Fish vibriosis recombinant adenovirus vaccine as well as preparation method and application thereof

Abstract

The invention relates to the technical field of biological medicines, and particularly discloses a fish vibriosis recombinant adenovirus vaccine as well as a preparation method and application thereof. A replication-defective recombinant adenovirus vector is utilized to prepare the vibriosis recombinant adenovirus vaccine, and the preparation method comprises the following steps: cloning a vibrio anguillarum flaA gene, constructing a Pshuttle-CMV-ECMV vector with a target gene, obtaining a recombinant adenovirus plasmid, screening to obtain a recombinant adenovirus, and preparing the recombinant adenovirus vaccine. The fish vibriosis recombinant adenovirus vaccine prepared by the invention can be used for immunizing and preventing infection of vibrio anguillarum in a juvenile fish stage in a soaking manner, and the vaccine has a wide application prospect in the aspect of prevention and control of fish vibriosis after being subjected to animal safety tests.

Description

Technical Field

[0001] The present invention relates to the technical field of biomedicine, and in particular to a recombinant adenovirus vaccine for fish vibriosis and a preparation method and application thereof. Background Art

[0002] Vibrio anguillarum, belonging to the genus Vibrio in the family Vibrionaceae, is a pathogen that causes hemorrhagic septicemia in marine fish. As a normal flora in the aquatic environment, Vibrio anguillarum will proliferate rapidly when the water temperature is high and nutrients are rich, especially in water bodies with high stocking density, high salinity and high organic matter content. In addition, stress states such as parasitic infection and mechanical damage can also accelerate the occurrence of the disease. The main virulence factors of Vibrio anguillarum include flagellin, extracellular protease, exopolysaccharide, siderophore, hemolysin and adhesion factor, among which flagella and pili are essential for the ability to infect fish. Studies have shown that flagellin flaA has significant pathogenicity and is a potential immunogen for vaccine development. Fish infected with Vibrio anguillarum can show chronic infection, skin ulcers, and acute and subacute infections, the latter of which is characterized by systemic hemorrhagic septicemia. Initial symptoms include darkening of body color, decreased appetite, imbalance, and abdominal swelling and skin bleeding in some fish. Pathological changes mainly include liver congestion, spleen enlargement and kidney liquefaction necrosis. Chronically infected fish may develop muscle granulomatous necrosis and eye damage, such as corneal edema, ulcers and proptosis.

[0003] At present, vaccines for Vibrio anguillarum mainly include inactivated vaccines and attenuated vaccines. Most commercial vaccines use inactivated strains to retain their immunogenicity and stimulate host immune responses. However, the immunogenicity of inactivated vaccines is usually limited, and although attenuated vaccines have good immunogenicity, there is a risk of recovery mutation and side effects.

[0004] In recent years, recombinant adenovirus vectors have attracted widespread attention as a new approach to vaccine development. Recombinant adenovirus vectors have high titer, high efficiency, and will not integrate exogenous genes into the host genome. They have been widely used in gene expression and vaccine delivery. This vector can effectively transfer target genes to a variety of cell lines and stimulate the body to produce effective and lasting specific humoral and cellular immune responses. Recombinant adenovirus vectors were infected with a variety of teleost cell lines by immersion, showing extremely high infection efficiency and inducing effective mucosal immunity and T cell immune responses. In addition, adenovirus vectors can induce mucosal immune responses that are more effective than parenteral immunization in a variety of animals, showing a long-lasting immune response ability. These characteristics make recombinant adenovirus vectors a promising vaccine candidate for preventing fish Vibrio disease, and provide new ideas and methods for the development of fish Vibrio disease immersion vaccines. Summary of the invention

[0005] The present invention provides a recombinant adenovirus vaccine for fish vibriosis and a preparation method and application thereof, which are used to solve the problem of aquaculture losses caused by infection with Vibrio anguillarum in the current fish aquaculture process.

[0006] The present invention adopts the following technical scheme: a recombinant adenovirus vaccine for fish vibriosis, wherein the antigen protein of the recombinant adenovirus vaccine contains the flaA gene of Vibrio anguillarum, and the nucleotide sequence of the antigen of the recombinant adenovirus vaccine is shown in SEQ ID NO: 1.

