A recombinant adenovirus vaccine for fish vibriosis and a preparation method and application thereof

Abstract

The application relates to the technical field of biological medicine, and particularly discloses a fish vibriosis recombinant adenovirus vaccine and a preparation method and application thereof. A vibriosis recombinant adenovirus vaccine is prepared by using a replication-defective recombinant adenovirus vector, and the preparation method comprises the following steps: cloning of a Vibrio anguillarum flaA gene, construction of a Pshuttle-CMV-ECMV vector with the target gene, obtaining of a recombinant adenovirus plasmid, screening of the obtained recombinant adenovirus, and preparation of the recombinant adenovirus vaccine. The fish vibriosis recombinant adenovirus vaccine prepared by the application can be used for immunoprophylaxis of Vibrio anguillarum infection in the juvenile fish stage through a soaking mode, the vaccine has passed an animal safety test, and has a wide application prospect in the prevention and control of fish vibriosis.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of biological medicine, and particularly relates to a recombinant adenovirus vaccine for fish vibrio disease, a preparation method and application thereof. BACKGROUND

[0002] Vibrio anguillarum, belonging to the genus Vibrio in the family Vibrionaceae, is a pathogenic bacterium that causes hemorrhagic septicemia in marine fish. As a normal flora in the water environment, Vibrio anguillarum can proliferate rapidly when the water temperature is high and the nutrient salt is rich, especially in water bodies with high stocking density, high salinity and high organic matter content. In addition, parasitic infection, mechanical damage and other stress states can also accelerate the occurrence of disease. The main virulence factors of Vibrio anguillarum include flagellin, extracellular protease, exopolysaccharide, siderophore, hemolysin and adhesion factor, etc., among which flagella and pili are crucial for the ability to infect fish. Studies have shown that flagellin flaA has significant pathogenicity and is a potential immunogen for vaccine development. Fish infected with Vibrio anguillarum can exhibit chronic infection, skin ulceration, and acute and subacute infection, the latter of which is characterized by systemic hemorrhagic septicemia. Initial symptoms include darkening of body color, decreased appetite, and balance disorders, and some fish may have abdominal swelling and skin bleeding. Pathological changes mainly include liver congestion, splenomegaly and kidney liquefactive necrosis. Fish with chronic infection may have muscle granulomatous necrosis and eye damage, such as corneal edema, ulceration and exophthalmos, etc.

[0003] At present, Vibrio anguillarum vaccines mainly include inactivated vaccines and attenuated vaccines. Commercial vaccines mostly use inactivated strains to retain their immunogenicity and stimulate host immune response. However, the immunogenicity of inactivated vaccines is usually limited, while attenuated vaccines have good immunogenicity but have the risk of recovery mutation and side effects.

[0004] In recent years, recombinant adenovirus vectors have received extensive attention as a new approach to vaccine development. Recombinant adenovirus vectors have high titer and high efficiency, and do not integrate foreign genes into the host genome, and have been widely used in gene expression and vaccine delivery. This vector can effectively transfer the target gene to various cell lines and stimulate the body to produce effective and long-lasting specific humoral and cellular immune responses. Recombinant adenovirus vectors show extremely high infection efficiency by soaking a variety of hard bone fish cell lines and can induce effective mucosal immunity and T cell immune response. In addition, adenovirus vectors can induce more effective mucosal immune response than parenteral immunization in various animals, showing long-lasting immune response ability. These characteristics make recombinant adenovirus vectors a promising vaccine candidate for preventing fish vibrio disease, providing new ideas and methods for the development of fish vibrio disease soaking vaccines. SUMMARY

[0005] The application provides a recombinant adenovirus vaccine for fish vibriosis and a preparation method and application thereof, and aims at solving the problem of breeding loss caused by infection of Vibrio anguillarum.

[0006] The application adopts the following technical scheme: a recombinant adenovirus vaccine for fish vibriosis, wherein the antigen protein of the recombinant adenovirus vaccine contains a Vibrio anguillarum flaA gene, and the nucleotide sequence of the antigen of the recombinant adenovirus vaccine is shown in SEQ ID NO: 1.

