Application of irisin in preparation of prion medicine

Abstract

The invention relates to the technical field of biology, and particularly discloses application of irisin in preparation of prion medicine. Research finds that irisin relieves oxidative stress caused by a prion disease model and alleviates mitochondrial dysfunction caused by the oxidative stress. The invention further provides application of irisin in preparation of a medicine for treating nerve cell apoptosis caused by prion disease stimulation. The invention provides a new method for intervening neuron problems caused by prion diseases.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to application of irisin in the preparation of prion drugs. Background Art

[0002] Prion diseases represent a group of fatal neurodegenerative disorders characterized by the expression of cellular prion protein (PrP C ) misfolds into pathogenic forms (PrP Sc ). PrP 106-126 The peptide corresponds to a segment of the prion protein and has become an important tool for studying these diseases. It is a synthetic peptide homologous to residues 106-126 of the human prion protein and was found to recapitulate the PrP Sc PrP has many characteristics, including cytotoxicity, neurotoxicity, glial trophic activity, proteinase-K resistance, and β-sheet structure. 106-126 This study helps to clarify the role of amyloid structure in the neurodegenerative process of prion diseases and emphasizes the importance of oligomerization and prion-like spreading in protein misfolding diseases. 106-126 Peptides are important tools in prion research, providing insights into the molecular basis of prion-induced neurotoxicity and providing avenues for the development of therapeutic strategies against these devastating diseases.

[0003] Mitochondria carry out a variety of important functions, however, they are extremely susceptible to oxidative stress, which can lead to mitochondrial dysfunction and induce cell apoptosis. The main source of cellular ROS is mitochondria. The UCPs family found in the inner membrane of mitochondria can partially dissipate the proton concentration gradient of the inner membrane of mitochondria, playing a key role in controlling intracellular ROS homeostasis and preventing oxidative stress. Among them, UCP2 (Uncoupling Protein 2) (NCBI ID: 22228) is the main type in the nervous system. Recent studies have shown that UCP2 is associated with neurodegenerative diseases such as Parkinson's disease, Alzheimer's disease and depression, and its neuroprotective function may be mediated by limiting the production of ROS and protecting mitochondrial function. Therefore, targeting UCP2 may have important therapeutic significance for the treatment of prion-induced oxidative stress and mitochondrial dysfunction. Oxidative stress is of great significance in the pathogenesis of prion diseases, but its underlying mechanism remains to be elucidated.

[0004] In recent years, irisin, as a newly discovered endogenous muscle hormone, is released into the circulation by cleaving fibronectin type III domain-containing protein 5 (FNDC5), which protects the health of neurons through anti-inflammatory and antioxidant effects.

[0005] Studies have shown that the reduction of irisin in the cerebrospinal fluid of Alzheimer's patients may be one of the important biomarkers for prediction and judgment, and may play an important role in the treatment of neuronal degeneration in Parkinson's patients. Although Alzheimer's disease, Parkinson's disease and prion disease are all neurodegenerative diseases, their pathogenic mechanisms are not the same. The main pathogenic mechanism of Alzheimer's disease is the deposition of amyloid plaques and Tau protein tangles, while the core mechanism of Parkinson's disease is the degeneration of dopaminergic neurons in the substantia nigra and the formation of Lewy bodies. Prion disease is caused by abnormal folding of prion proteins and neuronal damage. In addition, the symptoms of the three are also different. For example, Alzheimer's disease is mainly manifested by memory loss and cognitive impairment, Parkinson's disease is mainly characterized by movement disorders, and prion disease is manifested by rapidly progressive dementia and neurodegeneration.

[0006] Although there are literature reports that irisin can treat Alzheimer's disease and Parkinson's disease through BDNF or αVβ5 integrin, the pathogenic mechanisms and symptoms of Alzheimer's disease, Parkinson's disease and prion disease are different, and it is not expected that similar treatment methods can be used to effectively treat prion disease. In addition, the prior art also records that acetylcholinesterase inhibitors (such as donepezil) can effectively relieve the symptoms of Alzheimer's disease, but are ineffective for Parkinson's disease and prion disease; levodopa is the first-line treatment for Parkinson's disease, but cannot be used to treat Alzheimer's disease or prion disease. This existing information can also prove that the three treatment methods cannot be expected to be universal. It is still necessary to conduct further research on how to treat prion diseases. Summary of the invention

[0007] One of the purposes of the present invention is to provide a new method for intervening in neuronal problems caused by prion diseases.

