A method for constructing gene editing-free all-male fish based on kdm6bb gene knockdown technology

By using the kdm6bb gene knockdown technology and the CRISPR/Cas9 system to knock out the kdm6bb gene in fish, we were able to construct all-male fish without gene editing. This solved the problems of hormone pollution and large-scale continuous production, and improved the economic benefits and quality of fish farming.

CN119791068BActive Publication Date: 2025-11-25SHANGHAI OCEAN UNIV
View PDF 4 Cites 0 Cited by

Patent Information

Application Number
CN202510047206.8
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-01-13
Publication Date
2025-11-25
Estimated Expiration
2045-01-13

AI Technical Summary

Technical Problem

Existing technologies for sex control breeding of fish suffer from problems such as hormone pollution, residues, and the inability to achieve large-scale continuous production. Furthermore, gene-edited offspring cannot be promoted for aquaculture and breeding applications.

Method used

Using the kdm6bb gene knockdown technology, the kdm6bb gene in fish was knocked out through the CRISPR/Cas9 system, reducing the expression level of kdm6bb protein and inhibiting the expression of male development genes. Pseudo-female fish were obtained and mated with wild-type male fish. Super-male fish were then selected and hybridized with wild-type female fish to obtain all-male offspring without gene editing.

Benefits of technology

It enables sex-controlled breeding and monosex population farming, avoids hormone pollution, is suitable for large-scale continuous production, improves farming yield and quality, and is applicable to economic fish species in aquaculture.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119791068B_ABST
    Figure CN119791068B_ABST
Patent Text Reader

Abstract

The application discloses a method for constructing gene editing-free all-male fish based on kdm6bb gene knockdown technology, comprising the following steps: using CRISPR / Cas9 gene editing technology to perform knockdown treatment on fish kdm6bb genes, and obtaining kdm6bb heterozygotes (kdm6bb+ / -) through genotyping; obtaining kdm6bb heterozygous mutants with effectively reduced kdm6bb protein expression through self-crossing of the heterozygote fish; screening pseudo-female fish with XY gender genetic type through gender molecular markers, mating with wild-type XY male fish, screening YY gender genetic type super-male fish without kdm6bb mutation, crossing with wild-type XX female fish, obtaining all-male fish population without carrying kdm6bb mutation, realizing monosex culture of fish, improving the efficiency of gender control breeding, and showing wide adaptability in aquatic economic fish based on XX / XY gender determination.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of fish breeding technology, specifically relating to a method for constructing all-male fish without gene editing based on kdm6bb gene knockdown technology. Background Technology

[0002] The diversity of sex determination mechanisms presents a significant paradox in the developmental biology of lower vertebrates. Sex control through artificial intervention in the sex development process allows for the creation of offspring with desired sex characteristics. Animal sex control plays a crucial role in improving yield and quality, and enhancing disease and stress resistance. Unlike mammals, which rely on the chromosome sex determination system (CSD), fish sex determination exhibits high plasticity, influenced by numerous exogenous factors such as temperature and hormones. Among many aquaculture species, numerous animals display significant sexual dimorphism, meaning one sex exhibits significantly superior growth performance compared to the other. For example, male tilapia grow significantly faster than females, and monosex farming can yield substantial economic benefits.

[0003] Sex reversal induced by interfering with sex hormones is the most common method for producing single-sex populations. For example, patent document CN110583539B discloses a method for producing high-fertility YY-transformed female Nile tilapia, and CN117016488A discloses an inducer, induction method and application for sex reversal of XY-type male largemouth bass into XY-type pseudo-females. Both methods induce sex reversal in fish through hormone regulation, thereby obtaining single-sex aquaculture populations. However, the application of the above methods also produces many adverse effects, such as hormone pollution, fish residues, unstable sex development of parent fish induced by hormone-related substances, and inability to produce on a large scale continuously. Therefore, it is particularly urgent to develop sex control breeding methods such as sex reversal and single-sex population construction based on endogenous gene editing. CN113789352B discloses a method and application for sex control breeding of fish with XX / XY sex genetic determination, including: (1) obtaining homozygous cyp17a1 fish through gene editing; (2) screening XX genotype cyp17a1. - / - Homozygous fish, exhibiting physiological male characteristics, are denoted as pseudo-male fish; (3) The genotype cyp17a1 + / + Wild-type females of XX with genotype cyp17a1 - / - XX pseudo-male fish underwent artificial spawning and insemination, resulting in all individuals with the genotype cyp17a1. + / -The method of creating an all-female population of XX fish enables sex-controlled breeding and the aquaculture of monosex populations. However, the monosex populations obtained by this method are all gene-edited offspring, which cannot yet be widely adopted for aquaculture and breeding applications. Therefore, it is necessary to design a method to knock down a key sex-inducing gene, thereby achieving sex reversal in fish and the construction of monosex populations to solve the aforementioned problems. Summary of the Invention

