.45(m,1H),7.74(d,J=5.9Hz,1H),7.82(d,J=6.1Hz,1H),8.08(s,1H),8.21(d,J=7.2Hz,2H),12.9(s,1H); 13 C NMR (100MHz, DMSO) δ34.0,90.5,114.9,127.7,128.8,129.3,130.1,131.4,133.7,138.1,146.2,156.7,161.9,163.8,166.5,167.4. HPLC 96.5%.

[0918] Scheme 25: Preparation of Compound 19

[0919]

[0920] Example 25: Preparation of Compound 19

[0921] To a stirred suspension of intermediate 2.2 (100 mg, 0.42 mmol) and DIPEA (0.07 mg, 0.47 mmol) in DMSO (5 mL) was added intermediate 8.5 (120 mg, 0.47 mmol). Stirring was continued overnight at room temperature. The crude product was poured into water, washed with EtOAc, then acidified to pH 3, and extracted with EtOAc (3 x 50 mL). After purification by flash chromatography, CH2Cl2 / MeOH (10% product) was used to wash out to give the title compound 19 (65 mg, 0.15 mmol) as a pure orange solid. Yield 38%. 1 HNMR (400MHz, DMSO) δ4.37 (s, 2H), 7.20 (t, J = 4Hz, 1H), 7.45 (t, J = 7.6Hz, 1H), 7.63(t,J=7.2Hz,2H),7.75(d,J=4.3Hz,1H),7.88(s,1H),8.07(d,J=3Hz,1H); 13 CNMR(100MHz,DMSO)δ33.7,85.7,120.4,124.9,125.4,126.7,128.7,128.8, 129.5,131.1,132.3,140.6,142.2,159.1,159.9,163.3,170.4,171.3.HPLC 94.1%.

[0922] Scheme 26: Preparation of Compound 18

[0923]

[0924] Example 26: Preparation of Compound 18

[0925] To a stirred suspension of intermediate 2.2 (500 mg, 0.5 mmol) and DIPEA (0.4 mL, 2.12 mmol) in DMSO (5 mL) was added intermediate 9.2 (487 mg, 2.12 mmol). Stirring was continued overnight at room temperature. The crude product was poured into water, washed with EtOAc, then acidified to pH 3 and extracted with EtOAc (3 x 50 mL). After purification by flash chromatography, it was eluted with CH2Cl2 / MeOH (10% product) and titrated with a mixture of Et2O / acetone to give the title compound 18 (200 mg, 0.52 mmol) as a pure yellow solid. Yield 25%. 1H NMR (400MHz, DMSO) δ3.49 (s, 2H), 4.53 (s, 2H), 7.16 (d, J = 6.8Hz, 1H), 7.26 (t, J=7.2Hz,1H),7.36(m,3H),8.05(d,J=4.4Hz,1H),8.27(s,1H),12.13(s,1H); 13 C NMR(100MHz,DMSO)δ34.3,40.9,88.5,116.8,127.6,128.9,129.1,129.8,1 30.4,131.9,135.2,135.8,137.0,139.9,159.1,161.6,165.7,172.9.HPLC 95.8%.

[0926] Scheme 27: Preparation of compound 17

[0927]

[0928] Example 27: Preparation of Compound 17

[0929] To a stirred suspension of intermediate 2.2 (160 mg, 0.66 mmol) and DIPEA (0.09 mL, 0.55 mmol) in DMSO (3 mL) was added intermediate 10.3 (171 mg, 0.55 mmol). Stirring was continued overnight at room temperature. The crude product was poured into water, washed with EtOAc, then acidified to pH 3, and extracted with EtOAc (3 x 50 mL). After purification by flash chromatography, eluted with CH2Cl2 / MeOH (5% product), and then titrated with a mixture of Et2O / acetone to obtain the title compound 17 (90 mg, 0.22 mmol) as a pure orange solid. Yield 23%. 1 HNMR(400MHz,DMSO)δ4.59(s,2H),7.29(t,J=4.6Hz,1H),7.54(t,J=7.6Hz,1H),7.68(t,J=7 .8Hz,1H),7.91(d,J=7.7Hz,1H),7.96(d,J=4.9Hz,1H),8.16(s,1H),8.22(d,J=3.8Hz,1H); 13 C NMR (100MHz, DMSO) δ33.9,88.9,117.6,125.0,126.2,127.9,129.6,129.9,131.2,131.9,134.4,139.3,140.4,155.8,159.1,163.8,167.0.HPLC 96.2%.

[0930] Scheme 28: Preparation of Compound 23

[0931]

[0932] Example 28: Preparation of Compound 23

[0933] To a stirred suspension of intermediate 2.2 (150 mg, 0.63 mmol) and K2CO3 (96.6 mg, 0.70 mmol) in acetone (10 mL) was added intermediate 11.2 (173 mg, 0.72 mmol). Stirring was continued overnight at room temperature. Volatiles were removed in vacuo. The crude product was extracted with water, acidified to pH 3, and extracted with EtOAc (3 x 50 mL). After purification by flash chromatography, eluted with CH2Cl2 / MeOH (5% product), and then titrated with hot EtOAc to obtain the title compound 23 (150 mg, 0.39 mmol) as a pure orange solid. Yield 62%. 1 H NMR (400MHz, DMSO) δ3.92(s,2H),6.72(t,J=7.7Hz,1H),6.79(d,J=7.6Hz,1H),6.88(t,J=7.3Hz,1H),7.20(t ,J=4.26Hz,1H),7.77(d,J=4.7Hz,1H);7.92(d,J=7.8Hz,1H),8.0(d,J=3.5Hz,1H);9.59(s,1H),9.80(s,1H); 13 C NMR (100MHz, DMSO) δ35.12,86.2,115.5,119.2,120.1,121.0,124.4,127.0,128.7,129.2,131.4,141.8,147.3,159.2,167.9,169.1,170.5.HPLC 97.7%.

[0934] Example 29: Synthesis of Exemplary Compounds

[0935]

[0936] See Hirose M et al., “Design and synthesis of novel DFG-out RAF / vascular endothelial growth factor receptor 2 (VEGFR2) inhibitors: 3. Evaluation of 5-amino-linked thiazolo[5,4-d]pyrimidine and thiazolo[5,4-b]pyridine derivatives.” Bioorg. Med. Chem. 2012, 15; 20(18): 5600-15.

[0937]

[0938] See Clift MD, Silverman RB., “Synthesis and evaluation of novel aromatic substrates and competitive inhibitors of GABA aminotransferase,” Bioorg. Med. Chem. Lett,. 2008, 15; 18(10): 3122-5.

[0939]

[0940] A.M. El-Reedy, A.O. Ayyad and A.S. Ali, “Azolopyrimidines and pyrimidoquinazolines from 4-chloropyrimidines,” J. Het. Chem. 1989, 26, 313-16.

[0941]

[0942] See Iwahashi M et al., “Design and synthesis of new prostaglandin D2 receptor antagonists,” Bioorg. Med. Chem. 2011, 19(18): 5361-71.

[0943]

[0944] See U.S. 2008 / 004,302(A1); and U.S. 8,716,470(B2).

[0945] Biological activity

[0946] ACMSD and acute inflammation

[0947] Cell detection

[0948] Detection steps for ACMSD plasmid transfection into mouse Kupffer cells and cytokine analysis after LPS induction

[0949] Kupffer cells (immortalized mouse Kupffer cell line, cat# SCC119 (ImKC) Merck Millipore) were plated in 24-well tissue culture plates at 150,000 cells / well in RPMI medium + 10% FBS. 24 hours after seeding, cells were transfected with Fugene HD (Promega), pCDNA3.1 mouse ACMSD, and pCDNA3.1 empty vector (each at a concentration of 0.75 μg / well) for 18 hours.

[0950] Cell stimulation was performed using an ACMSD inhibitor (e.g., a compound of the invention, a compound of Formula I, Ia, Ib, and II) using the following concentrations of test compound: 0.5 μM, 5 μM, and 50 μM, using cells to which only 0.5% final concentration of DMSO was added as a control. All wells were normalized with 0.5% final concentration of DMSO. Cells were treated with LPS at a final concentration of 50 ng / ml in cell culture medium for 18 hours, and then supernatants were collected for analysis of mouse cytokine secretion (IL-1, IL1β, IL-2, IL-3, IL-4, IL-5, IL6, IL-9, IL-10, IL-12 (p40), IL-12 (p70), IL-13, IL-17, IFN-γ, Rantes, Eotaxin, MCP-1, MIP-1, MIP-1, G-CSF, GM-CSF, TNF, and KC (keratinocyte chemoattractant)) using the Bio-Plex Pro Mouse Cytokine 23-plex Assay (cat#M60009RDPD). Cells were centrifuged and the resulting pellets were collected for RT-PCR analysis or ATP measurement (Promega Cell-Titer-Glo cat#G7571).

