Application of pentafluridol in preparation of medicine for preventing and treating rotavirus

Abstract

The invention belongs to the technical field of biology, and particularly discloses application of pentafluridol in preparation of a medicine for preventing and treating rotavirus. Compared with the prior art, the invention discovers that the penfluridol can be used for remarkably inhibiting replication of rotavirus, and discovers that the penfluridol can be used for remarkably inhibiting transcription and protein expression level of VP6, and the penfluridol has very small toxicity to cells. Therefore, the Penfluridol can be used as the only active ingredient for treating the rotavirus.

Description

Technical Field

[0001] The invention relates to the field of biotechnology, in particular to the application of penfluridol in preparing medicines for preventing and treating rotavirus. Background Art

[0002] Rotavirus (RV) enteritis is an acute gastrointestinal infectious disease caused by rotavirus. The pathogen is mainly transmitted through the digestive tract. Infants and young children are susceptible. It is often caused by group A rotavirus. There is currently no commercial drug for the treatment of rotavirus, so the development of effective anti-rotavirus drugs is of great significance for the treatment of rotavirus.

[0003] Rotavirus disease is mainly manifested as rotavirus gastroenteritis, which is an acute, highly contagious zoonosis. Rotavirus infection is widespread. In addition to humans, it can also infect a variety of mammals and birds, including sheep, pigs, horses, donkeys, etc., seriously endangering the animal husbandry industry. The most typical symptoms of rotavirus are diarrhea, dehydration and other symptoms caused by intestinal infection. Rotavirus is mainly transmitted through fecal-oral transmission, usually in contaminated water or inadequately treated sludge and wastewater. Rotavirus has obvious seasonal characteristics, with a high incidence in autumn and winter.

[0004] Rotavirus is a non-enveloped double-stranded RNA virus with a core genome of 11 dsRNA segments surrounded by three capsid proteins. The RNA segments encode six structural proteins (VP1, VP2, VP3, VP4, VP6, VP7) and six non-structural proteins (NSP1, NSP2, NSP3, NSP4, NSP5, NSP6). Rotavirus can be divided into 10 serotypes (AJ) due to different epitopes on the VP6 protein, and the structural protein VP7 can determine the typing of rotavirus G type. Currently, 42 different G genotypes and 58 different P genotypes have been found in different species of type A rotavirus (https: / / rega.kuleuven.be / cev / viralmetagenomics / virus-classification / newgenotypes).

[0005] Penfluridol is an FDA-approved drug for the treatment of psychiatric disorders. In recent years, penfluridol has been shown to inhibit the growth or metastasis of several solid tumor types (breast, pancreatic and brain tumors) in both in vivo and in vitro models. Currently, no studies have been conducted on the effects of penfluridol on rotavirus.

[0006] Therefore, there is an urgent need to study drugs based on Penfluridol for preventing and treating rotavirus. Summary of the invention

[0007] In order to solve the above technical problems, the present invention provides the use of penfluridol in preparing a medicine for preventing and treating rotavirus.

[0008] To achieve the above object, the present invention is implemented according to the following technical solutions:

[0009] One of the purposes of the present invention is to provide the use of penfluridol as the sole active ingredient in the preparation of a medicament for preventing and treating rotavirus.

[0010] The second object of the present invention is to provide a drug for preventing and treating rotavirus, comprising penfluridol; and further comprising a pharmaceutically acceptable carrier and / or excipient.

[0011] Preferably, the dosage form of the drug for preventing and treating rotavirus is one of tablets, sprays, granules, capsules, oral liquids, injections, and suspensions.

[0012] Compared with the prior art, the present invention finds that Penfluridol can significantly inhibit rotavirus replication, and finds that Penfluridol can significantly inhibit the transcription and protein expression level of VP6, and Penfluridol has little cytotoxicity. Therefore, Penfluridol can be used as the only active ingredient to treat rotavirus. BRIEF DESCRIPTION OF THE DRAWINGS

[0013] Figure 1 Penfluridol for CC of two cells 50 The CC values ​​on Caco-2 cells are shown in Figure 2A. 50 Value; (B) is CC on MA104 cells 50 value.

[0014] Figure 2 IC of Penfluridol for inhibiting rotavirus infection 50 The IC values ​​on Caco-2 cells are shown in Figure 2. 50 Value; (B) is the IC on MA104 cells 50 value.

[0015] Figure 3 The compound Penfluridol inhibits the expression of rotavirus VP6 protein in cells: (A) is the expression of rotavirus VP6 protein in Caco-2 cells; (B) is the expression of rotavirus VP6 protein in MA104 cells.