[0007] The preparation method of the recombinant adenovirus vaccine for fish vibriosis comprises the following steps: (1) The flaA gene of Vibrio anguillarum was analyzed, and primers Van-flaA-F and Van-flaA-R were designed to perform PCR amplification using DNA of Vibrio anguillarum as a template. The homologous sequence and restriction site of the Pshuttle-CMV-ECMV vector were added to primers Van-flaA-F and Van-flaA-R, respectively; (2) Construction of a Pshuttle-CMV-ECMV vector carrying the flaA gene of Vibrio anguillarum: The cloned flaA gene of Vibrio anguillarum was cloned into the Pshuttle-CMV-ECMV vector by homologous recombination technology to construct a Pshuttle-CMV-ECMV vector carrying the flaA gene of Vibrio anguillarum, named Pshuttle-CMV-ECMV / Van-flaA; (3) Obtaining a recombinant adenovirus plasmid: homologously recombining the obtained recombinant adenovirus vector Pshuttle-CMV-ECMV / Van-flaA with the PAd-easy-1 vector in Escherichia coli BJ5183 to construct a recombinant adenovirus plasmid; (4) Screening and obtaining recombinant adenovirus: The screened recombinant adenovirus positive plasmid was digested with Pac Ⅰ and then used to transfect HEK293 cells to obtain a recombinant adenovirus carrying the Vibrio anguillarum flaA gene; (5) Preparation of recombinant adenovirus vaccine for vibriosis: After the harvested recombinant adenovirus carrying the flaA gene of Vibrio anguillarum is subcultured, the expression of the target antigen protein is detected. The recombinant adenovirus that can express the protein after detection is inoculated into HEK293 cells for multiple subcultures, repeated freezing and thawing, and the virus titer is measured. The high-titer recombinant adenovirus is used to prepare the recombinant adenovirus vaccine for vibriosis.

[0008] Furthermore, the nucleotide sequence of the primer Van-flaA-F is shown in SEQ ID NO:2.

[0009] Furthermore, the nucleotide sequence of the primer Van-flaA-R is shown in SEQ ID NO:3.

[0010] Furthermore, the virus titer in step (5) must be greater than 1×10 8 mL-1TCID50.

[0011] Furthermore, 1 ml of the high-titer recombinant adenovirus in step (5) is used to infect cultured HEK293 cells. 72 hours after infection, the HEK293 cells and the supernatant are repeatedly frozen and thawed three times, followed by centrifugation at 3500-4000 rpm / min for 8-12 minutes, and the supernatant is taken to prepare a recombinant adenovirus vaccine for vibriosis.

[0012] The invention discloses an application of a recombinant adenovirus vaccine for fish vibriosis and an application of the vaccine in the preparation of fish anti-Anguillarum anguillarum drug.

[0013] The invention discloses an application of a recombinant adenovirus vaccine for fish vibriosis, and an application of the vaccine in preparing an immersion preparation for fish to resist fish vibriosis virus.

[0014] Beneficial effects of the present invention: (1) The present invention amplifies the flagellin flaA gene in Vibrio anguillarum, connects it to the Pshuttle-CMV-ECMV vector, and after PCR screening, homologously recombines with the PAd-easy-1 backbone vector to construct a replication-deficient recombinant adenovirus plasmid. After transfecting cells with the plasmid, a replication-deficient recombinant adenovirus containing the target gene is obtained. The recombinant adenovirus after detection is inoculated into HEK293 cells for multiple passages, and a high-titer recombinant adenovirus is selected to prepare a recombinant adenovirus vaccine for vibriosis, which has high vaccine stability; (2) The recombinant adenovirus vaccine prepared by the present invention can be used for immunization by immersion, and can be used for immersion immunization in fish seedlings. It has been proven to be safe, effective, and non-toxic through animal safety tests. It is convenient and simple to use clinically and is suitable for large-scale application. It has broad application prospects in the prevention and control of Vibrio anguillarum in fish farming. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] Figure 1 This is a diagram verifying the construction process of the recombinant adenovirus vector of the Vibrio anguillarum flaA gene of the present invention: A: Identification of PCR products of Vibrio anguillarum flaA gene: Lane 1, DNA Maker; Lane 2: PCR amplification products of Vibrio anguillarum flaA gene; Lane 3: blank control.