[0951] Detection steps of ACMSD silencing

[0952] Kupffer cells in 24-well plates were transfected with 5 pmol of ACMSD siRNA or scrambled siRNA (siRNAACMSD cat#4390771 and scrambled siRNAcat#4390843, both from Ambion) as negative controls. After incubation for 18 hours, cells were treated with ACMSD inhibitors (e.g., compounds of the present invention, compounds of formula I, Ia, Ib and II) (5 μM) or DMSO as carriers, and then treated with LPS at a final concentration of 50 ng / ml in cell culture medium for an additional 1 hour, incubated overnight, and then cytokine secretion was determined using the Bio-Plex kit. All wells were normalized with 0.5% final concentration of DMSO.

[0953] Cytokine secretion assay

[0954] 200,000 Kupffer cells were seeded in a 24-well plate and an ACMSD inhibitor (e.g., a compound of the present invention, a compound of Formula I, Ia, Ib, and II) (5 μM) was added 1 hour before the cells were stimulated with LPS overnight at a final concentration of 50 ng / ml (aqueous solution of 1 mg / mL stock solution, distributed in the wells at a concentration of 50 ng / ml). Cells treated with DMSO at a final concentration of 0.5% in the culture medium were used as controls. All wells were normalized with DMSO at a final concentration of 0.5%. The supernatant was collected and cytokine secretion was determined using the Bio-Plex Pro Mouse Cytokine 23-plex Detection System (cat#M60009RDPD) of the Bio-Plex instrument. The cells were rinsed once with PBS and then lysed and total RNA was extracted for RT-PCR detection to evaluate the regulation of ACMSD on IL-10, SIRT1, and STAT3 gene expression.

[0955] Briefly, total RNA was extracted from cells using the manufacturer's method of the Qiagen RNeasy Plus Mini kit (cat. 74134). Total RNA concentration was quantified using an Implen instrument and purity was assessed by measuring the ratio of A260 / A280. RNA with an A260 / A280 ratio of (1.8-2.0 range) was isolated.

[0956] Total RNA (1 μg) was reverse transcribed using the method of SuperScript IV VILO Master Mix (Thermo Fisher, cat. #.11756500). Real-time PCR was then performed in a CFX 96 Real Time System (Bio-Rad) as follows: 95°C denaturation for 2 minutes, followed by 40 cycles of 95°C for 10 seconds each, and 60°C hybridization for 20 seconds. QPCR was performed using 2xQuantiNova SYBR Green PCR Master Mix (Qiagen). Mouse β2 microglobulin (mβ2M) was used as a reference gene.

[0957] All cytokine secretion values ​​were normalized to the fluorescence signal measured by cellular ATP (CellTiter-Glo cat# G7571).

[0958] Primer sequences

[0959] mSTAT3FWCACATGCCACGTTGGTGTTTT

[0960] mSTAT3 RW ACGATCCGGGCAATTTCCAT

[0961] mIL10 FW CAGTACAGCCGGGAAGACAAT

[0962] mIL10 RW TTGGCAACCCAAGTAACCCT

[0963] mSIRTI_FWTATCTATGCTCGCCTTGCGG

[0964] mSIRT1_RW GACACAGAGACGGCTGGAAC

[0965] mACMSDFWGCAGATGGATGGACGAATGG

[0966] mACMSD RWCGAAGCACACTTTGAGTTTGG

[0967] mB2M FW CTCGGTGACCCTGGTCTTTC

[0968] mB2M RW GGATTTCAATGTGAGGCGGG

[0969] Animal Model Methods

[0970] LPS-induced acute kidney injury and liver injury

[0971] A total of 40 Sprague-Dawley rats (8-week-old male rats, 200-220 g) were randomly divided into three LPS model groups (8h, 24h and 48h sacrifice groups, n=10 in each group) and a control group (n=10 in each group). Rats were obtained from Charles River Laboratories. After 1 week of acclimatization, rats in the LPS group were intraperitoneally injected with 10 mg / kg LPS (dissolved in saline) based on previous reports; rats in the control group were intraperitoneally injected with an equal amount of saline. After 8h, 24h or 48h, the rats were anesthetized with chloral hydrate, and then blood was collected by direct puncture of the abdominal aorta. The blood was then centrifuged at 3000×g to prepare serum samples. Organ tissues were collected and divided into two parts: one part was fixed in 4% formaldehyde and the other part was frozen in liquid N2. All serum and tissue samples were stored at −80°C until biochemical analysis of liver function (AST / ALT levels), renal function (BUN and serum / plasma creatinine levels), and inflammatory biomarkers (expression and secretion of cytokines and chemokines, including TNFα, IL-6, MCP-1, MIP-1α, and IL-10).

[0972] CLP-induced sepsis model

[0973] C57BL / 6 mice (12-15 weeks old) (obtained from Charles River Laboratories) were anesthetized with an intraperitoneal (ip) injection of a 1:1 solution of ketamine (75 mg / kg) and xylazine (15 mg / kg) (or pentobarbital (70 mg / kg)). The hair on the lower abdomen of the mice was shaved, and the area was disinfected with a 70% alcohol cotton swab. Under sterile conditions, a 1 to 2 cm midline laparotomy was performed to expose the cecum. The cecum was tightly ligated with a 2.0 silk suture at the level of the second cecal artery, perforated twice with a 22-gauge needle, and returned to the peritoneal cavity after exposure to allow feces to be expressed. The abdominal wall was then sutured with a 4-0 flowing silk flat suture. Control animals underwent the same laparotomy and cecal excision, but no ligation or perforation was performed. Animals were resuscitated immediately after surgery by subcutaneous injection of 1.0 mL of 0.9% saline and recovered on a warming blanket under monitoring. The animals were then treated with 0.5 ml LRS (Q12 hr SQ 3 days), ampicillin-sulbactam (250 mg / kg, Q12 hr, IP 3 days) and analgesics (buprenorphine 0.05 mg / kg, 3 days).

[0974] ACMSD inhibitors (e.g., compounds of the present invention, compounds of Formula I, Ia, Ib, and II) were administered at two different time points: (a) an early phase time point, i.e., at CLP, and (b) a time point 24 hours after CLP. The IP injection dose of ACMSD inhibitor was 15 mg / kg. Blood samples and target organ tissues (liver and kidney) were collected at sacrifice for histology and biomarker measurements.

[0975] LPS-induced sepsis model

[0976] Male C57 / 6 mice (12-15 weeks old) (obtained from Charles River Laboratories) were housed under a 12h / 12h light / dark cycle and had free access to water and standard chow. The mice were divided into four groups: control group, control + ACMSD inhibitor group, LPS group, and LPS + ACMSD inhibitor group. LPS (Sigma; 20 mg / kg / day and 1 mg / ml in 0.9% saline) was injected intraperitoneally, and the control group was treated with the same volume of 0.9% saline alone. Intraperitoneal injection of an ACMSD inhibitor (e.g., a compound of the present invention, a compound of Formula I, Ia, Ib, and II) at a dose of 15 mg / kg was used, which was injected intraperitoneally immediately after LPS injection. The control group and the LPS group alone were injected with an equal volume of solvent. Mice were sacrificed 24 h after various treatments, and livers and kidneys were collected for subsequent analysis.

[0977] Blood samples and target organ tissues (liver and kidney) were collected at sacrifice for histology and biomarker measurements.

[0978] Acute pancreatitis model

[0979] Male C57BL / 6 mice (8 weeks old) (obtained from Charles River Laboratories) were fed a standard commercial diet and housed in a pathogen-free facility at an ambient temperature of 20-22°C, a relative humidity of 50±5%, and a 12 / 12h light / dark cycle. Experiments were performed on mice weighing between 20g and 25g, and all mice were within 3 days of age.