[0007] The preparation method of the recombinant adenovirus vaccine for fish vibriosis comprises the following steps:

[0008] (1) The Vibrio anguillarum flaA gene is analyzed, primers Van-flaA-F and Van-flaA-R are designed, and the DNA of Vibrio anguillarum is used as a template to perform PCR amplification, wherein the primers Van-flaA-F and Van-flaA-R are added with the homologous sequence and the enzyme cutting site of the Pshuttle-CMV-ECMV vector respectively;

[0009] (2) The Pshuttle-CMV-ECMV vector with the Vibrio anguillarum flaA gene is constructed: the Vibrio anguillarum flaA gene cloned is cloned into the Pshuttle-CMV-ECMV vector through the homologous recombination technology, the Pshuttle-CMV-ECMV vector with the Vibrio anguillarum flaA gene is constructed, and is named as Pshuttle-CMV-ECMV / Van-flaA;

[0010] (3) The recombinant adenovirus plasmid is obtained: the obtained recombinant adenovirus vector Pshuttle-CMV-ECMV / Van-flaA is subjected to homologous recombination with the PAd-easy-1 vector in Escherichia coli BJ5183, and the recombinant adenovirus plasmid is constructed;

[0011] (4) The recombinant adenovirus is screened and obtained: the positive plasmid of the recombinant adenovirus screened is subjected to Pac I enzyme cutting, and is used for transfecting HEK293 cells, and the recombinant adenovirus with the Vibrio anguillarum flaA gene is obtained;

[0012] (5) The recombinant adenovirus vaccine for vibriosis is prepared: the harvested recombinant adenovirus with the Vibrio anguillarum flaA gene is subcultured, the expression of the target antigen protein is detected, the recombinant adenovirus capable of expressing the protein after detection is inoculated into HEK293 cells to perform multiple subcultures, repeated freeze-thawing and determination of virus titer, and the recombinant adenovirus vaccine for vibriosis is prepared by taking the recombinant adenovirus with high titer.

[0013] Further, the nucleotide sequence of the primer Van-flaA-F is shown in SEQ ID NO: 2.

[0014] Further, the nucleotide sequence of the primer Van-flaA-R is shown in SEQ ID NO: 3.

[0015] Further, the virus titer in the step (5) needs to be greater than 1x10 8 mL-1TCID50.

[0016] Further, in the step (5), 1ml of the recombinant adenovirus with high titer is taken to infect the cultured HEK293 cells, and after 72h of infection, the above-mentioned HEK293 cells are repeatedly frozen and thawed 3 times together with the supernatant, and then centrifuged at 3500-4000rpm / min for 8-12min, and the supernatant is taken to prepare the Vibrio disease recombinant adenovirus vaccine.

[0017] The application of the fish Vibrio disease recombinant adenovirus vaccine in the preparation of the fish anti-Vibrio anguillarum medicine.

[0018] The application of the fish Vibrio disease recombinant adenovirus vaccine in the preparation of the fish anti-Vibrio anguillarum medicine.

[0019] The beneficial effects of the present application are as follows:

[0020] (1) The present application amplifies the flagellin flaA gene in Vibrio anguillarum, connects it to the Pshuttle-CMV-ECMV vector, and after positive PCR screening, homologous recombination with the PAd-easy-1 backbone vector is performed to construct a replication-defective recombinant adenovirus plasmid, and after transfecting cells with the plasmid, a replication-defective recombinant adenovirus containing the target gene is obtained, and after detection, the recombinant adenovirus is inoculated into HEK293 cells for multiple passages, and a high-titer recombinant adenovirus is selected to prepare a Vibrio disease recombinant adenovirus vaccine, and the vaccine has high stability.

[0021] (2) The recombinant adenovirus vaccine prepared by the present application can be immunized by soaking, and can be soaked and immunized during the juvenile stage of fish, and the safety and effectiveness of the present animal safety test are proved, and there is no toxic side effect, and the clinical use is convenient and simple, and is suitable for large-scale application, and has a broad application prospect in the prevention and control of Vibrio anguillarum in fish culture. BRIEF DESCRIPTION OF DRAWINGS

[0022] Figure 1 The figure is for the construction process verification of the Vibrio anguillarum flaA gene recombinant adenovirus vector of the present application:

[0023] A: PCR product identification of Vibrio anguillarum flaA gene: Lane 1, DNA Maker; Lane 2, PCR amplification product of Vibrio anguillarum flaA gene; Lane 3, blank control.