[0008] The present invention provides the use of irisin in preparing a medicine for treating neuronal apoptosis, neuronal oxidative stress or neuronal mitochondrial dysfunction caused by prion disease stimulation.

[0009] In prion diseases, an early sign of neuronal damage is impaired mitochondrial function. Mitochondria supply energy through the respiratory chain and participate in a variety of key functions in cells. However, mitochondria are extremely susceptible to oxidative stress, which leads to dysfunction and triggers apoptosis. Irisin is an endogenous myokine, and mitochondrial uncoupling is a key mechanism for reducing ROS levels in mitochondria. UCP2 is a transmembrane protein of the mitochondrial anion carrier family, located on the inner membrane of mitochondria, and reduces mitochondrial ROS synthesis by promoting increased electron flux and enhancing respiratory chain activity. However, the specific role and mechanism of irisin in prion disease are still unclear. The research results of the present invention show that in the prion cell model, irisin relieves oxidative stress and mitochondrial dysfunction by activating UCP2, thereby reducing neuronal apoptosis. It is also proved that UCP2 is a potential target for therapeutic intervention in prion disease, and irisin has the potential to be used as a drug to alleviate prion disease.

[0010] The present invention also provides the use of irisin in the preparation of a drug for treating any of the following conditions caused by prion disease stimulation:

[0011] (1) Increased levels of mitochondrial reactive oxygen species in neurons;

[0012] (2) Increased malondialdehyde in nerve cells;

[0013] (3) The ratio of reduced glutathione to oxidized glutathione in nerve cells decreases;

[0014] (4) Catalase activity in nerve cells is reduced;

[0015] (5) The total superoxide dismutase activity in nerve cells is reduced.

[0016] The present invention also provides the use of irisin in the preparation of a drug for treating decreased mitochondrial membrane potential of neurons, decreased energy metabolism of neurons, decreased activity of Complex I-IV of the mitochondrial respiratory chain complex of neurons, or decreased mitochondrial DNA copy number of neurons caused by prion disease stimulation.

[0017] The present invention also provides the use of irisin in preparing a drug for enhancing the colocalization of UCP2 and mitochondria in nerve cells and / or increasing the expression of UCP2.

[0018] The present invention also provides the use of irisin in reducing neuronal apoptosis, neuronal oxidative stress, and neuronal mitochondrial dysfunction caused by prion disease stimulation for non-disease diagnosis or treatment purposes.

[0019] The present invention also provides the use of irisin in enhancing the colocalization of UCP2 and mitochondria in nerve cells and / or increasing the expression of UCP2 for non-disease diagnosis or treatment purposes.

[0020] The above-mentioned application of the present invention can be for non-disease diagnosis or treatment purposes, such as for pharmaceutical preparation, pathogenic mechanism research, etc.

[0021] The beneficial effects of the present invention are at least:

[0022] The present invention found that the oxidative stress induced by the prion disease model can lead to mitochondrial dysfunction, and irisin can reduce the oxidative stress caused by the prion disease model and alleviate the mitochondrial dysfunction caused by it by activating UCP2. This provides a new method for intervening in neuronal problems caused by prion disease and a new therapy for the treatment of prion disease. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 This is one of the results of the effect of irisin on apoptosis induced by prion disease model. Among them, AB is the effect of irisin and PrP on N2a cells. 106-126 After treatment, the results of cell apoptosis were evaluated by Annexin V-FITC / PI flow cytometry. CD shows the results of N2a cell apoptosis determined by TUNEL staining, scale bar: 50 μm.

[0024] Figure 2 This is the second result of the effect of irisin on apoptosis induced by prion disease model. Among them, AG is the protein expression results of cleaved caspase-3, cleaved caspase-9, BAX and Bcl-2 in N2a cells detected by Western blotting, and the protein expression results of cyt c in the cytoplasm and mitochondrial extracts of N2a cells.