[0004] The purpose of this invention is to provide a method for constructing all-male fish without gene editing based on kdm6bb gene knockdown technology. This method uses gene editing technology to obtain heterozygous fish with histone demethylase kdm6bb edited, reducing kdm6bb protein levels, decreasing kdm6bb nuclear translocation, and inhibiting the expression of male development genes, thereby obtaining the kdm6bb genotype. + / - The pseudo-female fish of genotype XY were then bred with wild-type male fish to select those with the genotype kdm6bb. + / + YY's super-male fish; then the super-male fish are hybridized with wild-type XX female fish to obtain all-male offspring without gene editing, thus realizing sex-controlled breeding and monosex group farming of fish.

[0005] To achieve the above-mentioned objectives of this invention, the following technical solution is adopted:

[0006] This invention provides a method for constructing gene-edit-free all-male fish based on kdm6bb knockdown technology, comprising the following steps:

[0007] S1: Obtain the kdm6bb genotype by knocking down the fish kdm6bb gene or reducing the expression level of the fish kdm6bb protein. + / - kdm6bb heterozygote;

[0008] S2: The genotype is kdm6bb + / - Kdm6bb heterozygous fish were self-crossed, and genotyping yielded Kdm6bb heterozygous fish with a genetic sex of XY, exhibiting female physiological sex, and marked with the genotype kdm6bb. + / - The pseudo-female fish of XY;

[0009] S3: The genotype is kdm6bb + / - The pseudo-female fish of XY and the genotype kdm6bb + / + Wild-type male fish of XY were mated, and the resulting specimens were selected with the genotype kdm6bb. + / + YY's super male fish;

[0010] S4: The genotype is kdm6bb + / + YY's supermale fish and the genotype kdm6bb + / + When wild-type females of XX are mated, the resulting F3 generation has the genotype kdm6bb.+ / + All-male populations of XY.

[0011] As a preferred embodiment, in step S1, the fish kdm6bb gene is knocked down using gene editing technology, including: using the CRISPR / Cas9 system to specifically cut the fish kdm6bb gene to achieve knockdown of the fish kdm6bb gene, obtaining kdm6bb heterozygous fish, blocking the fish histone demethylation reaction, and inhibiting the expression of male development genes.

[0012] Preferably, in step S1, double-stranded small RNA interference technology is used to reduce the expression level of kdm6bb protein in fish to obtain genetically reversed XY sex reversal fish.

[0013] Preferably, in step S3, the genotype is kdm6bb. + / + The selection method for YY's supermale fish includes: the genotype is kdm6bb + / - The pseudo-female fish of XY and the genotype kdm6bb + / + Wild-type male XY fish were mated, and through genotyping, a supermale kdm6bb fish with no gene editing and genetic sex YY was obtained.

[0014] Preferably, in step S4, the genotype is kdm6bb. + / + The screening method for the all-male population of XY includes: the genotype being kdm6bb + / + YY's supermale fish and the genotype kdm6bb + / + Wild-type females of XX were mated, and an all-male population of kdm6bb with no gene mutations and XY genetic sex was obtained through genotyping.

[0015] Preferably, the pseudo-female fish is a female fish with a genetic sex of XY, a physiological sex of female, and a normal ovarian structure and mature egg development, whose offspring's genetic sex (XX, XY, and YY) is identified by sex molecular markers.

[0016] Preferably, the super-male fish is a male fish with a genetic sex of YY, a physiological sex of male, and a normal testis structure and mature spermatogenesis. The genetic sex of its offspring (XX, XY, and YY) is identified by sex molecular markers.

[0017] Preferably, the fish species are male heterogamous (XX / XY sex-determined) aquatic economically farmed fish.

[0018] More preferably, the fish is Nile tilapia.