[0024] B: PCR amplification and double enzyme digestion results of recombinant plasmid: Lane 1, DNA Maker; Lane 2, double enzyme digestion results of Sal I and Xho I; Lane 3, PCR amplification results; Lane 4, PCR amplification results of empty vector.

[0025] C: Identification of recombinant adenovirus vector: Lane 1, DNA Maker; Lane 2, Pac I enzyme digestion results of recombinant adenovirus plasmid; Lane 3, PCR amplification results of flaA gene; Lane 4, blank control.

[0026] Figure 2 The figure of green fluorescence expression results of the Vibrio anguillarum flaA recombinant adenovirus vaccine of the application is as follows:

[0027] A: GFP expression of HEK293 cells infected by the recombinant adenovirus; B: blank control group of HEK293 cells.

[0028] Figure 3 The figure of Western-blot detection results of Vibrio anguillarum flaA protein expressed by the Vibrio anguillarum flaA recombinant adenovirus of the application is as follows: Lane 1, M protein expression results of the recombinant adenovirus harvested from HEK293 cells; Lane 2, control group of the recombinant empty vector virus harvested from HEK293 cells; Lane 3, blank control group of HEK293 cells.

[0029] Figure 4 The figure of survival rate results of zebrafish treated by the Vibrio anguillarum flaA recombinant adenovirus vaccine of the application for 7 days is as follows.

[0030] Figure 5 The figure of the effect of the Vibrio anguillarum flaA recombinant adenovirus vaccine of the application on preventing and treating vibriosis on zebrafish is as follows. DETAILED DESCRIPTION

[0031] In order for those skilled in the art to better understand the solutions of the present application, the technical solutions in the embodiments of the present application will be described clearly and completely in combination with the drawings in the embodiments of the present application. Obviously, the described embodiments are only a part of the embodiments of the present application, rather than all the embodiments. Based on the embodiments in the present application, all other embodiments obtained by those skilled in the art without creative labor should belong to the protection scope of the present application.

[0032] Human embryonic kidney cells 293 (HEK293 cells) were adherent growth in cell culture medium, and were cultured in a constant temperature incubator at 37℃ with 5% CO2. DMEM medium (Gibco) containing 10% fetal bovine serum, 100 U / ml penicillin and 100 mg / ml streptomycin was used as the cell culture medium for HEK293 cells; DMEM medium containing only 2% fetal bovine serum was used as the maintenance solution for HEK293 cells during the virus culture process.

[0033] The Vibrio anguillarum in the present application is preserved in the National Aquatic Animal Pathogen Bank of the Ministry of Agriculture and Rural Affairs.

[0034] The DNA purification recovery kit and the plasmid extraction kit in the examples are products of Tiangen Biochemical Technology (Beijing) Co., Ltd.

[0035] The high-fidelity enzyme premix in the examples is purchased from Nanjing Novozyme Biotech Co., Ltd.

[0036] Example 1: Construction of a recombinant adenovirus vector of Vibrio anguillarum flaA gene:

[0037] (1) Cloning of Vibrio anguillarum flaA gene: First, the DNA template of Vibrio anguillarum flaA was amplified by PCR using Vibrio anguillarum cDNA as the template, with primer Van-flaA-F (5'- ATTTGCGGCCGC GCCACCATGACCATTACAGTAAATAC -3') sequence as SEQ ID NO: 2 and primer Van-flaA-R (5'-CCGCTCGAGCTGCAATAGTGACATTGCAG-3') sequence as SEQ ID NO: 3. The specific steps are as follows:

[0038] Van-flaA-F 1 μL (10 μM), Van-flaA-R 1 μL (10 μM), Vibrio anguillarum cDNA 1 μL, high-fidelity enzyme premix 10 μL, and supplement with nuclease-free water to 20 μL, PCR amplification was performed according to the following program, 1 cycle (95℃ 3min), 35 cycles (95℃ 10s, 58℃ 30s, 72℃ 30s), 1 cycle (72℃ 5min), 4℃ storage.