[0980] Mice were fasted for 17 h before treatment, but were provided with free access to drinking water. As described above, acute pancreatitis was induced by six injections of insulin (50 μg / kg, intraperitoneal administration [ip] at 1 h intervals). Each experimental group consisted of five mice. The control group received an intraperitoneal injection of saline (0.9% NaCl) solution. In the combination group of caerulein and ACMSD inhibitor, an ACMSD inhibitor (e.g., a compound of the present invention, a compound of Formula I, Ia, Ib and II) dissolved in a carrier (corn oil) was orally injected 3 h before the first caerulein injection (15 mg / kg body weight). All mice were killed 6 h after the last caerulein injection. Blood samples were taken to determine serum amylase, lipase and cytokine levels. Part of the pancreas was fixed in 4% paraformaldehyde in phosphate-buffered saline (PBS, pH 7.4) at 4°C overnight, embedded in paraffin, and cut into 4-μm thick sections for immunohistochemical studies, which were then stained with hematoxylin and eosin (H&E) and observed for morphological changes under an optical microscope by standard procedures. After staining with H&E, the histological injury scores of the pancreatic sections were graded in a blinded manner according to the severity and extent of edema, inflammatory cell infiltration, and acinar necrosis without knowing the experimental design. Part of the pancreas was also frozen in liquid nitrogen for Western blot and RT-PCR analysis.

[0981] Acute liver injury model

[0982] Male Balb / c mice (6-8 weeks old, 20±2 g) (obtained from Charles River Laboratories) were housed in plastic cages with a controlled light-dark cycle and fed with standard chow and water in a temperature (25±1°C) and humidity (50±5%) controlled environment. Liver injury was induced by tail vein injection of concanavalin A (20 mg / kg body weight). The mice were randomly divided into six groups of ten mice, as follows: (1) saline control group; (2) ACMSD inhibitor alone group; (3) concanavalin A induced model group; (4) low-dose ACMSD inhibitor + concanavalin A group; (5) medium-dose ACMSD inhibitor + concanavalin A group; and (6) high-dose ACMSD inhibitor + concanavalin A group. In the first two weeks, mice in the ACMSD inhibitor (e.g., a compound of the present invention, a compound of Formula I, Ia, Ib and II) group were orally administered up to 15 mg / kg body weight / day. The remaining mice received 0.1 mL / 10 g body weight / day of 0.5% carboxymethylcellulose solution. On day 14, one hour after oral administration, mice were injected with concanavalin A (0.05 mL / 10 g) into the tail vein, except for the saline group and the ACMSD inhibitor group alone, which only received saline (0.05 mL / 10 g). After 8 hours, the animals were killed. The left liver lobe was stored at -80°C until IL-2, IL-6 and TNF-α were detected. The right liver lobe was fixed in 4% paraformaldehyde at 4°C for hematoxylin-eosin (HE) and immunohistochemical staining.

[0983] Acute Graft-versus-Host Disease (aGvHD) (MHC Mismatch) Model

[0984] Nine-week-old C57BL / 6 (B6) (H-2kb) and B / c (H-2kd) mice were purchased from Charles River Laboratories. Mice were housed in an animal facility under specific pathogen-free conditions, with a temperature of 22 ± 1 °C, a humidity of 55 ± 5%, a light / dark cycle of 12 h / 12 ​​h, and air in the facility was filtered through a high-efficiency particulate air (HEPA) filter system to exclude bacteria and viruses. Animals had free access to mouse chow and tap water. Splenocytes (5 × 10 6 ) and bone marrow cells (5×10 6 ) and transplanted into B / c recipient mice by intravenous (iv) injection. Before transplantation, B / c mice were sublethally irradiated with 690 cGy and allowed to rest for 2 hours. After GvHD induction, ACMSD inhibitors (e.g., compounds of the present invention, compounds of Formulas I, Ia, Ib, and II) were orally administered to recipient mice daily (15 mg / kg body weight / day per mouse) starting from day 0 after bone marrow transplantation. The control group GvHD mice received the vehicle (normal saline) and the administration method was the same as the treatment group. Ten mice were used in each group.

[0985] Survival after BMT was monitored daily, and the extent of GvHD was assessed weekly using a scoring system that incorporates changes in the following clinical parameters: weight loss, posture, activity, fur texture, and skin integrity. Mice irradiated at 690 cGy were euthanized 28 days after BMT, followed by blinded histopathological examination of GvHD target tissues.

[0986] Cytokine levels were measured in blood collected from the heart by cardiac puncture.

[0987] Histopathological and immunohistochemical analyses were performed on formalin-fixed tissue sections of skin, liver, and large and small intestine stained with hematoxylin and eosin. Epithelial desquamation, crypt damage, goblet cell depletion, and inflammatory cell infiltration were scored histologically.

[0988] siACMSD cytokine data

[0989] In Kupffer cells, silencing ACMSD modulated the secretion of two proinflammatory cytokines. Thus, short hairpin RNA (siACMSD) reduced the secretion of proinflammatory cytokines, tumor necrosis factor α, TNFα, interleukin, IL-1α, IL-1β, and IL-6 in macrophages stimulated with LPS compared with vehicle control ( Figure 1 ).

[0990] Inflammation and the Kynurenine Pathway (ACMSD and QPRT)

[0991] Under inflammatory conditions (50 ng / mL LPS), ACMSD expression increased in Kupffer cells, while QPRT expression decreased. Importantly, ACMSD inhibition using compound I-18 increased QPRT expression above basal conditions ( Figure 2 ).

[0992] Similar results (QPRT down-regulation and up-regulation) were obtained in primary human bone marrow mononuclear cells (BMMCs) ( Figure 3 ).

[0993] Thus, under inflammatory conditions, decreased QPRT expression limits tryptophan biosynthesis through the de novo pathway for NAD + Conversely, treatment with an ACMSD inhibitor upregulated QPRT expression, thereby restoring NAD + of biosynthesis.

[0994] NAD + Restoration of biosynthesis

[0995] ACMSD inhibition using compound I-17 and compound I-18 restored NAD in Kupffer cells, primary hepatocytes, and renal proximal tubule HK2 cells + Biosynthesis ( Figure 4 ).

[0996] Effects of ACMSD inhibition on downstream targets (SIRT1 and SIRT3)

[0997] NAD + SIRT1 is NAD-dependent + ACMSD inhibition using compound I-18 increased the expression of two downstream target genes longevity factors: SIRT-1 in Kupffer cells and SIRT-3 in HK2 primary tubule cells. Figure 5 ).

[0998] Compounds I-17 and I-18 (500 nM) both activated SIRT1 in primary hepatocytes as measured 24 hours after treatment. Figure 6 ).

[0999] ACMSD inhibition using compound I-18 (50 μM) also reversed the cisplatin-induced decrease in SIRT expression in HK2 primary tubule cells ( Figure 7 ).

[1000] Links between ACMSD inhibition, SIRT, and inflammatory responses

[1001] SIRT1 is a core component of the SIRT1 / STAT3 pathway. ACMSD inhibition of compound I-18 induced an increase in SIRT1 expression and activity, which increased the expression of signal transducer and activator of transcription 3 (STAT3) in Kupffer cells in a dose-dependent manner. Figure 8 ).

[1002] The Il-10 / JAK1 / STAT3 anti-inflammatory response is an essential negative regulator for controlling the extent and duration of inflammation. One of the main biological functions of IL-10 is to counteract the production of inflammatory mediators, especially in response to TLR signals. ACMSD inhibition using compound I-18 increased IL-10 expression in Kupffer cells in a dose-dependent manner, thereby promoting the anti-inflammatory response ( Fig. 9 ).

[1003] STAT3 interacts with IL-10 and Il-6. Binding of IL-10 to IL-10R leads to activation of JAK1, which induces phosphorylation of STAT3, a key effector molecule of IL-10 action. STAT3 activation is essential for the anti-inflammatory effects mediated by IL-10.

[1004] Both IL-10 and interleukin-6 (IL-6) induce STAT3 activation, but produce different cellular responses: IL-6 stimulation promotes a pro-inflammatory response, whereas IL-10 signaling induces a strong anti-inflammatory response.

[1005] ACMSD inhibits and regulates the expression and secretion of cytokines

[1006] After LPS-induced inflammation (Kupffer cells were treated with 50 ng / mL LPS, 16-18°C, incubation time 24 h, both figures), ACMSD using compounds I-17 and I-18 (1 μM) reduced the secretion of the proinflammatory cytokine IL-6 in Kupffer cells, and compound I-18 decreased the secretion of IL-6 in a dose-dependent manner ( Fig.10 ).

[1007] ACMSD inhibition using compounds I-17 and I-18 also reduced the secretion of the proinflammatory cytokine IL-6 in a dose-dependent manner in co-cultured primary hepatocytes and Kupffer cells after LPS-induced inflammation (50 ng / mL). Fig.11 ).