[0019] Compared with the prior art, the present invention has the following beneficial effects:

[0020] 1. This invention provides a method for constructing gene-edit-free all-male fish based on kdm6bb knockdown technology. The method involves knocking out the key gene kdm6bb for sex development in fish using gene editing technology, obtaining heterozygous fish. This effectively reduces the expression level of kdm6bb protein, decreases kdm6bb entry into the cell nucleus, and inhibits the expression of male development genes, thereby achieving sex reversal in fish. When a genetically XY heterozygous pseudo-female fish is mated with a wild-type XY male fish, because the kdm6bb gene is not located on the Y chromosome, the kdm6bb gene can freely combine with the Y chromosome during gamete formation in the XY pseudo-female and wild-type XY male fish, forming a kdm6bb-free YY supermale fish. This supermale fish is then crossbred with a wild-type female fish (kdm6bb...). + / + Crossbreeding (XX) can yield a 100% male population (kdm6bb) + / + XY), thereby achieving the effects of gender control and single-sex group breeding.

[0021] 2. This invention applies gene editing technology to knock down sex-inducing genes in fish to obtain sex-reversed fish. By hybridizing sex-reversed fish with wild-type male fish, super-male fish without gene editing are obtained. These super-male fish are then hybridized with wild-type female fish to obtain an all-male monosex population, which significantly improves the yield and quality of farmed fish. This method uses gene knockout technology to obtain monosex aquaculture populations without gene mutations and is suitable for aquaculture promotion and breeding applications.

[0022] 3. This invention achieves sex control by endogenously interfering with the expression of sex-inducing genes, offering advantages such as the ability to continuously obtain pseudo-female and super-male parent fish on a large scale, simple operation, and the capacity for large-scale continuous production. It does not involve the induction of exogenous hormones, effectively avoiding the technical problems of hormone pollution, residues, and unstable sex development in parent fish induced by hormone-related substances, which prevent large-scale continuous production, inherent in traditional fish sex control breeding methods. Furthermore, the method provided by this invention has strong applicability, broad adaptability and scalability in aquaculture economic fish, greatly expanding its application scope in the field of sex control breeding for aquaculture economic fish. Attached Figure Description

[0023] Figure 1 This is a schematic diagram of the method for constructing gene-edit-free all-male fish based on kdm6bb knockdown technology in the embodiment.

[0024] Figure 2 This is a schematic diagram of two target sites in exons 5 and 7 of the kdm6bb gene in the example (red indicates gRNA sequence).

[0025] Figure 3 This is an electrophoresis image of PCR products from kdm6bb gene knockout individuals, as shown in the example. The three on the left are kdm6bb genes. + / +Wild type, the middle 3 are kdm6bb + / - Heterozygote, the three on the right are kdm6bb - / - Homozygous.

[0026] Figure 4 The image shown is an electrophoresis diagram for fish sex genotyping in this example.

[0027] Figure 5 In the example, a 1-month-old kdm6bb + / - Anatomical diagram and genotype identification diagram of XY pseudo-female fish.

[0028] Figure 6 In the example, a 1-month-old kdm6bb + / + Anatomical diagram and genotype identification diagram of YY supermale fish.

[0029] Figure 7 Anatomical diagram of 3-month-old all-male fish and kdm6bb in the example. + / + XY genotype identification diagram. Detailed Implementation

[0030] To make the objectives, technical solutions, and advantages of the embodiments of the present invention clearer, the technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some, not all, of the embodiments of the present invention. Based on the described embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0031] The following embodiments provide a method for constructing all-male fish without gene editing based on kdm6bb knockdown technology. A kdm6bb heterozygous model is constructed using gene editing technology to obtain pseudo-female fish with XY genotype. The pseudo-female fish are then mated with wild-type XY genotype male fish to screen for supermale fish without gene editing YY genotype. These supermale fish are then crossed with XX wild-type female fish to obtain all-male offspring with XY genotype, thus achieving all-male controlled breeding of XX / XY sex-determined fish.

[0032] The specific method for obtaining heterozygotes by knocking down the kdm6bb gene is as follows: the histone demethylase kdm6bb gene is cut using CIRSPR / Cas9 gene editing technology to obtain heterozygous offspring, thereby reducing the expression of kdm6bb protein and inducing XY genotype fish to develop into pseudo-female fish.