[0039] After PCR amplification, agarose electrophoresis was performed to verify the results of Vibrio anguillarum flaA gene PCR. After obtaining a single Vibrio anguillarum flaA gene fragment, the DNA purification recovery kit was used to purify the above-mentioned PCR product; the results are shown in Figure 1 A. As shown in Figure 1 A, the DNA template of Vibrio anguillarum flaA gene was successfully amplified.

[0040] (2) Construction of Pshuttle-CMV-ECMV vector with Vibrio anguillarum flaA gene: The purified Vibrio anguillarum flaA gene was double digested with Not I and Xho I restriction enzymes to generate compatible sticky ends. At the same time, Pshuttle-CMV-EGFP vector was also double digested with Not I and Xho I restriction enzymes to match the ends of Vibrio anguillarum flaA gene. The digested Vibrio anguillarum flaA gene and Pshuttle-CMV-EGFP vector were ligated with T4 DNA ligase at 16°C overnight to form recombinant DNA molecules. The ligation product was transformed into E. coli DH5a competent cells. The transformed cells were spread on LB agar plates containing kanamycin and incubated for 12-16 hours. Smaller single colonies were selected from the incubated plates and transferred into liquid medium containing kanamycin for 12 hours. The bacteria liquid was identified by PCR to confirm the insertion of Vibrio anguillarum flaA target gene. The bacteria liquid with the same size as the target size was further cultured, and then the plasmid DNA was extracted using a plasmid extraction kit and sequenced to verify the sequence correctness of the recombinant plasmid; the results are shown in Figure 1 B.

[0041] As shown in Figure 1 B, the Vibrio anguillarum flaA fragment was successfully homologously recombined into the Pshuttle-CMV-EGFP vector.

[0042] (3) Obtaining Pshuttle-CMV-EGFP / Van-flaA recombinant adenovirus plasmid: First, the Pshuttle-CMV-EGFP / Vibrio anguillarum flaA vector was digested with Pme I to obtain a linearized vector. Subsequently, the linearized Pshuttle-CMV-EGFP / Van-flaA vector was transformed into BJ5183 competent cells containing a PAd-easy-1 helper vector by heat shock method. The transformation operation included mixing 5 μL of purified linearized vector with 50 μL of BJ5183 competent cells, and then performing heat shock treatment at 42°C for 80 seconds. After heat shock, the recombination mixture was plated on LB plates containing 100 μg / mL kanamycin for screening. The PCR product was detected by 0.8% agarose gel electrophoresis to confirm the insertion of the target gene. The positive product was cultured in large quantities, and the plasmid DNA was extracted and identified by Pae I restriction enzyme digestion to verify the correctness of the recombinant adenovirus plasmid. The selected positive plasmid was further transformed into Stbl3 competent cells by heat shock method to obtain a large amount of high-quality plasmid DNA. The positive clones picked were identified again by Pae I enzyme digestion to ensure that the plasmid construction was correct. Finally, the positive enzyme digestion product was recovered and prepared for the next step of transfection experiment; the results are shown in Figure 1 FIG. 3C.

[0043] As shown in Figure 1 FIG. 3C, the Pshuttle-CMV-EGFP / Van-flaA recombinant adenovirus plasmid was successfully obtained.

[0044] (4) Screening and obtaining Vibrio anguillarum flaA recombinant adenovirus: The positive recombinant adenovirus plasmid obtained in the previous step was digested with Pae I to remove the Ori element and the kanamycin resistance gene, thereby exposing the inverted terminal repeat (ITR) and packaging signal of the adenovirus. The linearized recombinant adenovirus plasmid was transfected into HEK293 cells using liposomes.