[1008] ACMSD inhibition using compound I-18 (5 μM) also reduced LPS-induced IL-6 secretion in primary human bone marrow mononuclear cells (BMMCs) ( Fig.12 ).

[1009] Therefore, the simultaneous reduction in IL-6 secretion and increase in IL-10 expression induced by ACMSD inhibitors produced a synergistic anti-inflammatory effect.

[1010] In addition to reducing IL-6 secretion and increasing IL-10 expression, ACMSD inhibition also has broad anti-inflammatory effects by modulating the expression and secretion of a range of pro-inflammatory and anti-inflammatory cytokines, chemokines, and other mediators of acute inflammatory responses across multiple inflammatory cell types, as described below.

[1011] Thus, ACMSD inhibition using compounds 1-17 and 1-18 reduced the secretion and expression of the following proinflammatory cytokines TNFα, IL-1β, and IL-6, and the expression of the chemokine MCP-1.

[1012] TNFα secretion

[1013] After LPS-induced inflammation (50 ng / mL), ACMSD inhibition using compounds I-17 and I-18 reduced the secretion of the inflammatory cytokine TNFα in Kupffer cells, BMMC cells, and co-cultured primary hepatocytes and stellate cells ( Fig.13 ).

[1014] TNFα expression

[1015] ACMSD inhibition using two compounds, I-17 and I-18 (5 μM), reduced TNFα expression in co-cultured primary hepatocytes and stellate cells after treatment with a free fatty acid mixture (after 6 h exposure to a mixture of palmitate (0.33 mM) and oleate (0.66 mM)), as well as in ex vivo renal tissue samples after intraperitoneal injection of 30 mg / kg / dose of compound I-18 in a CLP-induced sepsis mouse model ( Fig.14 ).

[1016] IL-1β secretion

[1017] After LPS-induced inflammation (50 ng / mL), ACMSD inhibition using compounds I-17 and I-18 (1 μM) reduced the secretion of the inflammatory cytokine IL-1β in Kupffer cells, as well as in co-cultured primary hepatocytes and stellate cells ( Fig.15 ).

[1018] IL-1β expression

[1019] ACMSD inhibition with compound I-17 (5 μM) reduced IL-1β expression in co-cultured primary hepatocytes and stellate cells after treatment with a free fatty acid mixture (6 h after exposure to a mixture of palmitate (0.33 mM) and oleate (0.66 mM)), as well as in ex vivo renal tissue samples after intraperitoneal injection of 30 mg / kg / dose of compound I-18 in a CLP-induced sepsis mouse model ( Fig.16 ).

[1020] MCP1 expression

[1021] In ex vivo renal tissue samples after intraperitoneal injection of 30 mg / kg / dose of compound I-18 in a CLP-induced sepsis mouse model, ACMSD inhibition reduced the expression of MCP1 ( Fig.17 ).

[1022] Inhibition of the anti-fibrotic / anti-apoptotic effects of ACMSD

[1023] ACMSD inhibition with compound I-17 or compound I-18 (5 μM) reduced the expression of profibrotic cytokine TGF-β, profibrotic chemokine CTGF, profibrotic gene Bcl-2 associated gene X (BAX), actin alpha 2 (ACTA2), type 1 collagen alpha 1 chain CoI1a1, fibronectin, thrombospondin-1 (THBS-1), and tissue inhibitor of metalloproteinase 2 (TIMP2) in co-cultured primary hepatocytes and stellate cells after treatment with a free fatty acid mixture (after exposure to a mixture of palmitate (0.33 mM) and oleate (0.66 mM) for 6 h). Fig.18 ).

[1024] The antifibrotic effect of ACMSD inhibition by reducing transforming growth factor β (TGF-β) is mediated by the TGFβ / SMAD pathway, as also demonstrated by a dose-dependent decrease in maternal SMAD3 expression in both prophylactic and therapeutic treatment with compound 1-18 after TGF-β-induced fibrosis in HK2 cells. SMAD4 expression is less regulated ( Fig.19 ).

[1025] The antifibrotic effect of ACMSD inhibition was further demonstrated by the dose-dependent reduction of fibronectin and TIMP2 expression by compound I-18 ( Fig. 20 ).

[1026] ACMSD inhibition and mitochondria in the inflammatory setting

[1027] Mitochondria in inflammatory diseases of the liver and kidney

[1028] After 24 h of treatment, ACMSD inhibition using compounds I-17 or I-18 enhanced mitochondrial superoxide dismutase 2 (SOD2) activity in mouse primary hepatocytes in a dose-dependent manner ( Fig.21 ).

[1029] In HK-2 cells, ACMSD inhibition using compound I-18 (100 μM) also enhanced the expression of SOD2 and mitochondrial dynamin-like 120 kDa protein (OPA-1) after cisplatin injury ( Fig. 22 ).

[1030] After cisplatin insult (100 μM), ACMSD inhibition using compound I-17 modulated cellular ROS generation and mitochondrial biogenesis in various cell types, enhancing the expression of mitochondrial transcription factor A (TFAM) via SIRT-1 activation in primary hepatocytes and the expression of mitochondrial fusion protein OPA-1 via SIRT-3 activation in rat kidney NRK52E cells ( Fig.23 ).

[1031] In primary hepatocytes, ACMSD inhibition using compound I-17 increased the mRNA levels of fatty acid oxidation genes, medium-chain acyl-CoA dehydrogenase (Mcad), carnitine palmitoyltransferase 1 (Cpt1α), hydroxyacyl-CoA dehydrogenase (Hadha1), hormone-sensitive lipase (Hsl), pyruvate dehydrogenase lipoamide kinase 4 (Pdk4), and succinate dehydrogenase (Sdha1) after 6 h of exposure to a mixture of palmitate (0.33 mM) and oleate (0.66 mM). Fig.24 ).

[1032] ACMSD inhibition using 100 μM compound I-18 increased the mRNA levels of mitochondrial and oxidative stress genes, citrate synthase (CS), NDAH ubiquinone oxidoreductase subunit 2 (Ndufa2), cytochrome c oxidase subunit 2 (Cox2), ATP synthase lipid-binding protein (Atp5g1), superoxide dismutase 1 (Sod1), and superoxide dismutase 2 (Sod2) ( Fig.25 ).

[1033] After 24 h of treatment, ACMSD inhibition using compounds I-17 and I-18 increased the mRNA levels of mitochondrial genes, TFAM, Ndufa, ubiquinol-cytochrome C reductase core protein 1 (Uqcrc1), CytC, Atp5g1, and CS in mouse primary hepatocytes ( Fig.26 ).

[1034] The increase in mRNA levels of mitochondrial genes, Sod1, Ndufa2, Cox2, and CytC in HK-2 cells after 24 h of treatment with the ACMSD inhibitor compound I-18 was SIRT1-dependent and blocked by Sirt1 inhibition as shown by treatment with compound I-18 combined with a SIRT1 inhibitor (EX527) at the indicated concentrations ( Fig. 27 ).

[1035] Administration of ACMSD inhibitor compounds I-17 and I-18 also induced the transcription of mitochondrial genes, medium-chain acyl-CoA dehydrogenase (Mcad), carnitine palmitoyltransferase 1 (CptIa), NDAH ubiquinone oxidoreductase subunit 2 (Ndufa2), ATP synthase lipid-binding protein (Atp5g1), and superoxide dismutase 2 (Sod2) in the liver, but the expression of the same genes in the kidney was not affected ( Fig.28 ).

[1036] ACMSD inhibition using compound I-17 in primary hepatocytes increased mitochondrial SOD2 expression ( Fig.29 ).

[1037] ACMSD inhibition and Kupffer cell (macrophage) polarization

[1038] ACMSD inhibition of IL-18 induced polarization of liver-resident macrophages (Kupffer cells) toward an M2 macrophage phenotype, as evidenced by a decrease in M1 macrophage gene markers and an increase in M2 macrophage gene markers.

[1039] Thus, mouse Kupffer cells treated with LPS and compound I-18 showed a decrease in the expression of M1 phenotype gene markers, iNOS, IL-6, and TNFα ( Fig.30 ), and a corresponding increase in M2 phenotype gene markers, arginase-1, mannose receptor (Mrc-2), and IL-10 ( Fig.31 ).

[1040] ACMSD inhibition and protection against LPS-induced systemic inflammation

[1041] ACMSD inhibition of IL-18 improved survival and reduced mortality in C57BL / 6 mice subjected to LPS-induced systemic inflammation by promoting an anti-inflammatory phenotype.