[0025] Figure 3 The results of the study on the alleviating effect of irisin on neuronal mitochondrial dysfunction in the prion disease model. AB is the result of measuring mitochondrial morphology by confocal microscopy and analyzing mitochondrial length by ImageJ software, scale: 10μm. CD is the result of JC-1 analysis by flow cytometry. E is the mtDNA / nDNA ratio. F is the ATP level. GJ is the detection of mitochondrial respiratory chain complex (Ⅰ-Ⅳ) activity using a microplate luminometer.

[0026] Figure 4 The results of irisin alleviating neuronal oxidative stress in a prion disease cell model. AB are the results of mtROS levels detected by flow cytometry analysis. CF is the content of malondialdehyde, GSH / GSSG, catalase and total SOD activity in N2a cells.

[0027] Figure 5This is one of the research results on the protective effect of irisin in the prion disease model. AC is the mRNA levels of UCP2, UCP4 and UCP5. DE is the change of UCP2 protein expression in N2a cells after PrP106-126 treatment.

[0028] Figure 6 This is the second result of the study on the protective effect of irisin in the prion disease model. A is the immunofluorescence co-localization detection of mitochondrial markers DsRed-Mito and UCP2, scale bar: 10μm. B is the immunofluorescence co-localization detection of FITC-irisin and UCP2, scale bar: 10μm. C is the determination of N2a cell apoptosis by TUNEL staining, scale bar: 50μm.

[0029] Figure 7 The results of the study on irisin alleviating oxidative stress and maintaining mitochondrial function. A is the measurement of mitochondrial morphology by confocal microscopy. Scale bar: 10 μm. B is the result of observing the ultrastructure of cell mitochondria using transmission electron microscopy. Scale bar: 500 nm. C and E are the results of JC-1 analysis by flow cytometry. D is the result of mitochondrial length analysis by ImageJ software.

[0030] Figure 8 The results of the study on irisin alleviating oxidative stress and maintaining mitochondrial function. A is the ATP level. B is the ratio of mtDNA / nDNA. CF is the activity of mitochondrial respiratory chain complexes (I-IV) detected by microplate luminometer.

[0031] In each figure (if available), * represents P < 0.05, ** represents P < 0.01, and *** represents P < 0.001. DETAILED DESCRIPTION

[0032] The preferred embodiments of the present invention will be described in detail below in conjunction with examples. It should be understood that the following examples are provided only for the purpose of illustration and are not intended to limit the scope of the present invention. Those skilled in the art may make various modifications and substitutions to the present invention without departing from the purpose and spirit of the present invention.

[0033] The experimental methods used in the following examples are conventional methods unless otherwise specified. The materials, reagents, etc. used in the following examples are commercially available or prepared according to conventional methods in the art unless otherwise specified.

[0034] Example 1

[0035] 1 Materials and Methods

[0036] 1.1 Cell culture

[0037] N2a neuroblastoma cell line (ATCC#CCL-131) was purchased from the Cell Resource Center of the Chinese Academy of Medical Sciences / Peking Union Medical College and verified to be free of mycoplasma contamination. These cells were cultured in Gibco DMEM medium (Catalog No. C11995500BT) supplemented with 10% fetal bovine serum (Gibco, USA) at 37°C, 5% CO2 environment, and maintained in a humidified atmosphere.

[0038] PrP 106-126 The peptide was provided by Amy Peptide Biotechnology Co., Ltd. with a purity of more than 98% and a sequence of KTNMKHMAGAAAAGAVVGGLG (SEQ ID No. 1). The peptide was dissolved in 0.1 M PBS to a storage concentration of 1 mM and stirred at 4° C. for 24 hours to promote aggregation.

[0039] PrP 106-126 Experimental group: The experiment was carried out under sterile conditions, and PrP was added to N2a cells at a final concentration of 150 μM. 106-126 Peptide.

[0040] Irisin (HY-P70665, MCE, USA) was dissolved in DMEM to prepare a 1 mg / ml stock solution and stored at -20°C.

[0041] PrP 106-126 +Irisin experimental group: Irisin was added to N2a cells at a final concentration of 100 ng / ml. PrP was added at a final concentration of 150 μM 2 hours after irisin administration. 106-126 Peptide.

[0042] Irisin experimental group: Irisin was added to N2a cells at a final concentration of 100 ng / ml.

[0043] The control group (Control) did not receive any treatment.