[0045] The specific steps are as follows: 24 hours before transfection, logarithmically growing HEK293 cells were taken, and the cells were digested with trypsin digestion solution, and then diluted with cell culture medium to a cell density of 1 x 10 7 cells / ml to form a cell suspension. The cell suspension was added to 25 cm 2Cell culture flasks were placed in a cell culture incubator with a CO2 concentration of 5% and a temperature of 37°C. Transfection was performed when cell adhesion reached 60-70%. 30 μL of Lipofectamine™ 3000 was mixed with 900 μL of DMEM cell culture medium, followed by the addition of 4 μg of linearized recombinant adenovirus plasmid. After incubation at room temperature for 20 minutes, the mixture was added to the cells, and the cells were cultured at 37°C for 4 hours. Subsequently, the culture medium was removed, and 10 mL of cell maintenance medium containing 10% FBS was added, and the cells were cultured further. Transfection efficiency was assessed by monitoring intracellular GFP expression and cytopathic effect (ME). When high levels of GFP expression were observed in the cells, 5 mL of the supernatant cell maintenance medium was gently removed, and the remaining culture medium was collected for virus passage and amplification. Results are as follows: Figure 2 As shown.

[0046] like Figure 2 The results showed that HEK293 cells transfected with the adenovirus vaccine plasmid Vibrio anguillarum flaA exhibited abundant GFP fluorescence 48 hours after transfection, while no GFP fluorescence was observed in the negative control HEK293 cells. This indicates that the adenovirus vaccine plasmid Vibrio anguillarum flaA was successfully constructed.

[0047] (5) Preparation of recombinant adenovirus vaccine for vibriosis: HEK293 cells in the logarithmic growth phase were digested with trypsin digestion solution, and then diluted with cell culture medium to a cell density of 1×10⁻⁶. 7 The cell suspension was prepared by adding 5 ml of the cell suspension to a 25 cm³ / bottle. 2 The cells are placed in a cell culture incubator and cultured in a CO2 incubator. 2The volume content was 5%, and the temperature was 37℃. When the cell adhesion rate reached 60-70%, the culture medium was removed, and the virus-containing culture solution collected in the previous step was added. When a large number of GFP expression was observed in the cells, the virus solution of HEK293 cells was collected, and then the cells were lysed using RIPA lysis buffer. After lysis, the protein sample was broken up using ultrasonic waves, and centrifuged at 12000 rpm for 10 minutes at 4℃ to separate the supernatant. The supernatant was mixed with 6xLoading Buffer, and then heated at 95℃ for 10 minutes to denature the protein. Next, the treated protein sample was loaded into the SDS-PAGE electrophoresis gel well for electrophoretic separation, and the electrophoretic conditions were set to 80V for 1 hour, and then the voltage was increased to 120V until the electrophoresis was completed. Using β-actin as an internal reference, according to the protein molecular weight standard, the protein bands to be tested in the gel were cut off, and these protein bands were transferred to a PVDF membrane with a current of 200mA for 2 hours. After the membrane transfer was completed, the PVDF membrane was placed in a 5% skim milk solution for 1 hour to reduce non-specific binding. After blocking, the membrane was incubated with a 1:1000 dilution of GFP antibody overnight to specifically bind the target protein. The next day, the membrane was washed with PBST buffer 3 times for 10 minutes each time to remove unbound antibodies. Then, the membrane was incubated with a 1:2000 dilution of goat anti-mouse secondary antibody for 2 hours, and then washed with PBST buffer 3 times for 10 minutes each time to remove excess secondary antibody. Finally, the developer was added and the chemiluminescence reaction on the membrane was detected to evaluate the expression of the target protein in the recombinant adenovirus.