[0016] B: PCR amplification and double restriction digestion results of the recombinant plasmid: Lane 1, DNA Maker; Lane 2, Sal I and XhoⅠ double restriction digestion results; Lane 3, PCR amplification results; Lane 4, empty vector PCR amplification results.

[0017] C: Identification of recombinant adenovirus vector: Lane 1, DNA Maker; Lane 2, Pac I digestion result of recombinant adenovirus plasmid; Lane 3, flaA gene PCR amplification result; Lane 4, blank control.

[0018] Figure 2 This is the result of green fluorescence expression of the Vibrio anguillarum flaA recombinant adenovirus vaccine of the present invention: A: GFP expression in HEK293 cells infected with recombinant adenovirus; B: HEK293 cells blank control group.

[0019] Figure 3 The figures are Western-blot detection results of the expression of Vibrio anguillarum flaA protein by the recombinant adenovirus of Vibrio anguillarum flaA of the present invention: Lane 1, expression result of recombinant adenovirus M protein harvested from HEK293 cells; Lane 2, recombinant empty vector virus control group harvested from HEK293 cells; Lane 3, HEK293 cell blank control group.

[0020] Figure 4 This is a graph showing the survival rate of zebrafish after being treated with the Vibrio anguillarum flaA recombinant adenovirus vaccine of the present invention for 7 days.

[0021] Figure 5 This is a diagram showing the effect of the Vibrio anguillarum flaA recombinant adenovirus vaccine of the present invention in preventing and treating Vibrio disease in zebrafish. DETAILED DESCRIPTION

[0022] In order to enable those skilled in the art to better understand the scheme of the present invention, the technical scheme in the embodiment of the present invention will be clearly and completely described below in conjunction with the drawings in the embodiment of the present invention. Obviously, the described embodiment is only a part of the embodiment of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative work should fall within the scope of protection of the present invention.

[0023] Human embryonic kidney 293 cells (HEK293 cells) adhered to the wall and grew in a cell culture medium in a constant temperature incubator at 5% CO2 and 37°C. DMEM medium (Gibco) containing 10% fetal bovine serum, 100U / ml penicillin and 100mg / ml streptomycin was used as the cell culture medium for HEK293 cells; DMEM medium containing only 2% fetal bovine serum was used as the maintenance medium for HEK293 cells during virus culture.

[0024] The Vibrio anguillarum in the present invention is stored in the National Aquatic Animal Pathogen Bank of the Ministry of Agriculture and Rural Affairs.

[0025] The DNA purification and recovery kit and plasmid extraction kit in the examples are products of Tiangen Biochemical Technology (Beijing) Co., Ltd.

[0026] The high-fidelity enzyme premix in the examples was purchased from Nanjing Novozyme Biotech Co., Ltd.

[0027] Example 1: Construction of a recombinant adenovirus vector of Vibrio anguillarum flaA gene: (1) Cloning of the flaA gene of Vibrio anguillarum: First, the DNA template of flaA of Vibrio anguillarum was amplified by PCR using the cDNA of Vibrio anguillarum as a template using the primer Van-flaA-F (5'-ATTGCGGCCGC GCCACCATGACCATTACAGTAAATAC -3') with the sequence shown in SEQ ID NO:2 and the primer Van-flaA-R (5'-CCGCTCGAGCTGCAATAGTGACATTGCAG-3') with the sequence shown in SEQ ID NO:3. The specific steps are as follows: Van-flaA-F 1μL (10μM), Van-flaA-R 1μL (10μM), Vibrio anguillarum cDNA 1μL, high-fidelity enzyme premix 10μL, add nuclease-free pure water to 20μL, and perform PCR amplification according to the following program: 1 cycle (95℃ 3min), 35 cycles (95℃ 10s, 58℃ 30s, 72℃ 30s), 1 cycle (72℃ 5min), and store at 4℃.