[0016] Figure 4This is a graph showing the fluorescence observation results of the compound Penfluridol inhibiting rotavirus in MA104 cells. DETAILED DESCRIPTION

[0017] In order to make the purpose, technical solution and advantages of the present invention more clearly understood, the present invention is further described in detail below in conjunction with embodiments. The specific embodiments described herein are only used to explain the present invention and are not used to limit the invention.

[0018] The Caco-2 cells (human cloned colon adenocarcinoma cells) used in the following examples were preserved by the Guangdong Provincial Key Laboratory of Animal Molecular Design and Precision Breeding, and the MA104 cells (African green monkey embryonic kidney cells) were preserved by the Viral Diarrhea Laboratory of the Chinese Center for Disease Control and Prevention, with a generation of 23. Both cells were cultured in a 37°C, 5% CO2 incubator. The compound Penfluridol used was purchased from Selleck, and its chemical molecular structure is shown below:

[0019]

[0020] Other related reagents used, unless otherwise specified, are all commercially available agents, and the methods involved, unless otherwise specified, are all well-known methods.

[0021] The rotavirus strain used was the rotavirus vaccine strain LLR (G10P

[15] ), which was maintained by the Viral Diarrhea Laboratory of the Chinese Center for Disease Control and Prevention and subcultured on MA104 cells.

[0022] In order to verify whether Penfluridol can be used as the only active ingredient to prepare drugs for the prevention and treatment of rotavirus (RV), the following tests were conducted:

[0023] 1. Cytotoxicity of Penfluridol

[0024] The cytotoxicity of the small molecule penfluridol was detected by CCK-8 method on Caco-2 and MA104 cells. Caco-2 and MA104 cells (2×10 5 / well), add DMSO to dissolve different concentrations of Penfluridol (1.25μM, 2.5μM, 5μM, 10μM, 20μM) to treat cells as experimental groups, and set up blank control group (culture medium + DMSO) and negative control group (cells + culture medium + DMSO). The culture plate was incubated in an incubator for 24h, 10μL of CCK-8 solution was added to each well of the plate, and the culture plate was incubated in the incubator for another 4 hours. The absorbance at 450nm was measured using an enzyme reader, and the formula [(OD 实验组 -OD 空白对照组 ) / (OD 阴性对照 -OD 空白对照组 )×100%] to calculate the cell survival rate at each concentration.

[0025] The results are as follows Figure 1 As shown, the compound Penfluridol has low toxicity to Caco-2 and MA104 cells, even at a concentration of 20 μM ( Figure 1 When the horizontal axis is 1.3=log 20), the cell survival rate can still reach more than 75%, indicating that the cytotoxicity is low. In summary, the compound Penfluridol of the present invention has a good inhibitory effect on rotavirus and has low cytotoxicity, and can be used to treat rotavirus.

[0026] 2. Effect of Penfluridol on the number of viral gene copies during RV infection and replication

[0027] Caco-2 and MA104 cells (2×10 6 / well), the experimental group treated cells with RV (MOI = 0.01) mixed with different concentrations of Penfluridol (1.25μM, 2.5μM, 5μM, 10μM, 20μM) dissolved in DMSO. In addition, cells treated with RV and DMSO were used as the infection control group. The cell plate was then placed at 37°C and 5% CO2 for 24 hours, and then the cell samples were taken to extract RNA and reverse transcribed into cDNA, and the number of viral genome copies was detected by fluorescent quantitative PCR targeting the RV NSP3 gene. The total volume of the RT-qPCR reaction system was 25μL, including 12.5μL of Premix Ex Taq (Probe qPCR), 1μL of upstream and downstream primers, 0.5μL of RV probe primer, 2μL of template, and sterile deionized water was added to 25μL. The reaction conditions were: 95℃, 30s; 95℃, 5s, 60℃, 30s, for a total of 40 cycles.

[0028] Among them: RV-NSP3 upstream primer: ACCATCTWCACRTRACCCTCTATGAG; downstream primer: GGTCACATAACGCCCCTATAGC; RV probe primer: FAM-AGTTAAAAG CTAACACTGTCAAA-MGB.

[0029] The results of the RV virus genome copy number experiment are as follows Figure 2 As shown, Figure 2 (A) is a comparison of the inhibitory effects of different concentrations of Penfluridol on RV replication in Caco-2 cells. Figure 2 (B) is a comparison of the inhibitory effects of different concentrations of the compound Penfluridol on RV replication in MA104 cells; these two figures show that the addition of Penfluridol has a significant inhibitory effect on the RV viral genome copy number, and this inhibitory effect is concentration-dose dependent.