[0048] For the recombinant adenovirus capable of stably expressing the target protein, it was inoculated into HEK293 cells and passaged multiple times. After each virus solution was harvested, it was repeatedly frozen and thawed 2 to 3 times to release the virus particles. By determination, when the titer of the recombinant virus reached 1x10 8 mL-1 TCID50, the recombinant adenovirus vaccine of Vibrio anguillarum was prepared using the recombinant adenovirus stock solution. Logarithmic growth phase HEK293 cells were digested with trypsin digestion solution, and then diluted with cell culture medium to a cell density of 1x10 7 cells / ml to form a cell suspension, and the above cell suspension was added to 25cm 2The cell culture bottle is placed in a cell culture box, and the cell culture box has a CO2 volume content of 5% and a temperature of 37°C. When the cell adhesion rate reaches 60-70%, the culture medium is removed, 1 mL of the recombinant adenovirus collected in the previous step is added to infect the cultured HEK293 cells, the cells are cultured for 1 h, 4 mL of HEK293 cell maintenance solution is supplemented, and the cells are cultured for 72 h. The above-mentioned HEK293 cells and supernatant are repeatedly frozen and thawed for 3 times, and then centrifuged at 4000 rpm / min for 10 min, and the supernatant is taken. The supernatant is the recombinant adenovirus vaccine of Vibrio anguillarum. The recombinant adenovirus vaccine of Vibrio anguillarum includes a recombinant adenovirus capable of expressing the flaA gene of Vibrio anguillarum and a HEK293 cell maintenance solution. The results are shown in Figure 3 .

[0049] As Figure 3 shown in the results, the HEK293 cells infected with the recombinant adenovirus vaccine of Vibrio anguillarum flaA can stably express the flaA protein of Vibrio anguillarum, while the HEK293 cells infected with the recombinant empty vector adenovirus and the blank HEK293 cells do not express the flaA protein of Vibrio anguillarum, which indicates that the recombinant adenovirus vaccine of Vibrio anguillarum flaA can successfully express the target protein flaA of Vibrio anguillarum, and the recombinant adenovirus vaccine of Vibrio anguillarum flaA is successfully constructed.

[0050] Example 2: Safety effect verification of the recombinant adenovirus vaccine of Vibrio anguillarum disease

[0051] In order to comprehensively evaluate the safety of the recombinant adenovirus vaccine of Vibrio anguillarum in the present application for preventing Vibrio anguillarum, and to ensure the safety of its clinical application, a series of safety tests were conducted on the vaccine according to the provisions of the Chinese Veterinary Pharmacopoeia. Zebrafish was selected as the experimental animal, and the titer of the recombinant adenovirus vaccine used was 1 x 10 9 mL -1 TCID50.

[0052] In the experimental design, the first group of zebrafish was immunized by soaking with the recombinant adenovirus vaccine soaking preparation prepared by diluting 1 x 10 9 mL -1 TCID50 recombinant adenovirus vaccine with pure water at a ratio of 1:50, and the immunization lasted for 15 minutes; the second group of zebrafish was immunized by injection, with 0.01 mL of the recombinant adenovirus vaccine per fish; and the third group of zebrafish was used as a control group without vaccination. During the test period, all experimental groups of zebrafish were closely monitored for clinical adverse reactions, and the number of dead fish was recorded every day within 7 days after immunization. In addition, within 60 days after vaccination, the length and weight changes of the fish in each group were measured and recorded regularly. The results are shown in Figure 4 .

[0053] According to Figure 4The results showed that, with the control group exhibiting good zebrafish growth, no fish deaths or adverse clinical reactions were observed in either of the first two vaccinated groups within 7 days. Furthermore, compared to the control group, there were no significant differences in fish length and weight in the vaccinated groups after 60 days. These results indicate that the recombinant adenovirus vaccine has high safety and provides good immunization efficacy regardless of whether immersion or injection is used.

[0054] Example 3: Application of recombinant adenovirus vaccine for vibriosis:

[0055] Four-month-old zebrafish were selected and vaccinated by immersion using a 1×10⁻⁶ solution diluted with pure water at a ratio of 1:50. 9 mL -1 A recombinant adenovirus vaccine preparation using TCID50 was prepared for immersion immunization. Immunization was performed using this preparation for 15 minutes. To ensure the control effect, a negative control group (unvaccinated) was also established. Experimental fish were cultured in a recirculating aquaculture system at 28°C. After a 28-day immunization period, all zebrafish were intraperitoneally injected with 20 μL of *Vibrio anguillarum* (OD600 = 0.5). During the subsequent observation period, the survival and mortality of zebrafish in each group were recorded daily, and survival curves were plotted based on these data to evaluate the protective effect of the vaccine. Results are as follows: Figure 5 As shown.