[1042] Anti-inflammatory properties of ACMSD inhibitors

[1043] α-Amino-β-carboxymuconate-ε-semialdehyde decarboxylase (ACMSD) is an enzyme of the kynurenine pathway (KP) that is primarily expressed in the liver and kidney, representing the nascent NAD + A branch point in the biosynthetic pathway directing tryptophan to NAD + conversion.

[1044] We demonstrated that ACMSD inhibition by the pharmacological inhibitor compound 1-18 exhibited protective effects in preclinical models of liver and kidney diseases, such as NASH and AKI, respectively.

[1045] We demonstrated that ACMSD inhibition using compound I-18 exhibited anti-inflammatory effects in liver macrophages in vitro, promoting their transformation from a pro-inflammatory M1 (induced by LPS) to an anti-inflammatory M2 phenotype (M1 to M2 transition), and its mechanism of action was related to improving NAD + This is consistent with metabolic reprogramming regulated by mitochondrial homeostasis.

[1046] Furthermore, these effects were manifested by improved survival in LPS-induced and cecal ligation and puncture (CLP)-induced systemic inflammation mouse models, expanding the therapeutic opportunities of ACMSD inhibitors in diseases associated with systemic inflammation in the liver-kidney axis.

[1047] Materials and methods: Compound I-18 was used for 24h treatment in the presence of LPS to evaluate the anti-inflammatory properties and the transition from M1 to M2. Compound I-18 and TGFβ were used to stimulate tubular cells for 16 hours to evaluate the expression of fibrosis-related genes. After treatment with 15mg / kg LPS in mice, compound I-18 (50mg / kg) was administered daily. The survival percentage and liver gene changes of the control (Sham) group, LPS group and LPS+compound I-18 group (n=8) were monitored. Mice aged 12-15 weeks received CLP (50% ligation, penetrating puncture with a 21G needle) to evaluate CLP-induced sepsis. Starting from CLP, compound I-18 was administered at a concentration of 50mg / kg for 7 days. The survival percentage and the expression of genes related to renal inflammation were monitored.

[1048] Results: ACMSD expression was determined in liver-resident macrophages (Kupffer cells). Pharmacological ACMSD inhibition showed anti-inflammatory properties in vitro, promoting an anti-inflammatory M2 phenotype. Compound I-18 reduced fibrosis in renal cells. Compound I-18 promoted survival of mice subjected to two different inflammatory stimuli (LPS and CLP).

[1049] Conclusions: Taken together, these results expand the therapeutic opportunities of ACMSD inhibitors, reveal a new physiological function of ACMSD in regulating systemic inflammatory responses, and provide further therapeutic applications for ACMSD inhibitors.

[1050] Effects of ACMSD inhibition on M1 and M2 macrophage polarization

[1051] Macrophages are essential components of innate immunity and play a central role in inflammation and host defense. Classical M1 activation of macrophages results in the release of proinflammatory cytokines, ROS, and nitric oxide. Alternative M2 activation can promote tissue remodeling and exert immunomodulatory functions by producing ornithine and polyamines. Due to the plasticity of macrophages, they can switch from an activated M1 state back to an M2 state and vice versa. The M1 / M2 polarization of Kupffer cells plays a crucial role in the pathogenesis of hepatic metabolic syndrome.

[1052] The M1 phenotype exhibits pro-inflammatory properties, while the M2 phenotype exhibits anti-inflammatory and immune tolerance effects.

[1053] Blocking of ACMSD inhibition of pro-inflammatory M1 macrophages by compound 1-18 can lead to a shift from M1 to M2. Mouse Kupffer cells were treated with LPS and compound 1-18 to assess the role of ACMSD inhibition in the M1 / M2 shift. Fig.30 Compound 1-18 was shown to block pro-inflammatory M1 Kupffer macrophages.

[1054] Compound 1-18 can be seen to shift from M1 to M2 by increasing ACMSD inhibition of anti-inflammatory M2 macrophages. During inflammation, M2 phenotype biomarkers should increase, indicating the presence of an anti-inflammatory response. Fig.31 Compound 1-18 was shown to promote anti-inflammatory M2 Kupffer macrophages.

[1055] In addition, two different stimulations (LPS and IL-4) were performed to assess the M2 phenotype. Fig.32 It was shown that compound 1-18 was able to promote the M2 macrophage phenotype.

[1056] Thus, in mouse Kupffer cells, compound I-18 was shown to block pro-inflammatory M1 macrophages in a dose-response manner. Compound I-18 promoted the phenotype of M2 macrophages in mouse Kupffer cells. These results suggest that compound I-18 may have an anti-inflammatory effect, favoring the anti-inflammatory M2 while reducing the pro-inflammatory M1 phenotype.

[1057] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as those of ordinary skill in the art to which the invention belongs. In the specification, unless the context clearly stipulates otherwise, the singular also includes the plural. Although methods and materials similar or equivalent to the methods and materials described herein can be used in the practice and testing of the present invention, suitable methods and materials are described below. All publications, patent applications, patents and other references mentioned herein are expressly incorporated by reference. The references cited herein are not admitted to be prior art claimed to be disclosed. In the event of a conflict, this specification, including definitions, will control. In addition, materials, methods and embodiments are illustrative only and are not intended to be restrictive.

[1058] Equivalent

[1059] Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, that there are many equivalents to the specific embodiments and methods described herein. Such equivalents are intended to be encompassed within the scope of the present invention.

Claims

1. A method for treating an acute inflammatory disease in a subject, comprising administering to the subject a therapeutically effective amount of a compound represented by formula (I): or a pharmaceutically acceptable salt or tautomer thereof, in: X is O or OH; L is –(CH2)mCH2CH2-, –(CH2)mY(CH2)p-, –(CH2)mC(O)(CH2)p-, –(CH2)mC(O)O(CH2)p-, –(CH2)mC(O)NR 2 (CH2)p-, or -(CH2)mNR 2 C(O)(CH2)p; Y is O, N or S(O)q; R 1 It is C6-C 10 aryl or heteroaryl, wherein the aryl or heteroaryl is replaced by R a and R b and optionally substituted by one or more R e replace; R 2 Is H or C6-C 10 alkyl; R a and R b One of them is hydrogen and the other is -(CH2) r CO2R x 、-OCH2CO2R x 、-(CH2) r Tetrazole, -(CH2) r Oxadiazolone, -(CH2) r Tetrazodone, -(CH2) r Dihydrotetrazodone, -(CH2) r Thiadiazole, -(CH2) r Isoxazol-3-ol, -(CH2) r P(O)(OH)OR x 、-(CH2) r S(O)2OH, -(CH2) r C(O)NHCN, or -(CH2) r C(O)NHS(O)2alkyl; R c H, C1-C6 alkyl, C1-C6 haloalkyl, halogen, –CN, –OR x 、-CO2R x , or NO2; R d is methyl, optionally substituted 5- to 10-membered aryl, optionally substituted 5- or 6-membered heteroaryl, or optionally substituted 5- or 6-membered carbocyclic ring; Each R x is independently at each occurrence hydrogen or C1-C6 alkyl; Each R e are independently C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, halogen, -OR y , C1-C6 haloalkyl, -NHR z , -OH, or -CN; R f It is H or not present; Each R y and R z are independently hydrogen, C1-C6 alkyl, or C1-C6 haloalkyl; Each m and p is independently 0, 1 or 2, where m+p<3; q is 0, 1, or 2; r is 0 or 1; and Dashed lines are optional double bonds; Additional conditions: when X is O, L is –SCH2-, and R d When R is an optionally substituted phenyl group, c is not hydrogen or –CN, when X is O, L is –SCH2-, and R d When it is methyl, R c is not C1-C6 alkyl, and when X is O, L is –SCH2- and R d When it is 2-furanyl, R c Not –CN.

2. The method according to claim 1, wherein the compound is represented by formula (Ia): or a pharmaceutically acceptable salt or tautomer thereof.

3. The method according to claim 1 or 2, wherein the compound is represented by formula (Ib): or a pharmaceutically acceptable salt thereof, wherein n is 0, 1, 2 or 3.