[0028] After the PCR amplification, agarose electrophoresis was performed to verify the results of the PCR of the Vibrio anguillarum flaA gene. After obtaining a single target fragment of the Vibrio anguillarum flaA gene, a DNA purification and recovery kit was used to purify the above PCR product. The results were as follows: Figure 1 As shown in A. Figure 1 As shown in the result in middle A, the DNA template of the flaA gene of Vibrio anguillarum was successfully amplified.

[0029] (2) Construction of Pshuttle-CMV-ECMV vector carrying the flaA gene of Vibrio anguillarum: The purified flaA gene of Vibrio anguillarum was double-digested with Not I and Xho I restriction endonucleases to produce compatible sticky ends. The Pshuttle-CMV-EGFP vector was also double-digested with Not I and Xho I restriction endonucleases to match the ends of the flaA gene of Vibrio anguillarum. The digested flaA gene of Vibrio anguillarum and the Pshuttle-CMV-EGFP vector were ligated overnight at 16°C using T4 DNA ligase to form a recombinant DNA molecule. The ligation product was transformed into Escherichia coli DH5α competent cells. The transformed cells were spread on LB agar plates containing kanamycin and inverted for 12-16 hours. Smaller single colonies were selected from the cultured plates and transferred to liquid culture medium containing kanamycin for expansion culture for 12 hours. PCR identification was performed on the cultured bacterial liquid to confirm the insertion of the target gene of Vibrio anguillarum flaA. The bacterial solution with the same PCR identification results as the target size was further expanded and cultured, and then the plasmid DNA was extracted using a plasmid extraction kit and sequenced to verify the sequence correctness of the recombinant plasmid; the results are as follows Figure 1 As shown in B.

[0030] like Figure 1 As shown in B, the flaA fragment of Vibrio anguillarum was successfully homologously recombined into the Pshuttle-CMV-EGFP vector.

[0031] (3) Obtaining the Pshuttle-CMV-EGFP / Van-flaA recombinant adenovirus plasmid: First, the Pshuttle-CMV-EGFP / V. anguillarum flaA vector was digested with Pme I to obtain a linearized vector. Subsequently, the linearized Pshuttle-CMV-EGFP / Van-flaA vector was transformed into BJ5183 competent cells, which already contained the PAd-easy-1 auxiliary vector, by heat shock. The transformation operation included mixing 5 μL of purified linearized vector with 50 μL of BJ5183 competent cells, followed by heat shock treatment at 42°C for 80 seconds. After heat shock, the recombinant mixture was spread on an LB plate containing 100 μg / mL kanamycin for screening. The PCR product was detected by 0.8% agarose gel electrophoresis to confirm the insertion of the target gene. After a large number of positive products were cultured, the plasmid DNA was extracted and digested with Pac I restriction enzyme to verify the correctness of the recombinant adenovirus plasmid. The selected positive plasmids were further transformed into Stbl3 competent cells by heat shock method to obtain a large amount of high-quality plasmid DNA. The selected positive clones were again digested with Pac I to ensure that the plasmid construction was correct. Finally, the positive digestion products were recovered and prepared for the next transfection experiment; the results are shown in Figure 1 As shown in C.

[0032] like Figure 1 As shown in the result in Figure C, the Pshuttle-CMV-EGFP / Van-flaA recombinant adenovirus plasmid was successfully obtained.

[0033] (4) Screening for Vibrio anguillarum flaA recombinant adenovirus: The positive recombinant adenovirus plasmid obtained in the previous step was digested with Pac I to remove the Ori original and kanamycin resistance gene, thereby exposing the inverted terminal repeat sequence (ITR) and packaging signal of the adenovirus. The linearized recombinant adenovirus plasmid was transfected into HEK293 cells using liposomes.