[0033] In some embodiments, the method for constructing gene-edit-free all-male fish based on kdm6bb knockdown technology includes the following steps:

[0034] S1. Using gene editing technology, the kdm6bb gene was knocked down in fish to obtain kdm6bb heterozygous fish with the genotype kdm6bb. + / - ;

[0035] S2, the kdm6bb heterozygous fish were self-crossed, and genetic sex XY was determined by genotyping. The kdm6bb heterozygous fish, which exhibited female physiological sex, were labeled as kdm6bb. + / - XY pseudo-female fish;

[0036] S3, for those with the genotype kdm6bb + / - The pseudo-female fish of XY and the genotype kdm6bb + / + Wild-type male fish of type XY were mated, and the genotype kdm6bb was selected. + / + YY's super male fish;

[0037] S4, for those with the genotype kdm6bb + / + YY Super Male Fish and kdm6bb + / + When wild-type female fish are mated, all F3 offspring will have the genotype kdm6bb. + / + The all-male population of XY enables sex-controlled breeding and monosex aquaculture of fish.

[0038] Among them, the fish are male heterogamous (XX / XY sex-determined) aquatic economic farmed fish of the KDM6BB sensitive type.

[0039] In some embodiments, the specific process of obtaining the kdm6bb heterozygous fish in step S1 is as follows:

[0040] S11, design sgRNA target sites in the kdm6bb coding region, and synthesize sgRNA primers through in vitro transcription;

[0041] S12, during the I-cell stage of fish fertilized eggs, sgRNA and Cas9 mRNA are prepared into an injection mixture according to a predetermined ratio and co-injected into the fertilized eggs;

[0042] S13, the injected fertilized eggs are placed in 28℃ circulating water for incubation;

[0043] S14, using specific primers, the kdm6bb genotype of the injected offspring was identified, and kdm6bb heterozygous fish were obtained.

[0044] In some embodiments, in step S2, kdm6bb is obtained. + / - The specific process of XY pseudo-female fish is as follows:

[0045] S21, kdm6bb + / - Heterozygous fish are raised to sexual maturity, then naturally mate, spawn, and fertilize. The eggs are then incubated and raised in a 28°C circulating water system.

[0046] S22. Genotyping of the kdm6bb offspring was performed using specific primer sequences, and genetic sex was determined using sex molecular marker primers. Individuals that were heterozygous for kdm6bb, genetically XY, and physiologically female were obtained and marked as kdm6bb. + / - XY pseudo-female fish.

[0047] In some embodiments, in step S3, kdm6bb is obtained. + / + The specific process of YY Super Male Fish is as follows:

[0048] S31, kdm6bb + / - XY pseudo-female fish were raised in 28℃ circulating water until sexual maturity;

[0049] S32, kdm6bb + / - XY pseudo-female fish and wild-type kdm6bb + / + XY male fish mate naturally to lay eggs and fertilize them, then incubate and raise them in 28℃ circulating water:

[0050] S33, using specific primer sequences to identify the kdm6bb genotype of the offspring, and using sex molecular marker primers to identify the genetic sex of the self-crossed offspring, obtained supermale fish with no kdm6bb mutations, genetic sex YY, and physiological sex male, which were marked as kdm6bb. + / + YY Super Male Fish.

[0051] In some embodiments, in step S4, kdm6bb is obtained. + / + The specific process of the XY all-male population is as follows:

[0052] S41, kdm6bb + / + YY super male fish are naturally mated with wild-type XX female fish to lay eggs and fertilize them. The eggs are then incubated and raised in 28℃ circulating water.

[0053] S42 uses specific primer sequences to identify the kdm6bb genotype of offspring, and uses sex molecular marker primers to identify the genetic sex of self-crossed offspring, obtaining an all-male population of kdm6bb without mutation, with genetic sex of XY and physiological sex of male, thus realizing sex-controlled breeding and monosex population farming of fish.

[0054] In some embodiments, the pseudo-female fish has a genetic sex of XY and a physiological sex of female, possessing normal ovarian structure and mature egg development; the super-male fish has a genetic sex of YY and a physiological sex of male, possessing normal testicular structure and mature spermatogenesis. The screening process for pseudo-female and super-male fish involves identifying the genetic sex of offspring (XX, XY, and YY) through sex molecular markers.

[0055] In some embodiments, the target site for kdm6bb knockout is not limited to exons 7 and 9; any reduction in the expression level of kdm6bb heterozygous protein is sufficient.