4. The method according to any one of claims 1 to 3, in: R a and R b One of them is hydrogen and the other is CO2R x 、CH2CO2R x , tetrazole, or oxadiazolone; R c Halogen, –CN, –OR x , or C1-C6 alkyl; R d is methyl, optionally substituted 5- to 10-membered aryl, optionally substituted 5- or 6-membered heteroaryl, or optionally substituted 5- or 6-membered carbocyclic ring; and R x is hydrogen or C1-C6 alkyl; Each R e are independently C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, halogen, -OR y , C1-C6 haloalkyl, -NHR z , -OH, or -CN; Each R y and R z are independently hydrogen, C1-C6 alkyl, or C1-C6 haloalkyl; and n is 0, 1, 2, or 3; The additional condition is: when R d When R is an optionally substituted phenyl group, c is not hydrogen or –CN, when R d When it is 2-furanyl, R c Not –CN.

5. The method according to any one of claims 1 to 3, wherein the compound is represented by formula (II): or a pharmaceutically acceptable salt thereof.

6. The method according to claim 5, wherein R c Halogen, –CN, –OR x or C1-C6 alkyl, R d is methyl, optionally substituted 5- to 10-membered aryl, optionally substituted 5- or 6-membered heteroaryl, or optionally substituted 5- or 6-membered carbocyclic ring, and R x It is hydrogen or C1-C6 alkyl.

7. The method according to any one of claims 1 to 6, wherein R c It is –CN or halogen.

8. The method according to any one of claims 1 to 7, wherein R d is methyl, cyclohexyl, pyridyl, thiazolyl, phenyl, or thienyl.

9. The method according to any one of claims 1 to 7, wherein R d is methyl, cyclohexyl, pyridyl, thiazolyl, thienyl, or optionally substituted phenyl.

10. The method according to any one of claims 1 to 4, wherein R a is hydrogen, CH2CO2H, tetrazole, or oxadiazolone (1,2,4-oxadiazol-5(4H)-one).

11. The method according to any one of claims 1 to 4, wherein R b is hydrogen, CH2CO2H, tetrazole, or oxadiazolone (1,2,4-oxadiazol-5(4H)-one).

12. The method according to any one of claims 1 to 4, wherein n is 0.

13. The method according to claim 1, wherein the compound is selected from the group consisting of: or a pharmaceutically acceptable salt thereof.

14. The method according to claim 1, wherein the compound is selected from the group consisting of: or a pharmaceutically acceptable salt thereof.

15. The method according to claim 1, wherein the compound is selected from the group consisting of: or a pharmaceutically acceptable salt thereof.

16. The method of claim 1, wherein the compound is or a pharmaceutically acceptable salt thereof.

17. The method of claim 1, wherein the compound is or a pharmaceutically acceptable salt thereof.

18. The method of claim 1, wherein the compound is or a pharmaceutically acceptable salt thereof.

19. The method of claim 1, wherein the compound is or a pharmaceutically acceptable salt thereof.

20. The method of any one of claims 1-19, wherein the acute inflammatory disease is a systemic inflammatory disease.

21. The method of any one of claims 1-19, wherein the acute inflammatory disease is an organ-specific disease.

22. The method of any one of claims 1-19, wherein the acute inflammatory disease is cytokine storm or hypercytokineemia, systemic inflammatory response syndrome (SIRS), graft versus host disease (GVHD), acute respiratory distress syndrome (ARDS), severe acute respiratory distress syndrome (SARS), catastrophic antiphospholipid syndrome, viral infection, bacterial infection, fungal infection, influenza, pneumonia, shock, or sepsis.

23. The method of any one of claims 1-19, wherein the acute inflammatory disease is acute pancreatitis, hepatitis, respiratory disease, or enterocolitis.

24. The method of any one of claims 1-23, wherein the method reduces pro-inflammatory cytokines or increases anti-inflammatory cytokines.

25. The method of claim 24, wherein the proinflammatory cytokine is IL-1β, IL-6, IL-18, TNF-α, or TGF-β.

26. The method of claim 24, wherein the proinflammatory cytokine is MCP-1, TNF-α, or IL-1β.

27. The method of claim 24, wherein the proinflammatory cytokine is IL-6.

28. The method of claim 24, wherein the anti-inflammatory cytokine is IL-10.

29. The method according to any one of claims 1-23, wherein the expression of the longevity factor-1 regulatory genes sod2, tfam and ddal genes in the liver is increased.

30. A compound represented by formula (I): or a pharmaceutically acceptable salt or tautomer thereof, in: X is O or OH; L is –(CH2) m CH2CH2-, –(CH2) m Y(CH2) p -, -(CH2) m C(O)(CH2) p -, -(CH2) m C(O)O(CH2) p -, -(CH2) m C(O)NR 2 (CH2) p -, or -(CH2) m NR 2 C(O)(CH2) p ; Y is O, N or S(O) q ; R 1 It is C6-C 10 aryl or heteroaryl, wherein the aryl and heteroaryl are R a and R b and optionally substituted by one or more R e replace; R 2 is H or C1-C6 alkyl; R a and R b One of them is hydrogen and the other is -(CH2) r CO2R x 、-OCH2CO2R x 、-(CH2) r Tetrazole, -(CH2) r Oxadiazolone, -(CH2) r Tetrazodone, -(CH2) r Dihydrotetrazodone, -(CH2) r Thiadiazole, -(CH2) r Isoxazol-3-ol, -(CH2) r P(O)(OH)OR x 、-(CH2) r S(O)2OH, -(CH2) r C(O)NHCN, or -(CH2) r C(O)NHS(O)2alkyl; R c H, C1-C6 alkyl, C1-C6 haloalkyl, halogen, –CN, –OR x 、-CO2R x , or NO2; R d is methyl, optionally substituted 5- to 10-membered aryl, optionally substituted 5- or 6-membered heteroaryl, or optionally substituted 5- or 6-membered carbocyclic ring; Each R x is independently at each occurrence hydrogen or C1-C6 alkyl; Each R e are independently C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, halogen, -OR y , C1-C6 haloalkyl, -NHR z , -OH, or -CN; R f It is H or not present; Each R y and R z are independently hydrogen, C1-C6 alkyl, or C1-C6 haloalkyl; Each m and p is independently 0, 1 or 2, where m+p<3; q is 0, 1, or 2; r is 0 or 1; and Dashed lines are optional double bonds; Additional conditions: when X is O, L is –SCH2-, and R d When R is an optionally substituted phenyl group, c is not hydrogen or –CN, when X is O, L is –SCH2-, and R d When it is methyl, R c is not C1-C6 alkyl, and when X is O, L is –SCH2- and R d When it is 2-furanyl, R c Not – CN; Used to treat acute inflammatory diseases.

31. The compound for use in claim 30, wherein the compound is represented by formula (Ia): or a pharmaceutically acceptable salt or tautomer thereof.

32. The compound for use in claim 30 or 31, wherein the compound is represented by formula (Ib): or a pharmaceutically acceptable salt thereof, wherein n is 0, 1, 2 or 3.

33. A compound for use as claimed in any one of claims 30 to 32, in: R a and R b One of them is hydrogen and the other is CO2R x 、CH2CO2R x , tetrazole, or oxadiazolone; R c Halogen, –CN, –OR x , or C1-C6 alkyl; R d is methyl, optionally substituted 5- to 10-membered aryl, optionally substituted 5- or 6-membered heteroaryl, or optionally substituted 5- or 6-membered carbocyclic ring; and R x is hydrogen or C1-C6 alkyl; Each R e are independently C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, halogen, -OR y , C1-C6 haloalkyl, -NHR z , -OH, or -CN; Each R y and R z are independently hydrogen, C1-C6 alkyl, or C1-C6 haloalkyl; and n is 0, 1, 2, or 3; The additional condition is: when R d When R is an optionally substituted phenyl group, c is not hydrogen or –CN, and when R d When it is 2-furanyl, R c Not –CN.

34. A compound for use in any one of claims 30-32, wherein the compound is represented by formula (II): or a pharmaceutically acceptable salt thereof.

35. The compound for use in claim 34, wherein R c Is halogen, –CN, –OR x or C1-C6 alkyl, R d is methyl, optionally substituted 5- to 10-membered aryl, optionally substituted 5- or 6-membered heteroaryl, or optionally substituted 5- or 6-membered carbocyclic ring, and R x It is hydrogen or C1-C6 alkyl.

36. A compound for use in any one of claims 30-35, wherein R c It is –CN or halogen.

37. A compound for use in any one of claims 30-36, wherein R d is methyl, cyclohexyl, pyridyl, thiazolyl, phenyl, or thienyl.