[0034] The specific steps are as follows: 24 hours before transfection, HEK293 cells in the logarithmic growth phase were taken, the cells were digested with trypsin digestion solution, and then diluted with cell culture medium to a cell density of 1×10 7 cells / ml, form a cell suspension, add the above cell suspension at 5ml / bottle into 25cm 2The cells were placed in a cell culture flask and cultured in a cell culture incubator with a CO2 volume content of 5% and a temperature of 37°C. When the cell adhesion rate reached 60~70%, transfection was performed. 30μL LipofectamineTM 3000 was mixed with 900μL DMEM cell culture medium, and 4μg of linearized recombinant adenovirus plasmid was added. After incubation at room temperature for 20 minutes, the mixture was added to the cells and cultured at 37°C for 4 hours. Subsequently, the culture medium was removed and supplemented with 10mL of cell maintenance medium containing 10% FBS, and the culture was continued. The transfection efficiency was evaluated by monitoring the intracellular GFP expression and cytopathic effect (ME). When a large amount of GFP expression was observed in the cells, 5mL of the upper cell maintenance medium was gently removed, and the remaining culture medium was collected for virus passaging and amplification. The results are as follows. Figure 2 shown.

[0035] like Figure 2 The results showed that a large amount of GFP fluorescence could be observed in HEK293 cells transfected with adenovirus vaccine plasmid Vibrio anguillarum flaA 48 hours after transfection, while no GFP fluorescence was observed in the negative control HEK293 cells, indicating that the adenovirus vaccine plasmid Vibrio anguillarum flaA was successfully constructed.

[0036] (5) Preparation of recombinant adenovirus vaccine for vibriosis: HEK293 cells in the logarithmic growth phase were digested with trypsin and then diluted with cell culture medium to a cell density of 1×10 7 cells / ml, form a cell suspension, add the above cell suspension at 5ml / bottle into 25cm 2 The cells were cultured in a cell culture flask in a cell culture incubator with CO 2The volume content was 5% and the temperature was 37°C. When the cell adhesion rate reached 60-70%, the culture medium was removed and the culture medium containing the virus collected in the previous step was added. When a large amount of GFP expression was observed in the cells, the virus solution of HEK293 cells was collected, and then the cells were lysed using RIPA lysis buffer. After lysis, the protein sample was broken by ultrasound and centrifuged at 12000rpm for 10 minutes at 4°C to separate the supernatant. The supernatant was mixed with 6× Loading Buffer and then heated at 95°C for 10 minutes to denature the protein. Then, the treated protein sample was loaded into the SDS-PAGE electrophoresis gel well for electrophoresis separation. The electrophoresis conditions were set to 80V for 1 hour, and then the voltage was increased to 120V until the end of electrophoresis. Using β-actin as an internal reference, the protein bands to be tested in the gel were cut according to the protein molecular weight standard, and these protein bands were transferred to the PVDF membrane. The transfer conditions were electrophoresis at 200mA for 2 hours. After the membrane transfer was completed, the PVDF membrane was blocked in a 5% skim milk powder solution for 1 hour to reduce nonspecific binding. After blocking, the membrane was incubated with a 1:1000 diluted GFP antibody overnight to specifically bind the target protein. The next day, the membrane was washed 3 times with PBST buffer for 10 minutes each to remove unbound antibodies. After that, the membrane was incubated with a 1:2000 diluted goat anti-mouse secondary antibody for 2 hours and then washed 3 times with PBST buffer for 10 minutes each to remove excess secondary antibody. Finally, the developer was added and the chemiluminescent reaction on the membrane was detected to evaluate the expression of the target protein in the recombinant adenovirus.

[0037] For recombinant adenovirus that can stably express the target protein, it was inoculated into HEK293 cells and passaged multiple times. After each harvest of the virus solution, it was repeatedly frozen and thawed 2 to 3 times to release the virus particles. By measurement, when the titer of the recombinant virus reached 1×10 8 mL-1 TCID50, the recombinant adenovirus stock solution was used to prepare the recombinant adenovirus vaccine of Vibrio anguillarum. HEK293 cells in the logarithmic growth phase were taken, digested with trypsin digestion solution, and then diluted with cell culture medium to a cell density of 1×10 7 cells / ml, form a cell suspension, add the above cell suspension at 5ml / bottle into 25cm 2The cell culture flask was placed in a cell culture incubator for culture. The CO2 volume content in the cell culture incubator was 5% and the temperature was 37°C. When the cell adhesion rate reached 60-70%, the culture medium was removed, and 1 ml of the recombinant adenovirus collected in the previous step was added to infect the cultured HEK293 cells. After culturing for 1 hour, 4 ml of HEK293 cell maintenance medium was added. After culturing for 72 hours, the above HEK293 cells and the supernatant were repeatedly frozen and thawed 3 times, and then centrifuged at 4000 rpm / min for 10 minutes. The supernatant was taken, which was the recombinant adenovirus vaccine for Vibrio anguillarum. The recombinant adenovirus vaccine components for vibriosis disease include a recombinant adenovirus capable of expressing the flaA gene of Vibrio anguillarum and HEK293 cell maintenance medium. The results are as shown in Figure 3 shown.