[0056] In some embodiments, the fertilized eggs are incubated and cultured at a water temperature of 28°C to avoid high-temperature-induced sex reversal in fish.

[0057] In some embodiments, the fish is Nile tilapia.

[0058] Example 1

[0059] like Figure 1 As shown, this embodiment 1 provides a method for constructing gene-edit-free all-male fish based on kdm6bb knockdown technology, using Nile tilapia as the subject, and includes the following steps:

[0060] S1. Using gene editing technology, the kdm6bb gene was knocked down in fish to obtain kdm6bb heterozygous fish with the genotype kdm6bb. + / - The details are as follows:

[0061] S11. Based on the fish kdm6bb gene sequence, kdm6bb targets were designed using the online tool http: / / crispor.tefor.net / . The first and second targets are located on exons 7 and 9, respectively. The target sequences are shown in Table 1, and the target locations are as follows. Figure 2 As shown:

[0062] Table 1: KDM6BB gene knockout target sequence

[0063] Primer name Primer sequence (5'-3') Tilapia_kdm6bb_gRNA1 GGGAACCGCGCCAGAGAGAT Tilapia_kdm6bb_gRNA2 GGCAGGAGGCCACCACATTA

[0064] The injection mixture for S12,kdm6bb gene editing contained gRNA1 and gRNA2 at a concentration of 100 ng / μL, Cas9 protein at a concentration of 800 ng / μL, and the microinjection volume of the gRNA and Cas9 protein mixture was 1 μL.

[0065] Table 2: Preparation ratio of gRNA and Cas9 protein injection mixture

[0066] sample Volume (μL) Tilapia_kdm6bb_gRNA1(500ng / μL) 2 Tilapia_kdm6bb_gRNA2(500ng / μL) 2 Cas9 protein (2000 ng / μL) 4 water 2 total 10

[0067] S13 involves placing the injected fertilized eggs in 28°C circulating water for incubation and rearing until sexual maturity to obtain the F0 generation.

[0068] S14. Genomic DNA was extracted from different individuals using the tail fin clipping method. PCR amplification was performed using the fish-specific primers for kdm6bb listed in Table 3. Genotypes were identified by agarose gel electrophoresis. + / + Wild-type individuals produce only a 554bp band in their PCR product, kdm6bb + / -The PCR product of the heterozygous individual had two bands, 554bp and 371bp, kdm6bb - / - Homozygous individuals produce PCR products with only a 371bp band, such as Figure 3 As shown; the kdm6bb heterozygous fish were selected.

[0069] Table 3: Primers for detecting mutations in the kdm6bb target gene

[0070] Primer name Primer sequence (5'-3') Tilapia_kdm6bb_F GGAAGCCTCCAAGTGACAGG Tilapia_kdm6bb_R TTCTGAAGGTGATAAAGAGCAACA

[0071] S2. The kdm6bb heterozygous fish were self-crossed, and their genetic sex (XY) was determined by genotyping. + / - Heterozygous fish exhibit female physiological sex characteristics, such as... Figure 4 As shown; marked as kdm6bb + / - XY pseudo-female fish, details are as follows:

[0072] S21, kdm6bb + / - Heterozygous fish mate naturally to lay eggs and fertilize them, then incubate and raise them in 28°C circulating water until sexual maturity.

[0073] S22. Extract genomic DNA from the self-crossed progeny obtained in S21, perform PCR amplification using the kdm6bb-specific primers in Table 3, identify genotypes by agarose gel electrophoresis, and screen for kdm6bb-specific progeny. + / - Hybrid fish.

[0074] S23, First observe sexual maturity kdm6bb + / - Secondary sexual characteristics of heterozygous fish: males have only one cloaca on their genital protuberance, while females have two cloaca protuberances and an enlarged abdomen. KDM6BB was selected. + / - Heterozygous female fish; then, the sex molecular markers of fish in Table 4 were used to identify kdm6bb + / - Genetic sex determination was performed on heterozygous female fish. XX individuals showed only one posterior band, while XY individuals showed two bands of different sizes. Figure 5 As shown. KDM6BB was filtered out. + / - Heterozygous, pseudo-female fish with XY genetic sex, tagged as kdm6bb + / - XY pseudo-female fish.