[0044] 1.2 Plasmids and transfection

[0045] UCP2 siRNA (sense: 5'-CTAUGAAAUCTUUGGGCUUTT-3' (SEQ ID No. 2); antisense: 5'-AAGCCCAAAGAUUUCAUAGTT-3' (SEQ ID No. 3)) and plasmid pcDNA3.1 (+) -UCP2 were purchased from Synbio Technologies. DsRed-Mito plasmid was purchased from Clontech. N2a cells were transfected in Opti-MEM (31985062, Gibco, California, USA) using Lipofectamine 3000 (L3000015, Invitrogen, Carlsbad, CA, USA).

[0046] PrP 106-126 +Irisin+siUCP2 experimental group: cells were transfected with UCP2 siRNA for 24 hours and irisin (final concentration was 100 ng / ml) was added, and PrP was added 2 hours after irisin administration. 106-126 Peptide (final concentration 150 μM).

[0047] PrP 106-126 +siUCP2 experimental group: cells were transfected with UCP2 siRNA and PrP was added 24 hours later 106-126 Peptide (final concentration 150 μM).

[0048] Ctlr+siRNA experimental group: cells were transfected with UCP2 siRNA.

[0049] PrP 106-126 +OEUCP2 experimental group: cells were transfected with plasmid pcDNA3.1(+)-UCP2 and PrP was added 24 hours later 106 -126 Peptide (final concentration 150 μM).

[0050] 1.3 Flow cytometry detection of cell apoptosis

[0051] In order to quantify the apoptotic rate of cells, PrP 106-126 Experimental group, irisin + PrP 106-126The cells of the experimental group, irisin experimental group and control group were digested with 0.25% trypsin and neutralized with 10% FBS. The cell suspension was then centrifuged at 3000 rpm for 5 minutes, washed once with PBS, and stained with Annexin V-FITC and propidium iodide (PI) solution (C1062, Beyotime Biotechnology, China) at room temperature for 15 minutes. The percentage of apoptotic cells in each sample was then analyzed using a BD FACSCalibur flow cytometer (BD Biosciences, USA). The results are shown in Figure 1 AB in.

[0052] 1.4 TUNEL analysis

[0053] PrP was detected using a one-step TUNEL apoptosis assay kit (C1086, Beyotime, Shanghai, China). 106-126 Experimental group, irisin + PrP 106-126 Experimental group, irisin experimental group, control group, PrP 106-126 +Irisin+siUCP2 experimental group, PrP 106-126 +siUCP2 experimental group, Ctlr+siRNA experimental group and PrP 106-126 Apoptosis in N2a cells of the +OEUCP2 experimental group. Initially, N2a cells were seeded in 24-well plates and prepared according to the manufacturer's instructions before each treatment. Subsequently, apoptosis was carefully observed and analyzed using an A1 confocal microscope (Nikon). The results are shown in Figure 1 CD in Figure 6 C in.

[0054] 1.5 Assessment of mitochondrial function

[0055] PrP was measured using Mitosox (Thermo Fisher Scientific, Sunnyvale, CA, USA). 106 -126 Experimental group, irisin + PrP 106-126 Experimental group, irisin experimental group, control group, PrP 106-126 +Irisin+siUCP2 experimental group, PrP 106-126 +siUCP2 experimental group, Ctlr+siRNA experimental group and PrP 106-126Mitochondrial reactive oxygen species in N2a cells of the +OEUCP2 experimental group. Mitochondrial membrane potential was assessed using the JC-1 Mitochondrial Membrane Potential Assay Kit (C2005, Beyotime, Shanghai, China). Cells were incubated in JC-1 staining solution at 37 °C with 5% CO2 for 20 min, and samples were analyzed using flow cytometry. ATP levels were measured using an ATP assay kit (S0026, Beyotime, Shanghai, China) and a microreader from Biotek (Beijing, China). All procedures were performed according to the manufacturer's instructions. Results are shown in Figure 3 C, D, F, Figure 7 C,E in Figure 8 A in.