38. A compound for use in any one of claims 30-36, wherein R d is methyl, cyclohexyl, pyridyl, thiazolyl, thienyl, or optionally substituted phenyl.

39. A compound for use in any one of claims 30-33, wherein R a is hydrogen, CH2CO2H, tetrazole, or oxadiazolone (1,2,4-oxadiazol-5(4H)-one).

40. A compound for use in any one of claims 30-33, wherein R b is hydrogen, CH2CO2H, tetrazole, or oxadiazolone (1,2,4-oxadiazol-5(4H)-one).

41. A compound for use in any one of claims 30-33, wherein n is 0.

42. The compound for use in claim 30, wherein the compound is selected from the group consisting of: or a pharmaceutically acceptable salt thereof.

43. The compound for use in claim 30, wherein the compound is selected from the group consisting of: or a pharmaceutically acceptable salt thereof.

44. The compound for use in claim 30, wherein the compound is selected from the group consisting of: or a pharmaceutically acceptable salt thereof.

45. The compound for use in claim 30, wherein the compound is or a pharmaceutically acceptable salt thereof.

46. ​​The compound for use in claim 30, wherein the compound is or a pharmaceutically acceptable salt thereof.

47. A compound for use in claim 30, wherein the compound is or a pharmaceutically acceptable salt thereof.

48. A compound for use in claim 30, wherein the compound is or a pharmaceutically acceptable salt thereof.

49. A compound for use as claimed in any one of claims 30 to 48, wherein the acute inflammatory disease is a systemic inflammatory disease.

50. The compound for use in any one of claims 30-48, wherein the acute inflammatory disease is an organ-specific disease.

51. A compound for use in any one of claims 30-48, wherein the acute inflammatory disease is cytokine storm or hypercytokineemia, systemic inflammatory response syndrome (SIRS), graft versus host disease (GVHD), acute respiratory distress syndrome (ARDS), severe acute respiratory distress syndrome (SARS), catastrophic antiphospholipid syndrome, viral infection, bacterial infection, fungal infection, influenza, pneumonia, shock, or sepsis.

52. The compound for use in any one of claims 30-48, wherein the acute inflammatory disease is acute pancreatitis, hepatitis, respiratory disease, or enterocolitis.

53. A compound for use in any one of claims 30-48, wherein pro-inflammatory cytokines are reduced or anti-inflammatory cytokines are increased.

54. The compound for use in claim 53, wherein the proinflammatory cytokine is IL-1β, IL-6, IL-18, TNF-α, or TGF-β.

55. The compound for use in claim 53, wherein the proinflammatory cytokine is MCP-1, TNF-α, or IL-1β.

56. The compound for use in claim 53, wherein the pro-inflammatory cytokine is IL-6.

57. The compound for use in claim 53, wherein the anti-inflammatory cytokine is IL-10.

58. A compound for use in any one of claims 30-52, wherein the expression of the longevity factor-1 regulatory genes sod2, tfam and ddal genes in the liver is increased.

59. Use of a compound represented by formula (I): or a pharmaceutically acceptable salt or tautomer thereof, in: X is O or OH; L is –(CH2) m CH2CH2-, –(CH2) m Y(CH2) p -, -(CH2) m C(O)(CH2) p -, -(CH2) m C(O)O(CH2) p -, -(CH2) m C(O)NR 2 (CH2) p -, or -(CH2) m NR 2 C(O)(CH2) p ; Y is O, N or S(O) q ; R 1 It is C6-C 10 aryl or heteroaryl, wherein the aryl and heteroaryl are R a and R b and optionally substituted by one or more R e replace; R 2 is H or C1-C6 alkyl; R a and R b One of them is hydrogen and the other is -(CH2) r CO2R x 、-OCH2CO2R x 、-(CH2) r Tetrazolyl, -(CH2) r Oxadiazolone, -(CH2) r Tetrazodone, -(CH2) r Dihydrotetrazodone, -(CH2) r Thiadiazole, -(CH2) r Isoxazol-3-ol, -(CH2) r P(O)(OH)OR x 、-(CH2) r S(O)2OH, -(CH2) r C(O)NHCN, or -(CH2) r C(O)NHS(O)2alkyl; R c H, C1-C6 alkyl, C1-C6 haloalkyl, halogen, –CN, –OR x 、-CO2R x , or NO2; R d is methyl, optionally substituted 5- to 10-membered aryl, optionally substituted 5- or 6-membered heteroaryl, or optionally substituted 5- or 6-membered carbocyclic ring; Each R x is independently at each occurrence hydrogen or C1-C6 alkyl; Each R e are independently C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, halogen, -OR y , C1-C6 haloalkyl, -NHR z , -OH, or -CN; R f It is H or not present; Each R y and R z are independently hydrogen, C1-C6 alkyl, or C1-C6 haloalkyl; Each m and p is independently 0, 1 or 2, where m+p<3; q is 0, 1, or 2; r is 0 or 1; and Dashed lines are optional double bonds; Additional conditions: when X is O, L is –SCH2- and R d When R is an optionally substituted phenyl group, c is not hydrogen or –CN, when X is O, L is –SCH2- and R d When it is methyl, R c is not C1-C6 alkyl, and when X is O, L is –SCH2- and R d When it is 2-furanyl, R c Not – CN; Used to treat acute inflammatory diseases.

60. The use according to claim 59, wherein the compound is represented by formula (Ia) or a pharmaceutically acceptable salt or tautomer thereof.

61. The use according to claim 59 or 60, wherein the compound is represented by formula (Ib): or a pharmaceutically acceptable salt thereof, wherein n is 0, 1, 2 or 3.

62. The use according to any one of claims 59 to 61, in: R a and R b One of them is hydrogen and the other is CO2R x 、CH2CO2R x , tetrazole, or oxadiazolone; R c Is halogen, –CN, –OR x , or C1-C6 alkyl; R d is methyl, optionally substituted 5- to 10-membered aryl, optionally substituted 5- or 6-membered heteroaryl, or optionally substituted 5- or 6-membered carbocyclic ring; and R x is hydrogen or C1-C6 alkyl; Each R e are independently C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, halogen, -OR y , C1-C6 haloalkyl, -NHR z , -OH, or -CN; Each R y and R z are independently hydrogen, C1-C6 alkyl, or C1-C6 haloalkyl; and n is 0, 1, 2, or 3; The additional condition is: when R d When R is an optionally substituted phenyl group, c is not hydrogen or –CN, and when R d When it is 2-furanyl, R c Not –CN.

63. The use according to any one of claims 59-61, wherein the compound is represented by formula (II): or a pharmaceutically acceptable salt thereof.

64. The use according to claim 63, wherein R c Is halogen, –CN, –OR x , or C1-C6 alkyl, R d is methyl, optionally substituted 5- to 10-membered aryl, optionally substituted 5- or 6-membered heteroaryl, or optionally substituted 5- or 6-membered carbocyclic ring, and R x It is hydrogen or C1-C6 alkyl.

65. The use according to any one of claims 59-64, wherein R c It is –CN or halogen.

66. The use according to any one of claims 59-65, wherein R d is methyl, cyclohexyl, pyridyl, thiazolyl, phenyl, or thienyl.

67. The use according to any one of claims 59-65, wherein R d is methyl, cyclohexyl, pyridyl, thiazolyl, thienyl, or optionally substituted phenyl.

68. The use according to any one of claims 59-62, wherein R a is hydrogen, CH2CO2H, tetrazole, or oxadiazolone (1,2,4-oxadiazol-5(4H)-one).

69. The use according to any one of claims 59-62, wherein R b is hydrogen, CH2CO2H, tetrazole, or oxadiazolone (1,2,4-oxadiazol-5(4H)-one).

70. The use according to any one of claims 59-62, wherein n is 0.

71. The use according to claim 59, wherein the compound is selected from the group consisting of: or a pharmaceutically acceptable salt thereof.

72. The use according to claim 59, wherein the compound is selected from the group consisting of or a pharmaceutically acceptable salt thereof.

73. The use according to claim 59, wherein the compound is selected from the group consisting of or a pharmaceutically acceptable salt thereof.

74. The use according to claim 59, wherein the compound is or a pharmaceutically acceptable salt thereof.

75. The use according to claim 59, wherein the compound is or a pharmaceutically acceptable salt thereof.

76. The use according to claim 59, wherein the compound is or a pharmaceutically acceptable salt thereof.

77. The use according to claim 59, wherein the compound is or a pharmaceutically acceptable salt thereof.

78. The use according to any one of claims 59-77, wherein the acute inflammatory disease is a systemic inflammatory disease.