[0075] Table 4: Primers for sex genotyping in fish

[0076] Primer name Primer sequence (5'-3') Tilapia_sex_F TTCCTCAGGGATCTGTCCTTGGT Tilapia_sex_R CAGAAATGTAGACGCCCAGGTATC

[0077] S3, for those with the genotype kdm6bb + / - XY pseudo-female fish and genotype kdm6bb + / + XY wild-type male fish were mated, and the genotype kdm6bb was selected.+ / + YY Super Male Fish, details are as follows:

[0078] S31, kdm6bb + / - XY pseudo-female fish were raised in 28℃ circulating water until sexual maturity;

[0079] S32, kdm6bb + / - XY pseudo-female fish and wild-type kdm6bb + / + XY male fish mate naturally to lay eggs and fertilize them, then incubate and raise them in 28℃ circulating water:

[0080] S33, using the fish-specific primers in Table 3, the genotype of kdm6bb was identified in different individuals. The sex molecular marker primers for fish in Table 4 were used to identify the genetic sex of self-crossed offspring, resulting in supermale fish with no kdm6bb mutations, a genetic sex of YY, and a physiological sex of male. The genotype identification results are as follows: Figure 6 As shown, marked as kdm6bb + / + YY Super Male Fish.

[0081] S4, for those with the genotype kdm6bb + / + YY Super Male Fish and kdm6bb + / + When wild-type female fish are mated, all F3 offspring will have the genotype kdm6bb. + / + The all-male population of XY fish enables sex-controlled breeding and monosex population culture, as detailed below:

[0082] S41, select the kdm6bb filtered in step S33. + / + YY super male fish are naturally mated with wild-type XX female fish to lay eggs and fertilize them. The eggs are then incubated and raised in 28℃ circulating water.

[0083] S42, using the fish-specific primers for kdm6bb in Table 3, the kdm6bb genotype of different individuals was identified. Using the fish sex molecular marker primers in Table 4, the genetic sex of self-crossed offspring was determined, resulting in an all-male population of kdm6bb without gene mutations, with a genetic sex of XY and a physiological sex of male. Figure 7 As shown, this enables sex-controlled breeding of fish and the cultivation of single-sex populations.

[0084] The above description of the embodiments is provided to enable those skilled in the art to understand and use the invention. It will be apparent to those skilled in the art that various modifications can be made to these embodiments, and the general principles described herein can be applied to other embodiments without inventive effort. Therefore, the present invention is not limited to the above embodiments, and any improvements and modifications made by those skilled in the art based on the disclosure of the present invention without departing from the scope of the invention should be within the protection scope of the present invention.