[0056] 1.6 DNA extraction and mtDNA copy number determination

[0057] PrP was isolated from the genomic DNA using a universal genomic DNA extraction kit (CW2298S, CWBIO, CEAN, China). 106-126 Experimental group, irisin + PrP 106-126 Experimental group, irisin experimental group, control group, PrP 106-126 +Irisin+siUCP2 experimental group, PrP 106-126 +siUCP2 experimental group, Ctlr+siRNA experimental group and PrP 106-126 Total DNA was isolated from N2a cells in the +OEUCP2 experimental group and quantified using a spectrophotometer (Nanodrop 2000). The experiment used the VIIA7 Fast Real-Time PCR System (ABI) and SYBR Green Master Mix (Q141-02; Vazyme, Nanjing, China) for QPCR. Quantification was based on mtDNA (forward: 5′-CCTATCCCTTGCCATCAT-3′ (SEQ ID No. 4) and reverse: 5′-GAGGCTTGTTGCTTGTGTGTGTGTGAC-3′ (SEQ ID No. 5)) and genomic DNA (gDNA) using the comparative CT method (2 -ΔΔCT ) is used for calculation. The results are shown in Figure 3 The E in Figure 8 B in.

[0058] 1.7 Measurement of mitochondrial respiratory chain complexes

[0059] The activities of mitochondrial respiratory chain complexes I, II, III, and IV were assessed according to the manufacturer’s instructions (Solarbio, Solarbio, Beijing, Chine, China). PrP was measured using a microreader from Biotek (Beijing, China). 106-126 Experimental group, irisin + PrP 106-126 Experimental group, irisin experimental group, control group, PrP 106-126 +Irisin+siUCP2 experimental group, PrP 106-126 +siUCP2 experimental group, Ctlr+siRNA experimental group and PrP 106-126 Determination of the +OEUCP2 experimental group. The results are shown in Figure 3 GJ in Figure 8 CF in.

[0060] 1.8 Oxidative stress measurement

[0061] Antioxidant defense markers in N2a cells, including superoxide dismutase (SOD), catalase (CAT), malondialdehyde (MDA), and glutathione / oxidized glutathione ratio (GSH / GSSG). 106-126 Experimental group, irisin + PrP 106-126 Experimental group, irisin experimental group, control group, PrP 106-126 +Irisin+siUCP2 experimental group, PrP 106 -126 +siUCP2 experimental group, Ctlr+siRNA experimental group and PrP 106-126 +OEUCP2 experimental group, the glutathione ratio (GSH / GSSG) was evaluated following the manufacturer's instructions (Nanjing Jianering Bibionering Instristions). Superoxide dismutase (SOD), catalase (CAT), and malondialdehyde (MDA) were measured. These assays were performed using a microplate reader from Biotek (Beijing, China). To determine the content of mtROS in cells, cells were digested with 0.25% trypsin and then neutralized with 10% fetal bovine serum to neutralize protein hydrolysis. The cell suspension was centrifuged at 3000 rpm for 5 min, washed once with PBS, and the cells were mixed with MitoSOX (2 μM, Thermo Fisher Scientific, Sunnyvale, CA, USA) for 30 min, followed by two PBS washes and flow cytometric analysis (BD Biosciences, Franklin Lakes, NJ, USA). The results are shown in Figure 4 AF in .

[0062] 1.9 Immunofluorescence staining

[0063] PrP 106-126 Experimental group, irisin + PrP 106-126 Experimental group, irisin experimental group, control group, PrP 106-126 +Irisin+siUCP2 experimental group, PrP 106-126 +siUCP2 experimental group, Ctlr+siRNA experimental group and PrP 106-126 +OEUCP2 experimental group was tested. Compared with the preparation method of the above experimental groups, before treatment, for the experimental groups that originally did not have a transfection step, this experiment changed to adding a step of transfecting mitochondrial N2a cells with DSRED-MITO for 24 hours. For the experimental groups that originally had a transfection step, DSRED-MITO was added at the same time as transfection to co-treat mitochondrial N2a cells for 24 hours before performing subsequent operations in each group. The cells were washed twice with PBS and fixed with 4% paraformaldehyde for 30 minutes. The cells were then permeabilized with an immunostaining permeabilization buffer containing Triton X-100 (Beyotime Biotechnology, p0096) for 5 minutes. After blocking for one hour at room temperature, the cells were incubated with specific primary antibodies overnight at 4°C (as described in the "Immunoblotting" section). The secondary antibody was applied at 37°C for 1 hour, and then the slides were sealed with an antifade containing DAPI. Fluorescence images were acquired using an A1 confocal microscope (Nikon, Tokyo) and quantified using ImageJ software. Results are shown in Figure 3 AB in Figure 6 AB in Figure 7 A, D in.