[0038] like Figure 3 The results showed that HEK293 cells infected with the recombinant adenovirus vaccine of Vibrio anguillarum flaA could stably express the Vibrio anguillarum flaA protein, while HEK293 cells infected with the recombinant empty vector adenovirus and blank HEK293 cells did not express the Vibrio anguillarum flaA protein. This indicates that the recombinant adenovirus vaccine of Vibrio anguillarum flaA can successfully express the target protein Vibrio anguillarum flaA, and the recombinant adenovirus vaccine of Vibrio anguillarum flaA is successfully constructed.

[0039] Example 2: Safety and efficacy verification of recombinant adenovirus vaccine for vibriosis: In order to comprehensively evaluate the safety of the recombinant adenovirus vaccine in the present invention for preventing Vibrio anguillarum and ensure its safety in clinical application, a series of safety tests were conducted on the vaccine in accordance with the provisions of the Chinese Veterinary Pharmacopoeia. Zebrafish were selected as experimental animals in the test, and the titer of the recombinant adenovirus vaccine used was 1×10 9 mL -1 TCID50.

[0040] In the experimental design, the first group of zebrafish were immersed in 1×10 9 mL -1 The TCID50 recombinant adenovirus vaccine was used to prepare a recombinant adenovirus vaccine soaking preparation capable of immersion immunization, and the recombinant adenovirus vaccine soaking preparation was used for immunization for 15 minutes; the second group of zebrafish was inoculated with 0.01 mL of the recombinant adenovirus vaccine per tail by injection; the third group of zebrafish served as an unvaccinated control group. During the experiment, all experimental groups of zebrafish were closely monitored for clinical adverse reactions, and the number of dead fish was recorded every day within 7 days after immunization. In addition, the length and weight changes of each group of fish were regularly measured and recorded within 60 days after vaccination. The results are as follows Figure 4 shown.

[0041] according to Figure 4The results shown in the figure show that, while the zebrafish in the control group grew well, no fish deaths were observed in the first two groups vaccinated within 7 days, and no clinical adverse reactions were found. Moreover, compared with the control group, there was no significant difference in the length and weight of the fish in the vaccinated group after 60 days. These results show that the recombinant adenovirus vaccine has high safety and can achieve good immune effects whether it is immunized by immersion or injection.

[0042] Example 3: Application of recombinant adenovirus vaccine for vibriosis: Four-month-old zebrafish were selected and vaccinated by immersion. 1×10 9 mL -1 The TCID50 recombinant adenovirus vaccine was used to prepare a recombinant adenovirus vaccine soaking preparation capable of soaking immunization, and the recombinant adenovirus vaccine soaking preparation was used for immunization for 15 minutes. In order to ensure the controllability of the experiment, a negative control group without vaccination was also established. The experimental fish were cultured in a circulating aquaculture system at 28°C. After a 28-day immunization period, all zebrafish were intraperitoneally injected with 20μL of Vibrio anguillarum with OD600=0.5. During the subsequent observation period, the survival and death of each group of zebrafish were recorded every day, and a survival curve was drawn based on these data to evaluate the protective effect of the vaccine. The results are shown in Figure 5 shown.

[0043] according to Figure 5 The experimental results shown in the figure show that the zebrafish vaccinated with the recombinant adenovirus vaccine against Vibrio anguillarum flaA had a mortality rate of approximately 20% during the 20-day observation period. In contrast, the mortality rate of the negative control group zebrafish that were not vaccinated reached 100% during the same period of time. This significant difference indicates that the recombinant adenovirus vaccine against Vibrio anguillarum flaA vaccinated by immersion has an 80% protective efficacy against Vibrio anguillarum infection in zebrafish.