79. The use according to any one of claims 59-77, wherein the acute inflammatory disease is an organ-specific disease.

80. The use according to any one of claims 59-77, wherein the acute inflammatory disease is cytokine storm or hypercytokineemia, systemic inflammatory response syndrome (SIRS), graft-versus-host disease (GVHD), acute respiratory distress syndrome (ARDS), severe acute respiratory distress syndrome (SARS), catastrophic antiphospholipid syndrome, viral infection, bacterial infection, fungal infection, influenza, pneumonia, shock, or sepsis.

81. The use according to any one of claims 59-77, wherein the acute inflammatory disease is acute pancreatitis, hepatitis, respiratory disease or enterocolitis.

82. The use according to any one of claims 59-81, wherein pro-inflammatory cytokines are reduced or anti-inflammatory cytokines are increased.

83. The use of claim 82, wherein the proinflammatory cytokine is IL-1β, IL-6, IL-18, TNF-α, or TGF-β.

84. The use according to claim 82, wherein the proinflammatory cytokine is MCP-1, TNF-α, or IL-1β.

85. The use of claim 82, wherein the proinflammatory cytokine is IL-6.

86. The use according to claim 82, wherein the anti-inflammatory cytokine is IL-10.

87. The use according to any one of claims 59-81, wherein the expression of the longevity factor-1 regulatory genes sod2, tfam and ddal genes in the liver is increased.

88. A compound represented by formula (I): or a pharmaceutically acceptable salt or tautomer thereof, in: X is O or OH; L is –(CH2) m CH2CH2-, –(CH2) m Y(CH2) p -, -(CH2) m C(O)(CH2) p -,-(CH2) m C(O)O(CH2) p -,-(CH2) m C(O)NR 2 (CH2) p -, or -(CH2) m NR 2 C(O)(CH2) p ; Y is O, N or S(O) q ; R 1 It is C6-C 10 aryl or heteroaryl, wherein the aryl and heteroaryl are R a and R b and optionally substituted by one or more R e replace; R 2 is H or C1-C6 alkyl; R a and R b One of them is hydrogen and the other is -(CH2) r CO2R x 、-OCH2CO2R x 、-(CH2) r Tetrazolyl, -(CH2) r Oxadiazolone, -(CH2) r Tetrazodone, -(CH2) r Dihydrotetrazodone, -(CH2) r Thiadiazole, -(CH2) r Isoxazol-3-ol, -(CH2) r P(O)(OH)OR x 、-(CH2) r S(O)2OH, -(CH2) r C(O)NHCN, or -(CH2) r C(O)NHS(O)2alkyl; R c H, C1-C6 alkyl, C1-C6 haloalkyl, halogen, –CN, –OR x 、-CO2R x , or NO2; R d is methyl, optionally substituted 5- to 10-membered aryl, optionally substituted 5- or 6-membered heteroaryl, or optionally substituted 5- or 6-membered carbocyclic ring; Each R x is independently at each occurrence hydrogen or C1-C6 alkyl; Each R e are independently C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, halogen, -OR y , C1-C6 haloalkyl, -NHR z , -OH, or -CN; R f It is H or not present; Each R y and R z are independently hydrogen, C1-C6 alkyl, or C1-C6 haloalkyl; Each m and p is independently 0, 1 or 2, where m+p<3; q is 0, 1, or 2; r is 0 or 1; and Dashed lines are optional double bonds; Additional conditions: when X is O, L is –SCH2- and R d When R is an optionally substituted phenyl group, c is not hydrogen or –CN, when X is O, L is –SCH2- and R d When it is methyl, R c is not C1-C6 alkyl, and when X is O, L is –SCH2- and R d When it is 2-furanyl, R c Not – CN; Use in preparing medicines for treating acute inflammatory diseases.

89. The use according to claim 88, wherein the compound is represented by formula (Ia) or a pharmaceutically acceptable salt or tautomer thereof.

90. The use according to claim 88 or 89, wherein the compound is represented by formula (Ib): or a pharmaceutically acceptable salt thereof, wherein n is 0, 1, 2 or 3.

91. The use according to any one of claims 88 to 90, in: R a and R b One of them is hydrogen and the other is CO2R x 、CH2CO2R x , tetrazole, or oxadiazolone; R c Is halogen, –CN, –OR x , or C1-C6 alkyl; R d is methyl, optionally substituted 5- to 10-membered aryl, optionally substituted 5- or 6-membered heteroaryl, or optionally substituted 5- or 6-membered carbocyclic ring; and R x is hydrogen or C1-C6 alkyl; Each R e are independently C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, halogen, -OR y , C1-C6 haloalkyl, -NHR z , -OH, or -CN; Each R y and R z are independently hydrogen, C1-C6 alkyl, or C1-C6 haloalkyl; and n is 0, 1, 2, or 3; The additional condition is: when R d When R is an optionally substituted phenyl group, c is not hydrogen or –CN, and when R d When it is 2-furanyl, R c Not –CN.

92. The use according to any one of claims 88-90, wherein the compound is represented by formula (II): or a pharmaceutically acceptable salt thereof.

93. The use according to claim 92, wherein R c Is halogen, –CN, –OR x , or C1-C6 alkyl, R d is methyl, optionally substituted 5- to 10-membered aryl, optionally substituted 5- or 6-membered heteroaryl, or optionally substituted 5- or 6-membered carbocyclic ring, and R x It is hydrogen or C1-C6 alkyl.

94. The use according to any one of claims 88-93, wherein R c It is –CN or halogen.

95. The use according to any one of claims 88-94, wherein R d is methyl, cyclohexyl, pyridyl, thiazolyl, phenyl, or thienyl.

96. The use according to any one of claims 88-94, wherein R d is methyl, cyclohexyl, pyridyl, thiazolyl, thienyl, or optionally substituted phenyl.

97. The use according to any one of claims 88-91, wherein R a is hydrogen, CH2CO2H, tetrazole, or oxadiazolone (1,2,4-oxadiazol-5(4H)-one).

98. The use according to any one of claims 88-91, wherein R b is hydrogen, CH2CO2H, tetrazole, or oxadiazolone (1,2,4-oxadiazol-5(4H)-one).

99. The use according to any one of claims 88-91, wherein n is 0.

100. The use according to claim 88, wherein the compound is selected from the group consisting of: or a pharmaceutically acceptable salt thereof.

101. The use according to claim 88, wherein the compound is selected from the group consisting of or a pharmaceutically acceptable salt thereof.

102. The use according to claim 88, wherein the compound is selected from the group consisting of or a pharmaceutically acceptable salt thereof.

103. The use according to claim 88, wherein the compound is or a pharmaceutically acceptable salt thereof.

104. The use according to claim 88, wherein the compound is or a pharmaceutically acceptable salt thereof.

105. The use according to claim 88, wherein the compound is or a pharmaceutically acceptable salt thereof.

106. The use according to claim 88, wherein the compound is or a pharmaceutically acceptable salt thereof.

107. The use according to any one of claims 88-106, wherein the acute inflammatory disease is a systemic inflammatory disease.

108. The use according to any one of claims 88-106, wherein the acute inflammatory disease is an organ-specific disease.

109. The use according to any one of claims 88-106, wherein the acute inflammatory disease is cytokine storm or hypercytokineemia, systemic inflammatory response syndrome (SIRS), graft-versus-host disease (GVHD), acute respiratory distress syndrome (ARDS), severe acute respiratory distress syndrome (SARS), catastrophic antiphospholipid syndrome, viral infection, bacterial infection, fungal infection, influenza, pneumonia, shock, or sepsis.

110. The use according to any one of claims 88-106, wherein the acute inflammatory disease is acute pancreatitis, hepatitis, respiratory disease, or enterocolitis.

111. The use according to any one of claims 88-110, wherein pro-inflammatory cytokines are reduced or anti-inflammatory cytokines are increased.

112. The use according to claim 111, wherein the proinflammatory cytokine is IL-1β, IL-6, IL-18, TNF-α, or TGF-β.

113. The use according to claim 111, wherein the proinflammatory cytokine is MCP-1, TNF-α, or IL-1β.

114. The use according to claim 111, wherein the pro-inflammatory cytokine is IL-6.

115. The use according to claim 111, wherein the anti-inflammatory cytokine is IL-10.

116. The use according to any one of claims 88 to 110, wherein the expression of the longevity factor-1 regulatory genes sod2, tfam and ddal genes in the liver is increased.

Images