[0064] 1.10 Western blotting

[0065] Targeting PrP 106-126 Experimental group, irisin + PrP 106-126The experimental group, irisin experimental group, and control group were homogenized with RIPA buffer (R0010, Solarbio Life Sciences, Chine Beijing, China). After recovery, the lysate was incubated on ice for 30 minutes and centrifuged at 12,000 rpm for 10 minutes at 4°C. The protein concentration was determined using the BCA method. Equal amounts of protein were resolved on a 10%-15% SDS-PAGE gel and then transferred to a PVDF membrane using a standard protocol. The following primary antibodies were used for blotting: Caspase 3 (19677-1-AP, ProteinIntech), Caspase 9 (10380-1AP, ProteinIntech), Bax (50599-2-Ig, ProteinIntech), BCL2 (68103-1-ig, ProteinIntech), Cytochrome c (66264-1-IG, ProteinIntech), UCP2 (11081-1-AP, ProteinIntech), Cox IV (11242-1-ap, ProteinIntech), GAPDH (60004-1-Ig, ProteinIntech) and α-tubulin (11224-1-AP, Proteintech). Secondary antibodies included HRP-conjugated goat anti-mouse (ZB-2305, ZSBIO) and HRP-conjugated goat anti-rabbit (ZB-2301, ZSBIO). Blots were visualized using a chemiluminescent imaging system (Tanon Science & Technology). Figure 2 AG in Figure 5 DE in.

[0066] 1.11 Real-time quantitative PCR

[0067] Targeting PrP 106-126For the experimental group and the control group, the N2a cell samples obtained from the experiment were first homogenized using TRIZOL reagent (R401-01, Vazyme, Nanjing, China). Total RNA was extracted from the homogenized tissue following the manufacturer's guidelines. After determining the concentration of the RNA sample, 1 μg of RNA was transcribed using Hisscript II Select SuperMix (R312-02, Vazyme, Nanjing, Chine) to produce cDNA. The experiment was analyzed using real-time quantitative PCR (QPCR), which was performed using gene-specific primer sets and SYBR green master mix (Q141-02; Vazyme, Nanjing, China). The fluorescence changes were monitored using the VIIA 7 Fast Real-Time PCR System (ABI) to record and analyze the experimental process. The primers used are listed in Table 1. The results are shown in Figure 5 AC in.

[0068] Table 1 Primer sequences (SEQ ID No.6-13)

[0069] Gene name Upstream primer sequence (5′-3′) Downstream primer sequence (5′-3′) UCP2 TAAAGGTCCGCTTCCAGGCTCA TAAAGGTCCGCTTCCAGGCTCA UCP4 TCTACGGGAAGTCGTGTTTGGC AACTGTCCGATGACACCAGCCA UCP5 GTGCTGCAATCGTTGTGGGAGT GCCAAACCACAGGTGAAACTGG GAPDH CATCACTGCCACCCAGAAGACTG ATGCCAGTGAGCTTCCCGTTCAG

[0070] 1.12 Electron Microscope

[0071] PrP 106-126 Experimental group, irisin + PrP 106-126 Experimental group, control group, PrP 106-126 +Irisin+siUCP2 experimental group, PrP 106-126 +siUCP2 experimental group, Ctlr+siRNA experimental group and PrP 106-126 +OEUCP2 experimental group, N2a cells were collected, centrifuged in a centrifuge tube, and then fixed with 2.5% glutaraldehyde at 4°C for 12 hours. The samples were then observed using a transmission electron microscope (HITACHI HT7700, Japan). The results are shown in Figure 7 B in.

[0072] 1.13 Statistical analysis

[0073] Data are expressed as mean ± standard deviation (SD) and analyzed using Prism 8.0 software. Statistical comparisons were performed using unpaired Student's t-test or Tukey's post hoc test for multiple comparisons. Differences were considered statistically significant at p < 0.05.