[0030] 3. Effect of Penfluridol on the expression level of VP6 protein in RV

[0031] Caco-2 and MA104 cells (2×10 6 / well), the experimental group was treated with rotavirus (MOI = 0.01) mixed with different concentrations of Penfluridol (1.25μM, 2.5μM, 5μM, 10μM) dissolved in DMSO, and the infection control group was treated with RV (MOI = 0.01) mixed with DMSO. The cells were then placed at 37°C, 5% CO2 and cultured for 24 hours, and the cell culture was collected, centrifuged, and the supernatant was discarded. After adding 1×SDS-PAGE loading buffer, the protein was denatured (100℃, 10min), centrifuged for 10min (12000r / min), the supernatant was collected, the supernatant was subjected to electrophoresis (120V, 30min), and the membrane was transferred to a 0.2μm nitrocellulose membrane (NC membrane) (100V, 1h), and then blocked with 5% skimmed milk powder for 1h, the blocking solution was discarded, 1×TBST was added to wash the membrane, and then the primary antibody was added and incubated in a 4℃ refrigerator overnight, the NC membrane was washed with 1×TBST, the secondary antibody was added and incubated for 1h, and the membrane was washed with 1×TBST and exposed to ECL luminescent liquid to detect the expression difference of VP6 protein.

[0032] The experimental results are as follows Figure 3 As shown, Figure 3 (A) shows the expression of rotavirus VP6 protein in Caco-2 cells; Figure 3 (B) shows the expression of rotavirus VP6 protein in MA104 cells; Figure 3 In the figure, the size of VP6 protein is 43kD, the size of β-actin protein is 42kD, and 40kD represents the protein marker position. Figure 3 It can be seen that compared with the uninfected control group, the VP6 protein expression level in the infected control group (RV+DMSO, RV) and the experimental group (Penfluridol+RV) increased; however, compared with the infected control group (RV+DMSO), the VP6 protein expression level in the experimental group (Penfluridol+RV) was significantly reduced. The results show that the compound Penfluridol can significantly inhibit the expression level of VP6 protein in the rotavirus gene.

[0033] 4. Observation of the effect of Penfluridol on RV infection and replication in Caco-2 and MA104 cells under fluorescence

[0034] Caco-2 / MA104 cells (2×10 6 / well), the experimental group was inoculated with rotavirus (MOI = 0.01), and then treated with different concentrations of Penfluridol (1.25μM, 2.5μM, 5μM, 10μM) dissolved in DMSO, and the blank control was cultured Caco-2 cells without rotavirus (2×10 6 / well), recorded as the Mock group; the infection control group was treated with rotavirus (MOI = 0.01) mixed with DMSO, recorded as the DMSO group. The infection control group was treated with rotavirus and DMSO together. Then the cell plate was placed at 37°C, 5% CO2 for 24 hours, and then the supernatant was discarded, rinsed three times with PBS, and fixed with 4% formaldehyde for 30 minutes. Then it was treated with 0.3% Triton for 10 minutes for permeabilization. After that, it was blocked with 5% BSA at room temperature for 1 hour, the blocking solution was discarded, and the antibody diluted with 5% BSA (rotavirus VP6 monoclonal antibody, dilution of 1:200) was added, and incubated at 4°C in the dark overnight. Then, the fluorescent secondary antibody labeled with fluorescein isothiocyanate (FITC) was incubated at 37°C for 1 hour. After the incubation, the antibody was discarded, and after washing three times with PBST, the fluorescence changes were observed under a fluorescence microscope.

[0035] The experimental results are as follows Figure 4 As shown, Figure 4It shows that under fluorescence and white light, the fluorescence in the infection control group (DMSO+RV) is brighter, and the fluorescence gradually dims after treatment with different concentrations of Penfluridol. When treated with 10μM Penfluridol, the fluorescence almost disappears. The above results show that the compound Penfluridol can significantly inhibit the infection and replication of RV, and the inhibition becomes more obvious as the concentration of the compound increases.

[0036] In summary, Penfluridol can be used as the sole active ingredient to prepare drugs for preventing and treating rotavirus. Of course, the prepared drugs contain Penfluridol and also contain pharmaceutically acceptable carriers and / or excipients; the dosage form of the drugs is one of tablets, sprays, granules, capsules, oral solutions, injections, and suspensions.

[0037] The technical solution of the present invention is not limited to the above-mentioned specific embodiments. All technical variations made according to the technical solution of the present invention fall within the protection scope of the present invention.

Claims

1. Use of penfluridol in the preparation of drugs for preventing and treating rotavirus as the sole active ingredient in the preparation of drugs for preventing and treating rotavirus.

2. A drug for preventing and treating rotavirus, characterized in that: Contains penfluridol.

3. The drug for preventing and treating rotavirus according to claim 2, characterized in that: It also contains pharmaceutically acceptable carriers and / or excipients.

4. The drug for preventing and treating rotavirus according to claim 2 or 3, characterized in that: The dosage form of the medicine is one of tablets, sprays, granules, capsules, oral liquids, injections and suspensions.

Images