[0056] according to Figure 5 The experimental results show that the mortality rate of zebrafish vaccinated with the Vibrio anguillarum flaA recombinant adenovirus vaccine was approximately 20% during the 20-day observation period. In contrast, the mortality rate of the unvaccinated negative control group zebrafish reached 100% during the same period. This significant difference indicates that the Vibrio anguillarum flaA recombinant adenovirus vaccine administered via immersion has an 80% protective efficacy against Vibrio anguillarum infection in zebrafish.

[0057] The foregoing has shown and described the basic principles, main features, and advantages of the present invention. Those skilled in the art should understand that the present invention is not limited to the above embodiments. The embodiments and descriptions in the specification are merely illustrative of the principles of the invention. Various changes and modifications can be made to the invention without departing from its spirit and scope, and all such changes and modifications fall within the scope of the present invention as claimed. The scope of protection of this invention is defined by the appended claims and their equivalents.

Claims

1. A recombinant adenovirus vaccine for fish against vibriosis, characterized in that: The antigen protein of the recombinant adenovirus vaccine contains Vibrio anguillarum flaA gene, the nucleotide sequence of the antigen of the recombinant adenovirus vaccine is shown in SEQ ID NO: 1, and the preparation method of the fish Vibrio disease recombinant adenovirus vaccine comprises the following steps: (1) The flaA gene of Vibrio anguillarum is analyzed, primers Van-flaA-F and Van-flaA-R are designed, and the DNA of Vibrio anguillarum is used as a template for PCR amplification, and the primers Van-flaA-F and Van-flaA-R are added with the homologous sequences and enzyme digestion sites of the Pshuttle-CMV-ECMV vector respectively; (2) Constructing the Pshuttle-CMV-ECMV vector with the flaA gene of Vibrio anguillarum: the cloned flaA gene of Vibrio anguillarum is cloned into the Pshuttle-CMV-ECMV vector through homologous recombination technology to construct the Pshuttle-CMV-ECMV vector with the flaA gene of Vibrio anguillarum, which is named as Pshuttle-CMV-ECMV / Van-flaA; (3) Obtaining the recombinant adenovirus plasmid: the obtained recombinant adenovirus vector Pshuttle-CMV-ECMV / Van-flaA is subjected to homologous recombination with the PAd-easy-1 vector in Escherichia coli BJ5183 to construct the recombinant adenovirus plasmid; (4) Screening the obtained recombinant adenovirus: the positive plasmid of the screened recombinant adenovirus is subjected to Pac I enzyme digestion and then used for transfecting HEK293 cells to obtain the recombinant adenovirus with the flaA gene of Vibrio anguillarum; (5) Preparing the Vibrio disease recombinant adenovirus vaccine: the harvested recombinant adenovirus with the flaA gene of Vibrio anguillarum is passaged, the expression of the target antigen protein is detected, the recombinant adenovirus capable of expressing the detected protein is inoculated into HEK293 cells for multiple passages, repeated freezing and thawing, and the virus titer is determined, and the Vibrio disease recombinant adenovirus vaccine is prepared by taking the recombinant adenovirus with high titer; The nucleotide sequence of the primer Van-flaA-F is shown in SEQ ID NO: 2; The nucleotide sequence of the primer Van-flaA-R is shown in SEQ ID NO: 3; The virus titer in step (5) should be greater than 1 x 10 8 mL -1 TCID50; In the step (5), 1 ml of the recombinant adenovirus with high titer is used to infect the cultured HEK293 cells, the above-mentioned HEK293 cells and supernatant are repeatedly frozen and thawed for 3 times after 72 hours of infection, and then centrifuged at 3500-4000 rpm / min for 8-12 min, and the supernatant is taken to prepare the Vibrio disease recombinant adenovirus vaccine.

2. The fish Vibrio disease recombinant adenovirus vaccine of claim 1 in the preparation of a zebrafish anti-Vibrio anguillarum drug.

3. The fish Vibrio disease recombinant adenovirus vaccine of claim 1 in the preparation of a zebrafish anti-fish Vibrio virus soaking preparation.

Images