[0074] 2 Results

[0075] 2.1 Irisin reduces apoptosis induced by prion disease model

[0076] The present invention uses the method of combining Annexin V with fluorescent labeling to evaluate the effect of irisin on PrP 106-126 The results showed that PrP 106-126 Compared with the control group, the apoptosis of cells in the PrP 106 -126 In cells treated with irisin, this increase was significantly reduced. TUNEL staining results also showed that compared with PrP alone, 106-126 Compared with the treatment with irisin, the pretreatment with irisin significantly reduced cell apoptosis. In addition, Western blot analysis revealed that irisin treatment significantly reduced the cleavage of caspase-3 and caspase-9, reduced Bax protein expression, increased Bcl-2 expression and reduced cyt C release, all of which indicated that irisin could alleviate the mitochondrial-dependent apoptosis pathway ( Figure 1 , 2).

[0077] 2.2 Irisin alleviates neuronal mitochondrial dysfunction in prion disease models

[0078] In evaluating the effect of irisin on PrP 106-126 In the control group, N2a cells showed an intact mitochondrial network, while PrP 106-126 The treated group showed significant disruption of the mitochondrial network, indicating damage to the mitochondrial structure. In contrast, cells in the irisin-treated group showed an improvement in the state of the mitochondrial network. 106-126 The low mitochondrial membrane potential in the treated group further indicated impaired mitochondrial function. The addition of irisin led to the restoration of mitochondrial membrane potential, suggesting that irisin could prevent PrP 106-126 In addition, ATP is a key indicator of cellular energy metabolism. 106-126 The ATP level in the irisin-treated group was significantly decreased, while the ATP level in the irisin-treated group was significantly increased, indicating that irisin may promote the recovery of mitochondrial function by improving energy metabolism. The changes in mitochondrial membrane potential and ATP level were accompanied by changes in the activity of mitochondrial respiratory chain complexes (Complex I-IV). 106-126 Treatment with irisin significantly reduced the activity of these complexes, while the addition of irisin significantly increased their activity and increased the copy number of mitochondrial DNA. In summary, irisin effectively restored the activity of PrP 106 -126 Induced mitochondrial dysfunction ( Figure 3 ).

[0079] 2.3 Irisin alleviates neuronal oxidative stress in a prion disease cell model

[0080] Given that oxidative stress is a key factor in inducing mitochondrial dysfunction, in the present invention, its effect on PrP 106-126 The experimental results showed that irisin treatment significantly reduced PrP 106-126 In addition, compared with the levels of mitochondrial reactive oxygen species in PrP alone, 106-126 Treatment with irisin significantly reduced the level of malondialdehyde (MDA) in cells, increased the ratio of reduced glutathione (GSH) to oxidized glutathione (GSSG), and increased the activities of catalase (CAT) and total superoxide dismutase (T-SOD). These results consistently indicate that irisin can alleviate PrP 106-126 Induced mitochondrial dysfunction is achieved by protecting against oxidative stress ( Figure 4 ).

[0081] 2.4 Irisin exerts its protective effect in prion disease models via UCP2

[0082] The results of the present invention show that PrP 106-126 After treatment, the expression levels of UCP4 and UCP5 were not changed, but the expression level of UCP2 was reduced. In contrast, irisin treatment enhanced the colocalization of UCP2 with mitochondria and upregulated the expression of PrP 106-126 To understand the effect of irisin on PrP 106-126 The potential mechanism of UCP2 protection after treatment, the present invention uses FITC-labeled irisin to treat PrP 106-126 The results showed that colocalization of FITC-irisin and UCP2 was observed in N2A cells after FITC-irisin treatment. 106-126 The present invention found that irisin failed to alleviate PrP in cells with UCP2 knockdown. 106-126 Induced apoptosis, while UCP2-overexpressing cells were sensitive to PrP 106-126 This suggests that UCP2 plays a role in the regulation of irisin on PrP 106-126 played a key role in the protection provided by treated N2a cells ( Figure 5 , 6).