[0044] The above shows and describes the basic principles and main features of the present invention and the advantages of the present invention. It should be understood by those skilled in the art that the present invention is not limited to the above embodiments. The above embodiments and descriptions are only for explaining the principles of the present invention. Without departing from the spirit and scope of the present invention, the present invention may have various changes and improvements, which fall within the scope of the present invention to be protected. The scope of protection of the present invention is defined by the attached claims and their equivalents.

Claims

1. A recombinant adenovirus vaccine for fish vibriosis, characterized in that: The antigen protein of the recombinant adenovirus vaccine contains the Vibrio anguillarum flaA gene, and the nucleotide sequence of the antigen of the recombinant adenovirus vaccine is shown in SEQ ID NO:

1.

2. The method for preparing the recombinant adenovirus vaccine for fish vibriosis according to claim 1, characterized in that: The steps include: (1) The flaA gene of Vibrio anguillarum was analyzed, and primers Van-flaA-F and Van-flaA-R were designed to perform PCR amplification using DNA of Vibrio anguillarum as a template. The homologous sequence and restriction site of the Pshuttle-CMV-ECMV vector were added to primers Van-flaA-F and Van-flaA-R, respectively; (2) Construction of a Pshuttle-CMV-ECMV vector carrying the flaA gene of Vibrio anguillarum: The cloned flaA gene of Vibrio anguillarum was cloned into the Pshuttle-CMV-ECMV vector by homologous recombination technology to construct a Pshuttle-CMV-ECMV vector carrying the flaA gene of Vibrio anguillarum, named Pshuttle-CMV-ECMV / Van-flaA; (3) Obtaining a recombinant adenovirus plasmid: homologously recombining the obtained recombinant adenovirus vector Pshuttle-CMV-ECMV / Van-flaA with the PAd-easy-1 vector in Escherichia coli BJ5183 to construct a recombinant adenovirus plasmid; (4) Screening and obtaining recombinant adenovirus: The screened recombinant adenovirus positive plasmid was digested with Pac Ⅰ and then used to transfect HEK293 cells to obtain a recombinant adenovirus carrying the Vibrio anguillarum flaA gene; (5) Preparation of recombinant adenovirus vaccine for vibriosis: After the harvested recombinant adenovirus carrying the flaA gene of Vibrio anguillarum is subcultured, the expression of the target antigen protein is detected. The recombinant adenovirus that can express the protein after detection is inoculated into HEK293 cells for multiple subcultures, repeated freezing and thawing, and the virus titer is measured. The high-titer recombinant adenovirus is used to prepare the recombinant adenovirus vaccine for vibriosis.

3. The method for preparing the recombinant adenovirus vaccine for fish vibriosis according to claim 2, characterized in that: The nucleotide sequence of the primer Van-flaA-F is shown in SEQ ID NO:

2.

4. The method for preparing the recombinant adenovirus vaccine for fish vibriosis according to claim 2, characterized in that: The nucleotide sequence of the primer Van-flaA-R is shown in SEQ ID NO:

3.

5. The method for preparing the recombinant adenovirus vaccine for fish vibriosis according to claim 2, characterized in that: The virus titer in step (5) must be greater than 1×10 8 mL -1 TCID50.

6. The method for preparing the recombinant adenovirus vaccine for fish vibriosis according to claim 2, characterized in that: In step (5), 1 ml of the high-titer recombinant adenovirus is taken to infect cultured HEK293 cells. After 72 hours of infection, the HEK293 cells and the supernatant are repeatedly frozen and thawed three times, followed by centrifugation at 3500-4000 rpm / min for 8-12 minutes, and the supernatant is taken to prepare a recombinant adenovirus vaccine for vibriosis.

7. Use of the recombinant adenovirus vaccine for fish Vibrio disease as claimed in claim 1 in the preparation of fish anti-Anguillarum medicament.

8. Use of the recombinant adenovirus vaccine for fish vibriosis as claimed in claim 1 in the preparation of an immersion preparation for fish against fish vibriosis virus.

Images