Claims

1.A method for constructing gene editing-free all-male fish based on kdm6bb gene knockdown technology, characterized in that, a kdm6bb heterozygote model is constructed by kdm6bb gene knockdown technology to obtain XY genetic type pseudo-female fish; the pseudo-female fish is mated with wild type XY genetic sex male fish to screen for YY genetic sex super-male fish without gene editing, and the super-male fish is crossed with XX wild type female fish to obtain XY genetic sex all-male offspring, thereby realizing fish all-male controlled breeding; the method for constructing the kdm6bb heterozygote model by the kdm6bb gene knockdown technology comprises: a histone demethylase kdm6bb gene is cut by using CRISPR / Cas9 gene editing technology to obtain a heterozygote offspring, reduce the expression of kdm6bb protein, and induce XY genetic type fish to develop into pseudo-female fish; the method for constructing gene editing-free all-male fish based on kdm6bb gene knockdown technology comprises the following steps: S1, knockout the kdm6bb gene by gene editing technology to obtain kdm6bb heterozygote fish, genotype kdm6bb + / - ; S2, self-crossing the kdm6bb heterozygote fish, and obtaining the kdm6bb heterozygote fish with genetic sex XY through genotypic identification, and the physiological sex of the fish is female, and the fish is marked as kdm6bb + / - XY pseudo-female fish; S3, the kdm6bb + / - XY Pseudoceros with kdm6bb + / + XY wild-type males were mated to screen for kdm6bb + / + YY super-males; S4, the kdm6bb + / + YY super-male fish with kdm6bb + / + XX wild-type female fish to mate, and the offspring obtained are kdm6bb + / + XY genotype male fish, realizing fish gender control breeding and monosex population breeding; the fish is a kdm6bb sensitive type and male heterogametic genetic determination type fish; in step S1, the gene editing technology is to specifically cut the kdm6bb gene of the fish by using the CRISPR / Cas9 system, to realize the knock-out of the kdm6bb gene of the fish, to block the histone demethylation reaction of the fish, and to inhibit the expression of male development genes; wherein the process of obtaining the kdm6bb heterozygote fish is as follows: S11, according to the kdm6bb gene sequence of the fish, a gRNA target point is designed, gRNA is synthesized in vitro, the gRNA includes gRNA1 and gRNA2, and the sequences are shown in the following table: S12, an injection mixture is prepared by mixing sgRNA and Cas9 protein according to a predetermined ratio, and the fertilized eggs are co-injected; S13, the injected fertilized eggs are placed in a 28℃ circulating water for incubation; S14, kdm6bb genotyping is performed by using specific primers to obtain kdm6bb heterozygote fish; In step S2, the kdm6bb heterozygote fish is self-crossed to obtain kdm6bb heterozygote fish with genetic sex XY and physiological sex female, marked as kdm6bb + / - XY pseudo-female fish; wherein the kdm6bb + / - The process of obtaining the XY pseudo-female fish is as follows: S21, kdm6bb + / - Hybrid fish were fed to sexual maturity, natural mating to produce eggs, fertilization, and incubation in 28°C circulating water: S22, genotype identification of the kdm6bb of the selfed offspring by using specific primer sequence, genetic sex identification of the selfed offspring by using gender molecular marker primer, obtaining the individual of kdm6bb heterozygote, genetic sex of XY, and physiological sex of female, and marking as kdm6bb + / - XY pseudo female fish; In step S3, the kdm6bb + / - XY pseudo females are mated with wild type XY males, and kdm6bb + / + YY super males; wherein the kdm6bb + / + The process of obtaining kdm6bb S31, kdm6bb + / - XY Pseudolabrus were reared in a 28°C recirculating water until sexual maturity; S32, kdm6bb + / - XY pseudo females with wild type kdm6bb + / + XY males were allowed to naturally mate and spawn, and eggs were incubated and reared at 28°C in a recirculating water system. S33, using specific primer sequence to identify the kdm6bb genotype of offspring, using gender molecular marker primer to identify the genetic gender of selfed offspring, obtaining super-male fish with no mutation of kdm6bb, genetic gender of YY, and physiological gender of male, marked as kdm6bb + / + YY super-male fish; In step S4, the kdm6bb + / + YY super-male fish are mated with wild-type XX female fish, and a full-male population with genotype XY and no genetic mutation in kdm6bb is determined by genotype identification; wherein, the kdm6bb + / + The process of the XY full-male population is as follows: S41, kdm6bb + / + YY super-male fish were naturally mated with wild-type XX female fish, and the eggs were fertilized and hatched in a 28°C circulating water system. S42, kdm6bb genotyping is performed on the offspring by using specific primer sequences, and genetic sex identification is performed on the offspring of self-crossing by using sex molecular marker primers to obtain an all-male population of kdm6bb non-mutant, genetic sex XY, and physiological sex male, thereby realizing fish gender controlled breeding and monosex population breeding; the process of obtaining effective mutant kdm6bb heterozygote fish is as follows: the target gene fragment of F0 and F1 individuals is amplified and sequenced, the gene mutation is detected, and the effective mutant heterozygote offspring is screened; the genetic sex of the offspring is effectively identified: the genomic DNA of the offspring is extracted, the target detection fragment is amplified and electrophoresed, and the genetic sex is identified according to the size of the PCR product; the pseudo-female fish is a female fish with normal ovary structure and mature egg development; the super-male fish is a male fish with normal testis structure and mature sperm development; Screening of kdm6bb by molecular markers + / - XY pseudohermaphrodites and kdm6bb + / + YY supermales. 2.Use of the method for constructing gene editing-free all-male fish based on kdm6bb gene knockdown technology in claim 1 in gender controlled breeding of kdm6bb temperature sensitive type male heterogametic genetic determination type aquaculture economic fish.

Citation Information

Patent Citations

  • A method for producing high-fertility YY-transformed female Nile tilapia.

    CN110583539B

  • Methods and applications for sex control breeding of fish with XX / XY sex-determining genetic characteristics

    CN113789352B

  • Inducer for sex reversal of XY type genetic male fishes of micropterus salmoides into XY type pseudo female fishes, induction method and application

    CN117016488A

  • Large-scale production method for all-male salmon and trout

    CN118985489A