[0083] 2.5 Irisin alleviates oxidative stress and maintains mitochondrial function through UCP2

[0084] To further explore the role of UCP2 in irisin-mediated PrP 106-126The effects of irisin on oxidative stress and mitochondrial dysfunction in N2a cells treated with siRNA were investigated. By knocking down UCP2 using siRNA, the present invention found that the mitigating effect of irisin on mtROS generation was attenuated after UCP2 knockdown. The present invention found that UCP2 knockdown offset the irisin-mediated reduction of PrP 106-126 The beneficial effects of irisin on lipid peroxidation and oxidative damage in N2a cells treated with irisin were not altered, as evidenced by the unchanged MDA, GSH / GSSG, CAT activity, and T-SOD levels. Furthermore, in cells where UCP2 expression was knocked down, irisin had a negative effect on PrP 106-126 The induced N2a cell mitochondrial function lost its protective effect. When the expression of UCP2 was reduced, irisin treatment could not restore the mitochondrial network state, and the electron microscopy results showed abnormal mitochondrial ultrastructure, but irisin treatment and UCP2-overexpressing cells remodeled mitochondrial cristae and reduced swelling. In addition, the reduction of mitochondrial membrane potential, ATP level, mtDNA copy number and electron transport chain complex activity (I-IV) also confirmed this. These results show that irisin alleviates PrP through the expression of UCP2. 106-126 Induced oxidative stress and mitochondrial dysfunction ( Figure 7 , 8).

[0085] 3 Conclusion

[0086] Prion diseases are a group of fatal neurodegenerative diseases characterized by abnormal folding of cellular prion proteins into pathogenic forms. The development of prion diseases is closely related to oxidative stress and mitochondrial dysfunction. Irisin is an endogenous myokine that protects the health of neurons through its antioxidant properties. However, it is not clear whether irisin has any protective effect on prion diseases. The present invention found that exogenous irisin treatment can alleviate cell apoptosis caused by prion disease stimulation. At the same time, exogenous irisin significantly alleviates oxidative stress caused by prion disease stimulation. In addition, exogenous irisin can alleviate mitochondrial dysfunction caused by prion disease stimulation. And irisin treatment can target UCP2 and significantly improve oxidative stress and mitochondrial dysfunction caused by prion disease-induced N2a cells. The above-mentioned effects of irisin in prion disease cell models are blocked by knockdown of UCP2. These results show that irisin is a new and promising early intervention method for the treatment of prion diseases.

[0087] In summary, the present invention found that the oxidative stress induced in the prion disease model can lead to mitochondrial dysfunction, which may be one of the causes of prion disease. Irisin can reduce the oxidative stress caused by the prion disease model and alleviate the mitochondrial dysfunction caused by it by activating UCP2. In short, these data show that irisin has potential therapeutic value in prion disease.

[0088] Although the present invention has been described in detail above with general descriptions and specific embodiments, it is obvious to those skilled in the art that some modifications or improvements may be made thereto based on the present invention. Therefore, these modifications or improvements made without departing from the spirit of the present invention all fall within the scope of protection claimed by the present invention.

Claims

1. The application of irisin in the preparation of drugs for treating neuronal apoptosis caused by prion disease stimulation.

2. The use of irisin in the preparation of drugs for treating oxidative stress in nerve cells caused by prion disease stimulation.

3. Use of irisin in the preparation of a drug for treating any of the following conditions caused by prion disease stimulation: (1) Increased levels of mitochondrial reactive oxygen species in nerve cells; (2) Increased malondialdehyde in nerve cells; (3) The ratio of reduced glutathione to oxidized glutathione in nerve cells decreases; (4) Decreased catalase activity in nerve cells; (5) The total superoxide dismutase activity in nerve cells is reduced.

4. The use of irisin in the preparation of drugs for treating mitochondrial dysfunction of nerve cells caused by prion disease stimulation.

5. Use of irisin in the preparation of drugs for treating decreased mitochondrial membrane potential of neurons, decreased energy metabolism of neurons, decreased activity of Complex I-IV of the mitochondrial respiratory chain of neurons, or decreased mitochondrial DNA copy number of neurons caused by prion disease stimulation.

6. Use of irisin in the preparation of drugs for enhancing the colocalization of UCP2 with mitochondria and / or increasing the expression of UCP2 in nerve cells.

7. Use of irisin in reducing neuronal apoptosis caused by prion disease stimulation for non-disease diagnosis or treatment purposes.

8. Use of irisin in reducing oxidative stress in nerve cells caused by prion disease stimulation for non-disease diagnosis or treatment purposes.

9. Use of irisin in reducing mitochondrial dysfunction in nerve cells caused by prion disease stimulation for non-disease diagnosis or treatment purposes.

10. Use of irisin for enhancing the colocalization of UCP2 with mitochondria and / or increasing the expression of UCP2 in neural cells for non-disease diagnosis or treatment purposes.

Images